Circular RNA for treating multiple endocrine tumor type I and application thereof

By developing circular RNA encoding Menin protein, the problem of type I treatment of multiple endocrine tumors was solved, and the effect of stably and continuously expressing Menin protein in cells was achieved, providing new anti-tumor treatment methods.

CN120099012APending Publication Date: 2025-06-06GUANGDONG PANGUARD CELL BIOLOGICAL TECH CO LTD
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510131232.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-06
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art cannot effectively treat multiple endocrine tumor type I. Traditional drugs can only relieve symptoms, cannot fundamentally treat or delay the progression of the disease, and surgical resection is at risk of recurrence.

Method used

A circular RNA encoding Menin protein was developed, whose structure consists of complementary arms, ribozyme sequence, IRES sequence, 5'UTR, open reading framework, 3'UTR, ribozyme sequence and complementary arms, and was obtained through in vitro synthesis and transcription, circularization, and digestion reactions to be used to treat multiple endocrine tumor type I.

Benefits of technology

By supplementing the missing Menin protein in cells, the circular RNA is stable in the cell and has a long half-life, which can effectively exert anti-tumor effects, provide sustained therapeutic effects, and detect high-level and stable expression of Menin protein in human immortalized parathyroid cell model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and provides circular RNA for treating multiple endocrine tumor type I and application of the circular RNA. According to the invention, after different optimization and design are carried out on the circular RNA for coding Menin, the circular RNA with relatively good expression level and long half-life period is finally obtained, and the anti-tumor effect is mainly achieved by supplementing cell-deficient Menin. Compared with the prior art, the circular RNA for expressing the Menin protein provided by the invention is more stable in intracellular expression and longer in half-life period. In an immortalized parathyroid gland cell model, the Menin protein can be expressed by transfecting the circular RNA for 6 hours, and the circular RNA has good treatment potential for multiple endocrine tumor type I.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular, relates to a circular RNA for treating multiple endocrine neoplasia type I and an application thereof. Background Art

[0002] Multiple endocrine neoplasia syndrome I (MEN1) is an autosomal dominant syndrome, typically characterized by parathyroid, pituitary and pancreatic neuroendocrine tumors, characterized by the presence of adenomatous lesions in at least two endocrine tissues. MEN1 is a rare disease with no cure. Traditional drug treatments all start with symptoms to relieve pain, but cannot fundamentally treat MEN1 or delay its progression. Surgical resection may carry a risk of recurrence.

[0003] Multiple endocrine neoplasia type I is associated with loss-of-function mutations in the MEN1 gene encoding the tumor suppressor protein Menin. Menin protein is expressed in all tissues of the human body, localized in the cell nucleus, and participates in epigenetic modification of genes, mainly playing a role in transcriptional regulation, genome stability, cell apoptosis, and cell cycle regulation.

[0004] Circular RNA (circRNA) is a special type of single-stranded closed circular RNA molecule in the cells of organisms. It has no free 5' end and 3' end. Most natural circRNAs do not have the function of encoding proteins. They mainly play an important role in regulating gene expression as non-coding RNAs. However, there are also a few circRNA molecules, such as circFBXW7 and circZNF609, that have the ability to encode proteins in cells. These circRNAs encoding polypeptides usually contain an internal ribosome entry site (IRES) upstream of their gene coding sequence to start the polypeptide chain synthesis process in a different way from mRNA. Therefore, the circular RNA expression system is another protein expression system in cells besides the mRNA expression system. Since the circular RNA expression system only needs to insert the IRES expression element upstream of the coding sequence in the circular RNA molecule, it does not rely on the special RNA terminal structure, and the circular RNA is more stable than mRNA, so the circular RNA expression system may become a more ideal protein expression system than the mRNA expression system. At present, there is no related circular RNA drug for the treatment of MEN1-deficient tumors, and further optimization and iteration are needed. Summary of the invention

[0005] The purpose of the present invention is to provide a circular RNA for treating multiple endocrine neoplasia type I and its application.

[0006] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a circular RNA for treating multiple endocrine neoplasia type I, wherein the circular RNA encoding sequence is the amino acid shown in SEQ ID NO:4.

[0007] The structure of the circular RNA of the present invention is as follows from the 5′ end to the 3′ end: complementary arm 1 (5′ homology arm)-ribozyme sequence I-IRES sequence-5′UTR-coding region sequence (open reading frame)-3′UTR-ribozyme sequence II-complementary arm 2 (3′ homology arm).

[0008] Wherein, the complementary arm 1 and the complementary arm 2 are complementary paired nucleotide sequences.

[0009] The coding region sequence is shown in SEQ ID NO:1.

[0010] Furthermore, the ribozyme sequence I encodes T4 bacteriophage thymidylate synthase (Td) ribozyme 1, and its nucleotide sequence is shown in SEQ ID NO:10.

[0011] Furthermore, the ribozyme sequence II encodes T4 bacteriophage thymidylate synthase (Td) ribozyme 2, and its nucleotide sequence is shown in SEQ ID NO:11.

[0012] Furthermore, the IRES sequence is shown in any one of SEQ ID NOs: 5-9.

[0013] Preferably, the IRES sequence is shown as SEQ ID NO:4.

[0014] Preferably, the sequence of the 5′UTR is as shown in SEQ ID NO:12.

[0015] Preferably, the sequence of the 3′UTR is as shown in SEQ ID NO:13.

[0016] In a second aspect, the present invention provides a nucleic acid construct, which can be transcribed to obtain a linear precursor RNA of the circular RNA.

[0017] In a third aspect, the present invention provides biological materials containing the nucleic acid construct, wherein the biological materials include but are not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria or transgenic cell lines.

[0018] In a fourth aspect, the present invention provides a method for preparing the circular RNA, comprising: cloning the nucleic acid construct into an expression plasmid to obtain a recombinant plasmid, and then sequentially performing in vitro transcription, cyclization and digestion reactions to obtain the circular RNA.

[0019] In a fifth aspect, the present invention provides the use of the circular RNA in the preparation of a drug or composition for treating multiple endocrine neoplasia type I.

[0020] In a sixth aspect, the present invention provides a drug complex for treating multiple endocrine neoplasia type I, wherein the circular RNA is complexed with one or more lipids to prepare liposomes, lipid nanoparticles or lipid complexes.

[0021] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0022] (I) The present invention optimizes the sequence by bioinformatics means, and finally selects 5 IRES elements after data screening, that is, the IRES sequences in the present invention are shown in SEQ ID NO: 5-9, and tests the circular RNA to screen out a new generation of circular RNA for treating multiple endocrine neoplasia type I with better comprehensive performance, which mainly exerts anti-tumor effects by supplementing the Menin protein missing in cells. It effectively fills the gap in the field of circular RNA treatment of multiple endocrine neoplasia type I.

[0023] (ii) The circular RNA of the present invention has a good duration of protein expression, and the circular RNA framework provided has a certain versatility and can replace other target proteins for related research.

[0024] (III) After optimizing and designing the coding region and IRES element of the circular RNA encoding Menin in different ways, the present invention finally obtains a circular RNA with a good expression level and a long half-life. Compared with the prior art, the circular RNA expressing the Menin protein provided by the present invention is more stably expressed in cells and has a longer half-life.

[0025] (IV) The circular RNA of the present invention detected high-level and stable expression of Menin protein in the human immortalized parathyroid cell model, providing a theoretical basis for the application of circular RNA in parathyroid glands; during the experimental period, the abundance of Menin protein expression did not show a significant decrease, and continuous expression was detected for at least 7 days.

[0026] Figure 1 The schematic diagram of the circular RNA structure encoding Menin protein of the present invention.

[0027] Figure 2 This is the structure of the circular RNA of the present invention.

[0028] Figure 3 This is the basic process for circular RNA drug development in a preferred embodiment of the present invention.

[0029] Figure 4 This is the sequencing result of the circular RNA junction in a preferred embodiment of the present invention.

[0030] Figure 5 This is the result of agarose gel analysis of the transcription reaction product in a preferred embodiment of the present invention.

[0031] Figure 6 The results of agarose gel analysis of the cyclization and digestion reaction products in the preferred embodiment of the present invention are shown.

[0032] Figure 7 In a preferred embodiment of the present invention, Western Blot was used to detect the expression of Menin circRNA in 293T cells.

[0033] Figure 8 Schematic diagram of different IRES elements for detecting Menin circRNA transfected 293T cells in a preferred embodiment of the present invention

[0034] Fig. 9 This is a schematic diagram of Western Blot detection of the expression of Menin circRNA in immortalized parathyroid cells in a preferred embodiment of the present invention. DETAILED DESCRIPTION

[0035] In view of the current situation that there is no relevant circular RNA technology encoding Menin protein for treating multiple endocrine neoplasia type I at home and abroad, the present invention provides a feasible in vitro synthesis method of circular RNA, and expresses therapeutic protein for treating multiple endocrine neoplasia type I in relevant human cell lines.

[0036] The present invention aims to provide a preparation method and application of circular RNA for treating multiple endocrine neoplasia type I.

[0037] The present invention adopts the following technical solution:

[0038] In one aspect, the present invention provides a circular RNA, the coding sequence of which is shown in SEQ ID NO: 1, and the amino acid sequence of which is shown in SEQ ID NO: 4. The circular RNA is synthesized in vitro, and the circular RNA can be used as an active ingredient to treat multiple endocrine neoplasia type I.

[0039] According to a specific embodiment of the present invention, the circular RNA molecule expression element is composed of complementary arm 1 (5' homologous arm), ribozyme sequence I, IRES sequence, 5'UTR, open reading frame (coding region sequence), 5'UTR, ribozyme sequence II and complementary arm 2 (3' homologous arm) connected in sequence from 5' end to 3' end.

[0040] According to a specific embodiment of the present invention, the complementary arm 1 and the complementary arm 2 are complementary paired nucleotide sequences.

[0041] The ribozyme I is T4 bacteriophage thymidylate synthase (Td) ribozyme 1, and its nucleotide sequence is 5′-gggaattctagagaaaatttcgtctggattagttacttatcgtgtaaaatctgataaatggaattggttctacataaatgcctaacgact atccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacat gcagctggatataattccggggtaagattaacgaccttatctgaacataacgctaccgtttaatattgcgtcatat-3′(SEQ ID NO: 10); the ribozyme II is T4 phage thymidylate synthase (Td) ribozyme 2, and its nucleotide sequence is 5′-ctcagtagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtaga caatcccgtgctaaattgtaggactgccctttaataaatacttctatatttaaagaggtatttatgaaaagcggaatttatcagattaaaaata ctttctctagagtcgacctgcag-3′ (SEQ ID NO: 11).

[0042] In another aspect, the present invention provides a DNA template that can be transcribed into a linear precursor RNA.

[0043] According to a specific embodiment of the present invention, preferably, the IRES sequence is 5′-ttaaaacagcggatgggtaccccaccatccgacccactgggtgtagtactctggtacttcgtacctttgtacgcctgttcttcccattg -3′

[0044] According to a specific embodiment of the present invention, the 5′UTR sequence is 5′-aaaaaaaaaaaaaccaaaaaaaaaaaaacaaaaaaaaaaataattgactaa-3′ (SEQ ID NO: 12).

[0045] According to a specific embodiment of the present invention, the 3′UTR sequence is 5′-gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctga-3′ (SEQ ID NO: 13).

[0046] In another aspect, the present invention provides a method for preparing the circular RNA, comprising:

[0047] (1) cloning a DNA fragment capable of being transcribed and cyclized to obtain the circular RNA into an expression plasmid to obtain a recombinant plasmid;

[0048] (2) The circular RNA is obtained after in vitro transcription, cyclization and digestion reactions.

[0049] The method of the present invention may also include conventional operations in the field, such as operations for extracting plasmids, etc.

[0050] According to a specific embodiment of the present invention, the conditions for in vitro transcription of the RNA are 35-38° C. and the reaction time is 2-8 hours; the conditions for the cyclization reaction are 42-60° C. and the reaction time is 5-30 minutes.

[0051] On the other hand, the present invention also provides the use of the circular RNA in treating multiple endocrine neoplasia type I.

[0052] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0053] Example 1 Optimization of circular RNA coding region sequence

[0054] This example provides a process for optimizing the sequence of the circular RNA coding region.

[0055] The present invention designs and optimizes the circular RNA coding region sequence. Among them, reducing the minimum free energy (Minimum Free Energy, MFE) can improve translation stability, avoid the use of rare codons, and improving the codon adaptation index (Codon Adaptation Index, CAI) can increase the circular RNA translation efficiency. The present invention screens and optimizes 3 sequences, as shown in SEQ ID NO: 1-3. The MFE and CAI indexes of the designed and optimized Menin sequence are better than the NCBI public sequence (CCDS8083.1); among them, the average MFE is -756.7kcal / mol, an increase of about 14.0%, and the average CAI is 0.91, an increase of about 8.79%.

[0056] Example 2 Preparation of circular RNA for treating multiple endocrine neoplasia type I

[0057] This embodiment provides a circular RNA for treating multiple endocrine neoplasia type I, wherein the 5′ homology arm of the circular RNA is sequentially connected to a ribozyme I sequence (SEQ ID NO: 10), a 5′UTR (SEQ ID NO: 12), a preferred IRES (SEQ ID NO: 4), and a coding region (SEQ ID NO: 1), and the 3′ homology arm of the circular RNA is sequentially connected to a ribozyme II (SEQ ID NO: 11) sequence and a 3′UTR (SEQ ID NO: 13). In the present invention, the schematic diagram of the structure of the circular RNA is as follows Figure 1 The structure of circular RNA is shown in Figure 2 The basic process of circular RNA drug development is as follows. Figure 3 shown.

[0058] The method for preparing the circular RNA active ingredient for multiple endocrine neoplasia type I comprises the following steps:

[0059] (1) synthesizing a DNA fragment corresponding to the active ingredient circular RNA in the multiple endocrine neoplasia type I, and cloning the DNA fragment into an expression plasmid to obtain a recombinant plasmid; (2) transferring the recombinant plasmid into a host cell to obtain a recombinant cell, extracting the plasmid from the amplified recombinant cell, and performing PCR amplification using the extracted plasmid as a template to obtain a DNA template for in vitro synthesis of RNA; (3) constructing an in vitro circRNA synthesis system including the DNA template, and obtaining the active ingredient circRNA through transcription, cyclization and digestion reactions.

[0060] In the present invention, a DNA fragment of the RNA is synthesized and transcribed, and the DNA fragment is cloned into an expression plasmid to obtain a recombinant plasmid. The present invention does not specifically limit the method for synthesizing the DNA fragment corresponding to the RNA, and a conventional DNA synthesis method can be used. In the specific implementation of the present invention, the DNA fragment is commissioned to be synthesized by a biotechnology company. In the present invention, the specific sequence of the DNA fragment is determined according to the principle of complementary base pairing. In the present invention, the expression plasmid is preferably a pUC57 plasmid. In the present invention, the DNA fragment is cloned into an expression plasmid by an enzyme cutting and connecting method. In the present invention, the DNA fragment is preferably double-digested by BamHI and HindIII enzymes to obtain an enzyme-digested DNA fragment; the expression plasmid is preferably double-digested by BamHI and HindIII enzymes to obtain an enzyme-digested plasmid; then the enzyme-digested DNA fragment and the enzyme-digested plasmid are connected to obtain a recombinant plasmid.

[0061] 1. Preparation of recombinant plasmid

[0062] (1) The target fragment and pUC57 plasmid were double-digested with BamHI and HindIII, respectively.

[0063] (2) In vitro ligation using T4 ligase.

[0064] (3) Transform competent E. coli and culture on Amp solid medium for 16 hours.

[0065] (4) Colony PCR: select colonies containing the target band for sequencing.

[0066] (5) The colonies that were sequenced correctly were expanded and the plasmids were extracted.

[0067] (6) In the present invention, the plasmid of the correctly sequenced recombinant cells is extracted; the present invention has no particular limitation on the method for extracting the plasmid, and preferably a plasmid extraction kit is used.

[0068] 2. DNA linearization

[0069] In a constant temperature reactor, a plasmid DNA linearization experiment was performed. The plasmid DNA linearization experiment was performed according to the following enzyme digestion reaction system:

[0070] Components Specification Dosage Plasmid DNA 10 μg rCutsmartbuffer 10× 10μL HimdⅢ endonuclease 5000U / mL 1μL Nuclease-free water Make up to 50 μL

[0071] The reaction was carried out at 37°C for 1 hour. EDTA was added to terminate the reaction.

[0072] Agarose gel electrophoresis: prepare 1% agarose gel (weigh 1g agarose and add it to 100mL TAE solution), add 10μL bromophenol blue to the enzyme digestion product, shake and mix, then spot the sample, take pictures of the agarose gel after electrophoresis and save it.

[0073] 3. Transcriptional response

[0074] After obtaining the DNA template, the present invention constructs an RNA in vitro synthesis system including the DNA template to perform in vitro synthesis of RNA to obtain RNA. In a constant temperature reactor, an RNA in vitro synthesis experiment is performed. The RNA in vitro synthesis system is as follows:

[0075] 1) Prepare the transcription system as follows:

[0076] Components Volume per tube (μL) 10× Transcription Buffer 2 UTP(100mM) 2 CTP (100 mM) 2 GTP (100 mM) 2 10%m6A+90%ATP(100mM) 2 Linearized DNA template 1 μg T7RNApolymeraseMix 2 RNase-free water Add to 20 μL

[0077] Prepare the above system in a sterile, clean 1.5 mL EP tube, blow gently to mix, and then dispense 20 μL of the system into 200 μL reaction tubes. Place the reaction tubes in a PCR instrument at 37°C for 2 hours. The experimental results are as follows: Figure 5 shown.

[0078] 2) Digestion of DNA linearization template: After the reaction is completed, add 1 μL DNase I to each tube and react at 37°C for 15 minutes.

[0079] 3) Purification of RNA transcripts: The transcribed RNA can be precipitated with lithium chloride solution, and then the protein and free nucleotides can be removed. The purified RNA can be stored at -80°C for downstream experiments or electrophoresis detection.

[0080] Add 30 μL of RNase-free water and 30 μL of 7.5 M lithium chloride to the 20 μL reaction mixture.

[0081] After mixing evenly, incubate at -20°C for 30 minutes, centrifuge at 12000g for 15 minutes at 4°C, and collect the precipitate.

[0082] Add 500 μL of 70% chilled ethanol to wash the RNA pellet.

[0083] Dissolve the RNA precipitate in 100 μL RNase-free water per reaction tube. Store the purified RNA solution at -80°C.

[0084] 4. Cyclization reaction

[0085] The linear RNA circularization system was prepared as follows:

[0086] Components Dosage 10× Buffer 5μL GTP (100 mM) 1μL Linear RNA 20 μg RNase-free water Add to 50 μL

[0087] The reaction solution was mixed evenly, reacted at 50° C. for 30 minutes, and stored at 4° C. After the DNA template was transcribed, part of the linear RNA was cyclized, and the cyclization rate was 56.5%; after the cyclization reaction, the cyclization rate of the intron self-cleaving ribozyme reaction product could reach 83%.

[0088] 5. Digestive reaction

[0089] The RNase R digestion reaction system was prepared as follows:

[0090] Components Dosage 10× Buffer 5μL RNaseR 1μL RNA 10 μg RNase-free water Add to 50 μL

[0091] The above RNA is a mixture of circular RNA and linear precursor RNA. It was digested with RNase R at 37°C for 30 minutes and then subjected to agarose gel electrophoresis. Figure 6 As shown, the results of RNase R cleavage experiments showed that the prepared circular RNA was more resistant to RNase R cleavage than linear precursor RNA.

[0092] Example 3 Validation of circular RNA circularization interface

[0093] The cDNA was reverse transcribed by random primers, and PCR primers were designed to detect whether the sequence of the circularized product was correct. The forward primer of PCR for identifying the circularized product was 5′-CTgTTAAAggAggCCgCTTC-3′, and the reverse primer was 5′-TCTCACCACGTCGTCGATG-3′.

[0094] The interface sequence of circularized RNA was amplified by PCR, and the PCR reaction system was as follows:

[0095] Components Dosage 2×TaqMasterMix 25μL Forward primer (10 μM) 2μL Reverse primer (10 μM) 2μL cDNA 1μL RNase-free water Add to 50 μL

[0096] The PCR reaction program was: 95°C pre-denaturation for 5 minutes; 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds, for a total of 30 cycles; and stored at 4°C. The PCR amplification product was then sequenced by the Sanger method. The sequencing peak results are shown in Figure 4 The sequencing results showed that the artificially designed T4 phage thymidylate synthase (Td) intron self-cleaving ribozyme can be used to accurately prepare circular RNA in vitro.

[0097] Example 4 Optimization of IRES sequence

[0098] The present invention confirms whether there is a better target protein expression efficiency after the IRES sequence of circular RNA is optimized through transfection at the cytological level and sample detection, and screens out sequences with excellent expression efficiency by comparison with a control group, thereby achieving the purpose of circular RNA sequence optimization.

[0099] The present invention synthesizes circular RNA with optimized IRES sequence in vitro, detects the expression efficiency of target protein at the in vitro cytological level of Menin circRNA, and screens out circular RNA with better expression efficiency. Among them, the circular RNA corresponding to the IRES sequence of SEQ ID NO: 5 has a good protein expression amount in 293T cells, which is better than other alternative sequences. The experimental results are shown in Figure 8 .

[0100] Example 5293T, SK-BR-3, and immortalized parathyroid cells culture

[0101] Experimental method: In vitro potency-Western Blot detection

[0102] (1) 293T cell culture: 293T cells were routinely cultured using DMEM medium containing 10% FBS (Situofan Biotechnology Co., Ltd., catalog number: SH30243.FS); when the cell confluence was greater than 80%, the cells were digested with 0.1% trypsin and passaged at a ratio of 1:3, and then placed at 37°C, 5% CO 2 The incubator was cultured normally.

[0103] (2) Immortalized parathyroid cell culture: Immortalized parathyroid cells were routinely cultured using primary epithelial cell basal medium (Cybecon, catalog number: iCell-0089a-001b) containing 2% FBS. When the cell confluence was greater than 80%, the cells were digested with 0.1% trypsin and passaged at a ratio of 1:3. The cells were placed at 37°C and 5% CO. 2 The incubator was cultured normally.

[0104] Example 6 Menin circRNA transfection cell experiment

[0105] (1) Cell counting: Take 293T cells in good growth condition, remove the culture medium, wash the cells with 10 mL PBS, add an appropriate amount of 0.25% trypsin to digest for 2 minutes, then add DMEM culture medium containing 10% FBS to neutralize the trypsin, gently pipette to mix and transfer to a 50 mL centrifuge tube, and take 0.2-0.6 mL of the cell suspension for counting.

[0106] (2) Cell inoculation: Take 1 mL of cell suspension and dilute it to 3.5×10 with DMEM medium containing 10% FBS. 5 / mL, pipette and mix; take 2mL of cell suspension and add it to a 6-well plate. Prepare 2 parallel wells of cells for each circular RNA sample, 1 well of cells for the control sample, and 1 well for the blank control. Place the 6-well plate in a 37°C, 5% CO2 incubator and culture overnight.

[0107] (3) Cell culture medium replacement: About 24 hours after inoculation, observe the cell status in the 6-well plate. The confluence is about 90%. In a biosafety cabinet, prepare DMEM complete culture medium containing 10% FBS. Discard the culture medium in the well plate 30 minutes before transfection and add 1 mL of fresh complete culture medium to each well.

[0108] (4) Prepare the transfection system: Take 100 μL Opti-MEM (Gibco, Catalog No.: 51985091), add 10 μL Lipofectamine 2000 (Thermo Fisher Scientific, Catalog No.: 51985091), mix by gently pipetting with a pipette, and incubate for 10 minutes; take another 100 μL Opti-MEM, add 4 μg circular RNA sample, mix by gently pipetting with a pipette, mix the two tubes thoroughly, and let stand for 15 minutes.

[0109] Directly and evenly add the prepared transfection system into the cultured cells and shake well to ensure that the transfection system is evenly distributed on the cells.

[0110] (5) Cell culture medium replacement: 6 hours after transfection, discard the old culture medium and replace each well with 2 mL of fresh complete culture medium.

[0111] (6) Cell sampling: harvest 24 hours after transfection. Aspirate the old culture medium and wash once with 1 mL PBS. Aspirate the PBS and continue to blow down the cells with 1 mL PBS. Collect them in a 1.5 mL centrifuge tube and centrifuge at 300g for 5 minutes. Aspirate the supernatant as much as possible after centrifugation, and use the precipitated cells for Western blot detection.

[0112] (7) The circular RNA transfection experiment of immortalized parathyroid cells was the same as above.

[0113] Experimental group cell sample preparation and protein concentration test:

[0114] 1. Add 100 μL of 4°C pre-cooled RIPA lysis buffer (Shanghai Biotech Biotechnology Co., Ltd., Catalog No.: P0013B) to the previously collected cell pellet, resuspend the cell pellet, and place on ice at 4°C for 30 minutes;

[0115] 2. Place the cell sample on an ice box and perform ultrasonic disruption (Ningbo Xinzhi Biotechnology Co., Ltd., catalog number: Jy92-IIN) for 1 minute, power 10W, and the cycle mode is 3 seconds of ultrasonication followed by a 6-second pause;

[0116] 3. After ultrasound, centrifuge at 4°C, 12,000 g for 5 minutes and collect the supernatant.

[0117] 4. Bradford method was used to measure the protein concentration of the supernatant. Bradford protein concentration determination kit (Shanghai Biotech Co., Ltd., catalog number: P0006) was used. The operation steps are as follows:

[0118] 5. Prepare 0, 0.125, 0.25, 0.5, 0.75, 1, and 1.5 mg / mL protein standards. Take 5 μL of sample into the sample wells of a 96-well plate.

[0119] 6. Add 250 μL of G250 staining solution to each well.

[0120] 7. Incubate for 2 minutes and read the plate at 595 nm using a microplate reader.

[0121] 8. Average the absorbance values ​​minus the blank control. Plot the absorbance value of the standard minus the blank control against the concentration and substitute it into the sample absorbance value for calculation.

[0122] Example 7: Western blot detection of protein expression

[0123] (1) Gel preparation: Use distilled water to check for leaks on the gel plate in advance, and prepare 10% separation gel and 4% concentrated gel according to the gel preparation system in Table 1. Pour the separation gel, seal the line with water / isopropanol, and pour the concentrated gel after the separation gel solidifies, then insert the comb. After the upper concentrated gel solidifies, put it into the electrophoresis tank and add sufficient electrophoresis buffer.

[0124] Table 1 Gel preparation system

[0125]

[0126] (2) Loading: Pull out the comb vertically from the gel plate and load the samples in order. The protein loading amount ranges from 10 to 50 μg, and the sample volume for a 15-well plate is 10 to 20 μL.

[0127] (3) Electrophoresis: Use 60V constant voltage electrophoresis for the upper 4% concentrated gel, maintain the current at 20-40mM, use 90V constant voltage electrophoresis when bromophenol blue enters the lower 10% separation gel, and stop electrophoresis after the target protein is fully separated. The anode electrophoresis buffer can be recycled, and the cathode electrophoresis buffer is prepared on the spot. The formula is shown in Table 2.

[0128] Table 2 SDS-PAGE electrophoresis buffer (10×)

[0129]

[0130]

[0131] (4) Transfer: The formula of transfer solution is shown in Table 3. The transfer solution was precooled in a 4°C environment. The nitrocellulose membrane was soaked and balanced in advance and stacked in the order of black transfer plate-sponge-filter paper-gel-nitrocellulose membrane-filter paper-white transfer plate. The transfer condition was a constant voltage of 100 V and the transfer time was 2 h.

[0132] Table 3 Tris-glycine transfer solution formula (10×)

[0133]

[0134] (5) Blocking: The membrane was placed in 5% skimmed milk powder (prepared in TBST) for 1 hour.

[0135] (6) Incubation with primary antibodies: Place the membrane in GAPDH antibody (Thermo Fisher Scientific, Catalog No. PA1-987) and Menin antibody (Thermo Fisher Scientific, Catalog No. PA5-79663) diluents at an antibody dilution ratio of 1:1000 and incubate overnight in a 4°C refrigerator. Wash three times with TBST, 10 minutes each time.

[0136] (7) Incubation with secondary antibody: Add secondary antibody IgG-HRP (Thermo Fisher Scientific, Catalog No.: 31460) at a dilution ratio of 1:10000; incubate at room temperature for 1 hour. Wash three times with TBST, 10 minutes each time.

[0137] (8) Exposure: The membrane was immersed in ECL chemiluminescent reagent (Thermo Fisher Scientific, Cat. No. 34577) for 2 minutes, and then exposed to the gel imager and the image was collected.

[0138] 5. Result determination

[0139] The results are as follows Figure 7 As shown in the figure, compared with the Blank group, the expression level of Menin protein in 293T cells transfected with circRNA was good, and the continuous and stable expression of Menin protein was detected in the cells of the human immortalized parathyroid cell model in the circRNA transfection group ( Fig. 9 ), during the experimental period, the abundance of Menin protein expression did not show a significant decrease.

[0140] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A circular RNA for treating multiple endocrine neoplasia type I, characterized in that: The circular RNA encoding sequence is the amino acid shown in SEQ ID NO:

4.

2. The circular RNA according to claim 1, characterized in that The structure of the circular RNA, from the 5′ end to the 3′ end, is: complementary arm 1-ribozyme sequence I-IRES sequence-5′UTR-coding region sequence-3′UTR-ribozyme sequence II-complementary arm 2; The complementary arm 1 and the complementary arm 2 are complementary paired nucleotide sequences; The coding region sequence is shown in SEQ ID NO:

1.

3. The circular RNA according to claim 1, characterized in that The ribozyme sequence 1 encodes T4 bacteriophage thymidylate synthase ribozyme 1, and its nucleotide sequence is shown in SEQ ID NO: 10; The ribozyme sequence II encodes T4 bacteriophage thymidylate synthase ribozyme 2, and its nucleotide sequence is shown in SEQ ID NO:

11.

4. The circular RNA according to any one of claims 1 to 3, characterized in that The IRES sequence is shown in any one of SEQ ID NOs: 5-9. Preferably, the IRES sequence is shown as SEQ ID NO:

4.

5. The circular RNA according to any one of claims 1 to 3, characterized in that The sequence of the 5′UTR is shown in SEQ ID NO: 12; and / or The sequence of the 3′UTR is shown in SEQ ID NO:

13.

6. A nucleic acid construct, characterized in that The nucleic acid construct is transcribed to obtain a linear precursor RNA of the circular RNA according to any one of claims 1 to 5.

7. A biological material containing the nucleic acid construct according to claim 6, characterized in that: The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineering bacteria or transgenic cell line.

8. The method for preparing the circular RNA according to any one of claims 1 to 5, comprising: The nucleic acid construct of claim 6 is cloned into an expression plasmid to obtain a recombinant plasmid, and then the circular RNA is obtained after in vitro transcription, cyclization and digestion reactions.

9. Use of the circular RNA according to any one of claims 1 to 5 in the preparation of a drug or composition for treating multiple endocrine neoplasia type I.

10. A drug complex for treating multiple endocrine neoplasia type I, characterized in that: The circular RNA according to any one of claims 1 to 5 is complexed with one or more lipids to prepare liposomes, lipid nanoparticles or lipid complexes.

Citation Information

Cited By

  • CircRNA (Ribonucleic Acid) containing mRNA (Messenger Ribonucleic Acid) stable sequence and application thereof

    CN121427906A