Application of edf1, dsRNA thereof and primer group in prevention and treatment of plutella xylostella
By designing the dsRNA targeting edf1 of the rhododendron moth, interfering with its expression and downregulating the expression of GSS1, the problem of rhododendron moth resistance to traditional insecticides was solved, and the green and effective prevention and control of rhododendron moth was achieved.
Patent Information
- Application Number
- CN202510261077.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-06
- Publication Date
- 2025-06-06
AI Technical Summary
Diamond moth is resistant to traditional insecticides, resulting in poor chemical control effects. At the same time, the abuse of pesticides has also led to a decline in the population of natural enemies of insects, increasing the harm of crops.
DsRNA is designed by targeting the edf1 gene of the Diamondrome, interfering with the expression of edf1, thereby downregulating the expression of the thioglycoside sulfatease GSS1, and achieving the purpose of preventing and treating Diamondrome.
It effectively reduces the expression of GSS1 of thioglycephalus in rhodopsis moth, inhibits its defense ability on cruciferous plants, thus playing the role of preventing and controlling rhodopsis moth, and providing new ideas for green prevention and control.
Smart Images

Figure CN120099013A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to application of edf1 and dsRNA and a primer set thereof in preventing and controlling diamondback moth. Background Art
[0002] The diamondback moth (Plutellaxylostella) is distributed globally and widely harms cruciferous crops, which has a huge impact on human agricultural production activities. However, long-term chemical control has caused the diamondback moth to become resistant to most commercial insecticides, including Bacillus thuringiensis and other related biological agents. At the same time, the irrational use of pesticides has not only led to a sharp decline in the population of insect natural enemies, but also intensified the feeding of resistant diamondback moths on crops. Faced with the above-mentioned prevention and control dilemma, it is particularly urgent to explore new ways or new targets for the prevention and control of the diamondback moth. Summary of the invention
[0003] The purpose of the present invention is to provide the use of edf1 and its dsRNA and primer set in controlling the diamondback moth. The present invention can be used for controlling the diamondback moth by taking edf1 as a target.
[0004] The present invention provides application of edf1 as a target in controlling diamondback moth, wherein the nucleotide sequence of edf1 is shown as SEQ ID NO.1.
[0005] As a preferred embodiment, the application includes the application of negatively regulating edf1 in controlling Plutella xylostella.
[0006] The present invention also provides the use of edf1 in regulating the expression of glucosinolate sulfatase GSS1, wherein the nucleotide sequence of edf1 is shown as SEQ ID NO.1; the nucleotide sequence of glucosinolate sulfatase GSS1 is shown as SEQ ID NO.2.
[0007] As a preferred embodiment, the application includes the application of negatively regulating edf1 in downregulating the expression of glucosinolate sulfatase GSS1.
[0008] The present invention also provides a dsRNA targeting Plutella xylostella edf1, wherein the dsRNA comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO.3 and an antisense strand which is reverse complementary to the sense strand; the nucleotide sequence of the edf1 is shown in SEQ ID NO.1.
[0009] The present invention also provides a primer set for amplifying the dsRNA described in the above scheme, comprising an upstream primer having a nucleotide sequence as shown in SEQ ID NO.4 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.5.
[0010] The present invention also provides the use of the dsRNA or the primer set described in the above scheme in reducing the expression level of glucosinolate sulfatase GSS1 in Plutella xylostella.
[0011] The present invention also provides the use of the dsRNA or the primer set described in the above scheme in controlling Plutella xylostella.
[0012] The present invention also provides a product for controlling Plutella xylostella, which comprises the ds RNA or the primer set described in the above scheme.
[0013] The present invention also provides a method for controlling Plutella xylostella, comprising: introducing the dsRNA described in the above scheme into the body of Plutella xylostella.
[0014] Beneficial effects:
[0015] The present invention provides the use of edf1 as a target in the prevention and control of diamondback moth, and the nucleotide sequence of the edf1 is shown in SEQ ID NO.1. Glucosinolate sulfatases (GSSs) in the body of diamondback moth can compete with myrosinase for substrate glucosinolates, and then produce non-toxic substances to be excreted from the body to resist the defense of cruciferous plants. The edf1 of the present invention can bind to TATA box binding protein to regulate the expression of glucosinolate sulfatases GSS1. Taking edf1 as a target, negative regulation of edf1 can inhibit the expression of glucosinolate sulfatases GSS1, and finally play the role of preventing and controlling diamondback moth. The results of the embodiment show that dsRNA designed with edf1 as the target gene can downregulate the expression of GSS1 gene after interfering with edf1, and finally play the role of preventing and controlling diamondback moth. The present invention utilizes the silencing technology of edf1, a co-transcription factor of diamondback moth glucosinolate sulfatases GSS1, to achieve the inhibition of the expression of glucosinolate sulfatases GSS1 to prevent and control diamondback moth, and provides a new idea and technology for green prevention and control of forestry pests. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.
[0017] Figure 1 The qPCR verification results of the GSS1 regulatory factor in Example 1;
[0018] Figure 2 The yeast library screening results in Example 2;
[0019] Figure 3 The results of self-activation verification of TBP and edf1 and yeast rotation verification in Example 2;
[0020] Figure 4The gene expression results after dsRNA injection in Example 3; ns indicates no difference in the data, and * indicates significant difference in the data, p < 0.05. DETAILED DESCRIPTION
[0021] The present invention provides an application of edf1 as a target in preventing and controlling diamondback moth, wherein the nucleotide sequence of the edf1 is shown in SEQ ID NO.1: 5′-ATGTCTGAATCTGATTGGGACACAGTAACT ATTCTTAGGAAAAGGCCACCAAAGGCATCTGCGCTGAAGACTGAACAGGCTGTGAACGCCGCACGTCGCCAAGGACTCCCAGTTGACACTCAGCAGAAATATGGTGCAGGAACCAATAAACAACACGTTACCACAAAAAACACGGCAAAACTTGATAGGGAAACTGAAGAACTCAAACATGACAAAGTGCCACTCGATTTGGGAAAACTT ATTATGCAAGGGCGACAGGCTAAAGGAATGAGTCAGAAAGACTTGGCTACTAAGATATGTGAGAAACCGCAAATCGTCAACGACTACGAGGCAGGTCGAGGTATTCCCAACAATGTGGTCCTTGGGAAAATAGAGAGGGCAATTGGACTGAAACTCCGAGGCAAGGAGCGCGGCCAACCTCTACAGCCTCCCGGAGCTAAGAAATAA-3′.
[0022] As an embodiment, the application includes the application of negatively regulating edf1 in preventing and controlling diamondback moth. The edf1 described in the present invention is a co-transcription factor of glucosinolate sulfatase GSS1 of diamondback moth, which can interact with TATA box binding protein (TATABoxbingprotein, TBP) to regulate the expression of glucosinolate sulfatase GSS1. Taking edf1 as a target, negatively regulating edf1 can inhibit the expression of glucosinolate sulfatase GSS1, and finally play a role in preventing and controlling diamondback moth.
[0023]
[0024] The present invention also provides a dsRNA targeting Plutella xylostella edf1, wherein the dsRNA comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO.3 and an antisense strand which is reverse complementary to the sense strand. The sequence of the sense strand of the present invention is: 5′-ATGTCTGAATCTGATTGGGACACAGTAACTATTC TTAGGAAAGGCCACCTAAGGCATCCGCGCTGAAGACAGAACAGGCTGTGAACGCCGCTCGTCGCCAAGGACTCCCAGTTGACACTCAGCAGAAATATGGTGCAGGAACCAATAAACAACACGTTACCACAAAAAACACTGCAAAACTTGATAGGGAAACTGAAGAACTCAAACATGACAAAGTGCCACTCGATTTGGGAAAACTTA TTATGCAAGGGCGACAGGCTAAAGGAATGAGTCAGAAAGACTTGGCTACTAAGATATGTGAGAAACCGCAAATCGTCAACGACTACGAGGCAGGCCGAGGTATTCCCAACAATGTGGTCCTTGGGAAAATAGAGAGGGCAATTGGACTGAAACTCCGAGGCAAGGAGCGCGGCCAACCTCTACAGCCTCCCGGAGCTAAGAAA-3′.
[0025] The present invention also provides a primer set for amplifying the dsRNA described in the above scheme, comprising an upstream primer (5′-taatacgactcactatagggATGTCTGAATCTGAT TGGGACACAG-3′) with a nucleotide sequence as shown in SEQ ID NO.4 and a downstream primer (5′-taat acgactcactatagggTTATTTCTTAGCTCCGGGAGGCTG-3′) with a nucleotide sequence as shown in SEQ ID NO.5; the lowercase font in the primer sequence is a T7 promoter, which is used to identify the template during the subsequent synthesis of dsRNA.
[0026] The present invention also provides the use of the dsRNA described in the above scheme or the primer set described in the above scheme in reducing the expression of glucosinolate sulfatase GSS1 in Plutella xylostella. The dsRNA described in the present invention can effectively silence edf1 and downregulate the expression of glucosinolate sulfatase GSS1 in Plutella xylostella.
[0027] The present invention also provides the use of the dsRNA described in the above scheme or the primer set described in the above scheme in controlling the diamondback moth. The dsRNA described in the present invention can effectively silence edf1, thereby downregulating the expression of glucosinolate sulfatase GSS1, and playing a role in controlling the diamondback moth.
[0028] The present invention provides a product for controlling Plutella xylostella, which comprises the dsRNA described in the above scheme or the primer set described in the above scheme.
[0029] The present invention provides a method for controlling diamondback moth, comprising: introducing the dsRNA described in the above scheme into the body of diamondback moth. As an embodiment, the introduction method includes at least one of injection, spraying and feeding. In a specific embodiment of the present invention, the introduction method is injection.
[0030] To further illustrate the present invention, the application of edf1 and its dsRNA and primer set provided by the present invention in controlling Plutella xylostella is described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0031] Example 1
[0032] First, the diamondback moths that had been fed Suzhou green and artificial diet for 24h and 48h were collected for transcriptome sequencing, and the data were clustered and analyzed by GO after sequencing. When focusing on the regulatory factors of GSS1, some upregulated transcription factors were found, and they were investigated. It was found that in the previous study (Xu Xuejiao. Molecular mechanism of the expression of GSS in the diamondback moth in response to host plant glucosinolates [D], 2017.), there were some differentially expressed GSS1 regulatory factors in the transcriptome study of diamondback moths that had been fed artificial diets with plant glucosinolates (Px005686, Px006771, Px003655, gene reference Fujian Agriculture and Forestry University Diamondback Moth Database http: / / iae.fafu.edu.cn / DBM / download.php). Therefore, in the process of transcriptome control sequencing, the differential expression of these three transcription factors was detected, and the regulatory factors of GSS1 (Px005686, Px006771, Px003655) were verified by qPCR. The reaction system and procedure of the qPCR were set according to the conventional methods in the art. The primer sequences of the qPCR are shown in Table 1.
[0033] Table 1 qPCR validation primer sequence information
[0034]
[0035]
[0036] The qPCR test results are as follows Figure 1 The results showed that the expression level of the regulatory factor 6771 (i.e., the diamondback moth edf1 gene, Px006771) of GSS1 was the highest, so the diamondback moth edf1 gene was studied in the future.
[0037] Example 2
[0038] (1) Preparation of edf1-BD bait plasmid
[0039] A. Using the cDNA of Plutella xylostella larvae as a template, PCR was used to amplify the edf1 gene. The PCR reaction system was 25 μL: ddH 2 O 17.8μL, 10Xbuffer 2.5μL, dNTP 1.5μL, PrimerF 0.5μL, Primer R 0.5μL, rTaq 0.2μL and cDNA 2μL. The PCR reaction system is: pre-denaturation at 95°C for 5min; denaturation at 95°C for 20s, annealing at 60°C for 20s, extension at 72°C for 30s, 30 cycles; final extension at 72°C for 10min; insulation at 37°C for 30s. The primers of the PCR are shown in SEQ ID NO.12 and 13, edf1-F (SEQ ID NO.12): 5′-gcatatggccatggaggccgaattcATGTCTGAATCTGATTGG-3′; edf1-R (SEQ ID NO.13): 5′-gttatgcggccgctgcaggtcgacTTTCTTAGCTCCGGGAGG-3′; wherein the lowercase letters represent the homology arm part.
[0040] B. Use Takara brand rTaq enzyme to perform homologous recombination between the edf1 gene amplified in step A and the pGBKT7 (BD) vector (Takara), and connect them according to the homologous recombination kit of Yishen Biotechnology (Shanghai) Co., Ltd. to obtain the edf1-BD bait plasmid.
[0041] (2) Yeast screening library and interaction verification
[0042] Shanghai Baoji Biotechnology Co., Ltd. was commissioned to construct a diamondback moth nuclear library. The diamondback moth egg, 1st instar, 2nd instar, 3rd instar, 4th instar, pupa and adult samples were mixed to construct the diamondback moth nuclear library. The diamondback moth nuclear library and the edf1-BD bait plasmid in step (1) were co-transformed into yeast to screen for interacting proteins. The transformation of yeast cell competence was referred to the Y2HGold yeast cell competence instruction manual (Coolaber). The experimental steps are as follows:
[0043] A. Verification of self-activation of edf1-BD bait plasmid
[0044] The yeast containing the edf1-BD bait plasmid was diluted and spread on SD / -Trp and SD / -Trp / X-α-Gal culture media, and cultured at 30°C for 2-4 days to detect the growth of yeast. The SD / -Trp and SD / -Trp / X-α-Gal culture media were purchased from Coolaber, PM341433120. The results showed that yeast could not grow on the SD / -Trp / X-α-Gal culture media, indicating that the edf1-BD bait plasmid did not self-activate, and subsequent experiments could be continued.
[0045] B. Mating method for screening yeast library
[0046] ①Prepare yeast suspension carrying bait plasmid: select a single yeast colony with a diameter of about 2-3 mm from SD / -Trp solid medium, then inoculate it into 50 mL SD / -Trp liquid medium containing 20 μg / mL kanamycin, and incubate at 30°C and 200 rpm for 16-24 h until OD 600 The value reached 0.8; centrifuged at 600g for 5min and discarded the upper liquid; resuspended the cell pellet with 5mL of fresh SD / -Trp liquid culture medium to obtain Y2HGold bait bacterial liquid.
[0047] ②Take out 1mL of the diamondback moth nuclear library from the -80℃ refrigerator, thaw it in warm water at 30℃, and then mix the thawed library and the 5mL Y2HGold bait bacterial solution in step ① into a sterile 2L flask. Add 45mL of 2× YPDA medium containing 50μg / mL kanamycin to the flask, and gently shake it at 50rpm at 30℃ for 20h. After culturing for 20h, use an ordinary optical microscope to observe whether a Mickey Mouse head-shaped conjugate is formed. If no conjugate is observed, extend the culture to 24h. After that, transfer the culture solution to a sterile 50mL centrifuge tube, centrifuge at 1000g for 10min, and discard the upper liquid. Wash the flask twice with 0.5× YPDA medium containing 50μg / mL kanamycin; the washing solution is combined into the previous centrifuge tube and the cells are resuspended. Centrifuge again at 1000g for 10min, remove the supernatant, resuspend the precipitate with 3mL of 0.5× YPDA medium, transfer the suspension to a 10mL centrifuge tube, and resuspend 1.5mL of cells in 10mL of diluent. Subsequently, dilute the diluted bacterial solution by 10 times, 100 times, 1000 times, and 10000 times, and take 100μL to spread on 90mm SD / -Trp, SD / -Leu and SD / -Leu / -Trp solid culture medium, culture in a 30℃ incubator for 3-5d, and finally calculate the hybridization efficiency by counting the number of yeast colonies, hybridization efficiency = (the number of colonies on SD / -Trp / -Leu ÷ the number of colonies on SD / -Trp or SD / -Leu) × 100%. The hybridization efficiency of yeast two-hybrid can be calculated by counting yeast colonies, which provides an important reference for evaluating the strength of protein interaction and screening new interacting proteins. The remaining bacterial solution was spread on DDO plates and cultured at 30°C for 4-6 days until colony growth was observed. The remaining bacterial solution was spread on DDO / X plates and cultured at 30°C for 4-6 days.
[0048] ③Select the blue single colony produced by DDO / X in step ②, transfer it to TDO / X-α-Gal plate, and culture it at 30℃ for 4-6 days; then, transfer the blue single colony grown on TDO / X-α-Gal medium to QDO / X-α-Gal medium for culture. The results are as follows: Figure 2 shown. Figure 2The blue color below is positive plaque and the white color is negative plaque. The positive plaque is pGADT7-largeT and pGBKT7-53 co-transformed into yeast and then inoculated into QDO / X-α-Gal for detection. If it turns blue, the plaque is correct. It is placed at -80℃ for use. When it is used, it is first streaked on the DDO / X plate and then the streaked plaque is inoculated for use; the negative plaque is pGADT7-largeT and pGBKT7-lamic co-transformed yeast cells inoculated into QDO / X-α-Gal. If it is white, it proves that the plaque is correct. The rest is treated and used in the same way as the positive plaque, proving that the yeast screening library results are correct. The culture medium and vector used in this step were purchased from Coolaber.
[0049] ④ Select a single clone that grows normally and appears blue on the QDO / X-α-Gal medium and perform colony PCR detection on it. The colony PCR reaction system and procedure are the same as step (1); the colony PCR primer sequences are as follows: F-T7 (SEQ ID NO.14): 5′-TAATACGACTCACTATAGGGC-3′; R-T7 (SEQ ID NO.15): 5′-AGATGGTGCACGATGCACAG-3′.
[0050] After the PCR products were analyzed by agarose gel electrophoresis, samples containing prey inserts were selected for DNA sequencing. The detected gene sequences were functionally annotated by comparing the sequencing results with the NCBI BlastN database. As a result, an interacting protein TATA box binding protein (TBP) was found in the yeast screening library.
[0051] C. Yeast rotation verification
[0052] Experimental group: The TBP sequence was inserted between EcoRI and XhoI of the pGADT7 vector to construct the prey protein plasmid TBP-pGADT7 by homologous recombination. The sequence information of the TBP corresponds to the NCBI gene number LOC105393708. The constructed prey protein TBP-pGADT7 and the bait protein pGBKT7-edf1 vector (referring to the edf1-BD bait plasmid described in step (1)) were co-transformed into Y2HGold yeast competent cells. The yeast monoclonal clone that successfully integrated the two vectors was inoculated on TDO / X-α-Gal and cultured for 3 to 5 days. The blue plaques on the TDO / X-α-Gal plate were inoculated on the QDO / X-α-Gal plate and cultured at 30°C for 4 to 6 days. Figure 3 In line 5.
[0053] Positive control group: pGADT7-largeT (purchased from Coolaber) and pGBKT7-53 vector (purchased from Coolaber) were co-transfected into Y2HGold yeast competent cells. Subsequent operations were the same as those of the experimental group, corresponding to Figure 3 in row 1.
[0054] Negative control group: pGADT7-largeT (purchased from Coolaber) and pGBKT7-lamic vector (purchased from Coolaber) were co-transfected into Y2HGold yeast competent cells. Subsequent operations were the same as those of the experimental group, corresponding to Figure 3 In line 2.
[0055] Control group 1: The pGADT7 vector and the bait protein pGBKT7-edf1 vector were co-transfected into Y2HGold yeast competent cells. The subsequent operations were the same as those of the experimental group. Figure 3 In line 3.
[0056] Control group 2: The constructed prey protein pGADT7-TBP and pGBKT7 vectors were co-transfected into Y2HGold yeast competent cells, and the subsequent operations were the same as those of the experimental group, corresponding to Figure 3 In line 4.
[0057] The interaction between the two proteins was determined by observing the color of the QDO / X-α-Gal plate monoclonal clones, where blue indicated interaction between the proteins, while white or red indicated no interaction.
[0058] The results are as follows Figure 3 As shown in the figure, pGADT7-largeT and pGBKT7-53 co-transformed into blue colonies, which are positive plaques, and pGADT7-largeT and pGBKT7-lamic co-transformed into white colonies, which are negative plaques, indicating that the culture medium is correct and can be used to analyze whether the proteins interact with each other. pGADT7 and pGBKT7-edf1 vectors co-transformed into white colonies, indicating that the pGADT7 vector has no interaction with the bait protein pGBKT7-edf1 vector; pGADT7-TBP and pGBKT7 vectors co-transformed into white colonies, indicating that pGBKT7 has no interaction with the pGADT7-TBP vector. Control positive plaques show that TBP and edf1 do interact with each other.
[0059] Example 3
[0060] (1) dsRNA synthesis
[0061] A. Using the cDNA of the fourth instar larvae of Plutella xylostella as a template, the open reading frame of the edf1 gene was obtained by PCR technology. The reaction system and procedure were the same as in Example 2. The PCR amplification primers were as follows: PT-F (SEQ ID NO.16): 5′-TCTGAATCTGATTGGGACACAG-3′; PT-R (SEQ ID NO.17): 5′-TTTCTTAGCTCCGGGAGGCTG-3′.
[0062] B. Recover the amplified product using the Omega gel recovery kit and connect the amplified product into the pMD19-t plasmid. Refer to the instructions of the Beijing Bio-Rad Biotechnology Company DNA Ligation Kitchen Ver.2.1 ligation kit to obtain the pMD19-t transformation plasmid.
[0063] C. The pMD19-t transformation plasmid was transformed into the competent E. coli Trans5α cells, plated, and a single colony was picked and propagated in LB liquid culture medium containing 1‰ ampicillin the next day. The bacterial solution was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.
[0064] D. According to the sequencing results, bacterial cultures with low mutation rates were selected for propagation and plasmid extraction. Plasmid extraction was performed using the Sigma Rapid Small Quantity Plasmid Extraction Kit.
[0065] E. Using the plasmid extracted in step D as a template, amplification was performed using primers containing a T7 promoter. The reaction system and procedure were the same as those in Example 2. The primer sequences used were as follows: RNAi-F (SEQ ID NO.4): 5′-taatacgactcactatagggATGTCTGAATCTGATTGGGACACAG-3′; RNAi-R (SEQ ID NO.5): 5′-taatacgactcactatagggTTATTTCTTAGCTCCGGGAGGCTG-3′; wherein the lowercase font represents the T7 promoter.
[0066] F. The amplified product was recovered from gel; the concentration of the recovered product was measured, and the dsRNA of the edf1 gene was synthesized using the Promega T7 RiboMAX ExpressRNAi System according to the method and steps in the instruction manual, and was recorded as dsPxEDF1.
[0067] (2) RNAi analysis
[0068] The dsRNA of the GFP gene was used as the control group (see: Yan Hailian. Study on the effect of RNAi technology on silencing the trehalase gene of sticky insect and its cold tolerance [D]. Inner Mongolia Normal University, 2023), recorded as dsGFP. dsPxEDF1 and dsGFP were diluted to a concentration of 150 ng / μL with enzyme-free water and injected into diamondback moth eggs, with about 0.2 μL injected per egg. Five nymphs were collected from each of the dsPxEDF1 group and the dsGFP group to extract total RNA (TRizol method), reverse transcribed into cDNA, and real-time fluorescence quantitative PCR was used to detect the changes in the expression of edf1, GSS1, SUMF1a, and SUMF1b genes. RPL32 was used as the internal reference gene. The primer sequences of the real-time fluorescence quantitative PCR are shown in Table 2.
[0069] Table 2 Primer sequences for real-time fluorescence quantitative PCR
[0070] name Sequence information (5′→3′) Serial Number pxSUMF1a-F CATAGAAGCGGACAACGAGG SEQ ID NO.18 pxSUMF1a-R TCCACGAACTCACTGAAATC SEQ ID NO.19 pxSUMF1b-F ACATTTCCCAGCCATAACTC SEQ ID NO.20 pxSUMF1b-R ACTCCCAGACATTCCCGACA SEQ ID NO.21 PxEDF1-F TTTCTGACTCATTCCTTTAGCCTG SEQ ID NO.22 PxEDF1-R ACTTGATAGGGAAACTGAAGAACTC SEQ ID NO.23 pxGSS1-F AGCAAGCACTACGGTGAAG SEQ ID NO.24 pxGSS1-R AGAGAGATGCCGATGGTCT SEQ ID NO.25 RPL32-F CAATCAGGCCAATTTACCGC SEQ ID NO.26 RPL32-R CTGGGTTTACGCCAGTTACG SEQ ID NO.27
[0071] The reaction system of the real-time fluorescence quantitative PCR is: ddH 2 O 8μL; SYBR 10μL; F / R 0.5μL; cDNA template 1μL; total system 20μL. Reaction procedure: 95℃ pre-denaturation 10min; 95℃ 10s, 60℃ 10s, 72℃ 10s, 40 cycles. The experiment was repeated 6 times with 6 independent samples, and the reactions were completed on Roche LightCycler480Ⅱ real-time fluorescence quantitative PCR instrument to detect silencing efficiency. The results are shown in Table 3 and Figure 4 shown.
[0072] Table 3 Gene expression
[0073] Group PxD PxGSS1 PxSUMF1a PxSUMF1b dsGFP 1.00 1.00 1.00 1.00 dxPdF1 0.6 0.4 0.8 0.62
[0074] According to Table 3 and Figure 4 It can be seen that after interfering with edf1, the expression level of the GSS1 gene will be affected, but the expression of GSS1's modifying factors SUMF1a and SUMF1b will not be affected.
[0075] The inventors investigated edf1 and found that it plays a role in enhancing transcription and protecting mRNA in various insects such as fruit flies and silkworms (LIU QX, UEDA H, HIROSE S. MBF2 is a tissue-and stage-specific coactivator that is regulated at the step of nuclear transport in the silkworm Bombyx mori [J]. Dev Biol, 2000, 225 (2): 437-46.). Edf1 can enhance transcriptional activity by forming a bridging structure to bind different regulatory DNA binding proteins to the TATA box (LI FQ, UEDA H, HIROSE S. Mediators of Activation of fushi tarazu Gene Transcription by BmFTZ-Fl [J]. Molecular and Cellular Biology, 1994, 14 (5): 3013-21.). The edf1 domain contains a flexible helix-turn-helix (HTH) structure on the N-terminus and C-terminus, and the binding site of edf1 to TBP is located in the HTH domain at the C-terminus (MISHIMAM, OZAKI J, IKEGAMI T, et al. Resonance assignments, secondary structure and 15N relaxation data of the human transcriptional coactivator hMBF1(57-148)[J]. J Biomol NMR, 1999, 14(4): 373-6.; JINDRA M, GAZIOVA I, UHLIROVA M, et al. Coactivator MBF1 preserves the redox-dependent AP-1activity during oxidative stress in Drosophila[J]. Emboj, 2004, 23(17): 3538-47.). Therefore, interfering with edf1 will reduce the expression level of GSS1 in Plutella xylostella, thereby affecting the feeding and survival of Plutella xylostella.
[0076] The present invention utilizes the co-transcription factor edf1 of the diamondback moth glucosinolate sulfatase GSS1 as a target, designs dsRNA, and injects it into the diamondback moth to interfere with the expression of edf1, thereby reducing the expression of GSS1, and finally achieving the prevention and control of the diamondback moth.
[0077] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Application of edf1 as a target in controlling Plutella xylostella, wherein the nucleotide sequence of edf1 is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that: The application includes the application of negatively regulating edf1 in preventing and controlling diamondback moth.
3. Application of edf1 in regulating the expression of glucosinolate sulfatase GSS1, the nucleotide sequence of edf1 is shown as SEQ ID NO.1; the nucleotide sequence of glucosinolate sulfatase GSS1 is shown as SEQ ID NO.
2.
4. The use according to claim 3, characterized in that: The application includes the application of negatively regulating edf1 in downregulating the expression of glucosinolate sulfatase GSS1.
5. A dsRNA targeting Plutella xylostella edf1, characterized in that The dsRNA comprises a sense strand having a nucleotide sequence as shown in SEQ ID NO.3 and an antisense strand which is reverse complementary to the sense strand; the nucleotide sequence of edf1 is shown in SEQ ID NO.
1.
6. A primer set for amplifying the dsRNA according to claim 5, characterized in that: It comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO.4 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.
5.
7. Use of the dsRNA according to claim 5 or the primer set according to claim 6 in reducing the expression level of glucosinolate sulfatase GSS1 in Plutella xylostella.
8. Use of the dsRNA according to claim 5 or the primer set according to claim 6 in controlling Plutella xylostella.
9. A product for controlling diamondback moth, characterized in that: The product comprises the dsRNA of claim 5 or the primer set of claim 6.
10. A method for controlling Plutella xylostella, characterized in that: include: The dsRNA according to claim 5 is introduced into the body of Plutella xylostella.