Membrane protein sec63 gene and dsrna in pest control

By utilizing the locust membrane protein Sec63 gene and its dsRNA, a spray-on insecticide or bait was prepared, silencing the expression of the locust membrane protein Sec63 gene. This solved the problem of the lack of efficient and specific insect-resistant dsRNA targets in existing technologies, and achieved a specific control effect on locusts.

CN120099015BActive Publication Date: 2025-11-18SHANXI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510263732.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-06
Publication Date
2025-11-18
Estimated Expiration
2045-03-06

AI Technical Summary

Technical Problem

Existing nucleic acid biopesticides lack highly efficient and specific insect-resistant dsRNA targets for pest control, especially against intercontinental agricultural pests such as locusts. Furthermore, insect molting provides a safe target for pest control, but humans lack this biological characteristic, leading to difficulties in pest control.

Method used

By utilizing the locust membrane protein Sec63 gene and its dsRNA, dsRNA was synthesized through PCR amplification and transcription, and then prepared into a sprayable insecticide or bait to silence the expression of the locust membrane protein Sec63 gene, leading to difficulty in molting and death.

Benefits of technology

This study achieved specific gene silencing against locusts, leading to difficulty in molting and death, providing a new specific molecular target for pest control and improving control effectiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099015B_ABST
    Figure CN120099015B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biotechnology and agricultural pest control, and particularly relates to a membrane protein Sec63 gene and application of dsRNA of the membrane protein Sec63 gene in pest control. After cloning and sequencing of the Sec63 gene of Locusta migratoria, the sequence of the Sec63 gene of SEQ ID NO:1 is obtained; then the gene fragment of SEQ ID NO:2 is selected for synthesis of double-stranded RNA (dsRNA). After the dsRNA of the gene is injected into the body cavity of the Locusta migratoria, specific Sec63 genes can be silenced, so that the Locusta migratoria cannot successfully molt and dies when molting. The application provides a new specific molecular target for pest control based on RNA interference and a new technical approach for pest control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and agricultural pest control, specifically involving the application of the membrane protein Sec63 gene and its dsRNA in pest control. Background Technology

[0002] Nucleic acid biopesticides utilize the dsRNA of pests or pathogens themselves to silence the transcriptional level of target genes, thereby inhibiting the growth and development of pests or pathogens and achieving the purpose of pest and disease control. Compared with traditional pesticides, nucleic acid biopesticides have advantages such as strong insecticidal specificity, a wide range of target selection, and being green and safe. However, the development of nucleic acid biopesticides urgently needs to overcome the bottleneck of screening for highly efficient and specific insecticidal dsRNA targets. The cuticle is the first line of defense for pests against adverse external environments and pathogens. During the individual development of insects, the old cuticle is constantly shed and a new cuticle is formed. Molting is a biological phenomenon unique to arthropods, while humans and higher mammals lack this biological characteristic. Therefore, the cuticle has attracted much attention as a safe target for pest control.

[0003] The migratory locust (Locusta migratoria) is an intercontinental agricultural pest. It is characterized by its explosive, gregarious, and migratory nature; once it occurs, it not only affects a wide area but also spreads rapidly and causes severe damage. Sec63 is a membrane protein of the migratory locust, and currently, there are no reports on RNA interference techniques for pest control using the Sec63 gene. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to overcome the shortcomings of the prior art and provide the application of the membrane protein Sec63 gene and its dsRNA in pest control.

[0005] To achieve the above objectives, the technical solution of the present invention is as follows:

[0006] The first aspect of this invention is a locust membrane protein Sec63 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. This sequence was obtained by searching a locust transcriptome database, and the open reading frame of this sequence is 2277 bp, encoding 785 amino acids.

[0007] The second aspect of the present invention is a locust membrane protein Sec63 gene fragment, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0008] The third aspect of the present invention is a dsRNA of the locust membrane protein Sec63 gene, which is synthesized using the locust membrane protein Sec63 gene fragment described in the second aspect.

[0009] The fourth aspect of the present invention is a method for synthesizing dsRNA of the locust membrane protein Sec63 gene as described in the third aspect, comprising the following steps: designing an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4 according to the sequence SEQ ID NO: 1, and then obtaining the product as shown in SEQ ID NO: 2 by PCR amplification, which is then purified, transcribed and synthesized into dsRNA.

[0010] The fifth aspect of the present invention is the application of the dsRNA of the locust membrane protein Sec63 gene described in the third aspect in pest control.

[0011] Furthermore, dsRNA can be prepared into sprayable insecticides or baits, or transferred into the plant bodies ingested by pests.

[0012] Furthermore, the pest is the locust.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0014] The present invention provides a novel specific molecular target for RNA interference-based pest control, and offers a new technical approach for pest control. By injecting the dsRNA of the locust membrane protein Sec63 gene into the locust's body cavity, the expression of the Sec63 gene mRNA can be specifically silenced, leading to difficulty in molting and death in the locust. Attached Figure Description

[0015] Figure 1 Effect of injection of dsRNA synthesized by SEQ ID NO:2 on the expression of Sec63 gene mRNA in 3rd instar locusts (where **P<0.005).

[0016] Figure 2 Effect of injection of dsRNA synthesized by SEQ ID NO:2 on the phenotype of 3rd instar locusts (left side is the control injected with dsGFP, right side is the control injected with dsRNA synthesized by SEQ ID NO:2, i.e. dsLmSec63).

[0017] Figure 3 Effect of 5-instar locusts injected with dsRNA synthesized by SEQ ID NO:2 on the expression of Sec63 gene mRNA (***P<0.001).

[0018] Figure 4 Effect of 5-instar locusts injected with dsRNA synthesized by SEQ ID NO:2 on locust phenotype (left side is control injected with dsGFP, right side is dsRNA synthesized by SEQ ID NO:2, i.e. dsLmSec63). Detailed Implementation

[0019] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0020] Example 1: Obtaining the full-length cDNA sequence and gene fragment of the locust membrane protein Sec63 gene

[0021] Based on the transcriptome database of locusts, bioinformatics methods were used to search for the cDNA sequence of the locust membrane protein Sec63 gene. The full-length cDNA sequence of the locust membrane protein Sec63 gene was obtained. Primers were designed using Primer Premier 5.0 software to verify the full-length cDNA sequence, and the sequence was synthesized at Shanghai Bioengineering Co., Ltd. Four healthy, uniformly sized, and 50% male and 50% female nymphs of the locust were selected and frozen in liquid nitrogen. RNA was extracted according to the TaKaRa RNAiso Plus kit, and the extracted RNA was reverse transcribed into first-strand cDNA using the HiScript III qRT SuperMix (Nanjing Novizan Biotechnology Co., Ltd.) instructions. Using this cDNA as a template, and with the designed primers, the full-length cDNA sequence of the Sec63 gene was amplified by PCR. The obtained product was purified, cloned, and transformed into E. coli, and then sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequence is SEQ ID NO: 1.

[0022] Example 2: Synthesis of dsRNA from the locust membrane protein Sec63 gene

[0023] 1) Design of primers for the dsRNA of the locust membrane protein Sec63 gene

[0024] Based on the sequence of the locust membrane protein Sec63 gene obtained in Example 1 (SEQ ID NO: 1), dsRNA primers were designed using Primer Premier 5.0 software. The primer sequences are SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and both the upstream and downstream primers carry the T7 promoter sequence. All primers were synthesized by Shanghai Bioengineering Co., Ltd.

[0025] 2) Synthesis of dsRNA in the locust membrane protein Sec63 gene

[0026] Using the upstream and downstream primers of SEQ ID NO: 3 and SEQ ID NO: 4, PCR amplification was performed on the cDNA template of Example 1. The amplified PCR product, with the sequence of SEQ ID NO: 2, was purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme) and then purified according to T7 RiboMAX. TM The Express RNAi System (Promega) kit instructions state that dsRNA (i.e., dsLmSec63) was synthesized in vitro via transcription. Quantification was performed using a NANODROP 2000 (Thermo Scientific) to achieve a final concentration of 2 μg / μL. Storage was then performed at -80°C for later use.

[0027] Example 3: Experiment on lethality of 3rd instar locusts by dsRNA of the locust membrane protein Sec63 gene

[0028] 1) Injection of locust membrane protein Sec63 gene dsRNA

[0029] Third-instar nymphs of uniform size and health status, selected on the first day, were injected with the dsRNA synthesized in Example 2. A 25 μl microsyringe was used for injection; excessive force was avoided during injection. The injection point was the junction of the second and third abdominal segments on the lateral side, following the direction of blood flow, and avoiding the spiracles. The amount of dsRNA injected was 3 μg, and a control group of dsGFP (3 μg) was also included. Each group consisted of 10 nymphs, with 3 biological replicates, for a total of 30 nymphs. After injection, the nymphs were placed in 1L beakers in an artificial climate chamber (light:dark time = 14h:10h, temperature 30±2℃, humidity 60%), provided with fresh wheat seedlings and appropriate light, and sprayed with water to maintain humidity.

[0030] 2) Detection of Sec63 gene silencing in 3rd instar locust membrane protein

[0031] Total RNA was extracted from nymphs injected with dsGFP and dsLmSec63 24 h later. Four biological replicates were obtained from both the control and dsLmSec63 groups, with three nymphs per replicate. The RNA was reverse transcribed into first-strand cDNA, and the relative expression levels of the target gene (LmSec63) and the housekeeping gene (β-actin) were detected using RT-qPCR to calculate their silencing efficiency. Results showed that compared to the control group, LmSec63 gene expression was significantly reduced in the dsLmSec63-injected group. Figure 1 ).

[0032] 3) Observation of the phenotype of third-instar locusts after dsRNA injection

[0033] After injection of dsRNA, the 3rd instar nymphs, compared to the dsGFP-injected control group, began molting 5 days later and all successfully molted to the 4th instar. Upon reaching the 4th instar, the nymphs exhibited normal morphology and vitality. In the dsLmSec63-injected treatment group, 24 out of 30 nymphs failed to molt and ultimately died, exhibiting the following phenotype: Figure 2 As shown: the old epidermis of the head and chest can be cracked, but the old and new epidermis cannot be separated, ultimately leading to death.

[0034] Example 4: Experiment on lethality of 5th instar locusts by dsRNA of the locust membrane protein Sec63 gene

[0035] 1) Injection of locust membrane protein Sec63 gene dsRNA

[0036] Fifth instar nymphs of uniform size and health status, selected on the third day, were injected with the dsRNA synthesized in Example 2. A 25 μl microsyringe was used for injection; excessive force was avoided during injection. The injection point was the junction of the second and third abdominal segments on the lateral side, following the direction of blood flow, avoiding the spiracles. The injection volume of dsRNA was 10 μg, and a control group of dsGFP (10 μg) was also included. Each group consisted of 10 nymphs, with 3 biological replicates, for a total of 30 nymphs. After injection, the nymphs were placed in a 1L beaker in an artificial climate chamber (light:dark time = 14h:10h, temperature 30±2℃, humidity 60%), provided with fresh wheat seedlings and appropriate light, and sprayed with water to maintain humidity.

[0037] 2) Detection of Sec63 gene silencing in 5th instar locust membrane protein

[0038] Total RNA was extracted from nymphs injected with dsGFP and dsLmSec63 24 h later. Four biological replicates were obtained from both the control and dsLmSec63 groups, with three nymphs per replicate. The RNA was reverse transcribed into first-strand cDNA, and the relative expression levels of the target gene (LmSec63) and the housekeeping gene (β-actin) were detected using RT-qPCR to calculate their silencing efficiency. Results showed that compared to the control group, LmSec63 gene expression was significantly reduced in the dsLmSec63-injected group. Figure 3 ).

[0039] 3) Observation of the phenotype of 5th instar locusts after dsRNA injection

[0040] Fifth instar nymphs injected with dsRNA, and those in the dsGFP-injected control group, began molting 7 days later and all successfully molted into adults. After molting, the adults exhibited normal morphology and vitality. In the dsLmSec63-injected treatment group, 25 out of 30 nymphs failed to molt and ultimately died, exhibiting the following phenotype: Figure 4 As shown: the old epidermis of the head and chest can be cracked, but the old and new epidermis cannot be separated, ultimately leading to death.

[0041] The above description is only for better explaining the embodiments of the present invention and is not intended to limit them. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention shall fall within the scope of the present invention.

[0042] SEQ ID NO: 1

[0043]

[0044] SEQ ID NO:2

[0045] MGGQKFQYDESGGTFFYFLLSFLALLLIPGTYYWWPRKRREDPAKYEKECHCDDCKKKKLILQANEPWKGTKQMLTKLLIISGWLILALLAYKVSQFDYEYANFDPYEILGIPLGASQADIRKQYRKLSLILHPDKETGNEKAFMKLTKAYQALTDEEARRNWEKYGNPDGPGAMSFGIALPSWIVEKENSVWVLGLYALVFMVALPTVVGMWWYKSIRYSGDQVLLNTTQMYYYFFHKTPSMALKRVIMILAASLEFEKKHNSEIVERPTDNEEVPHLIKQISNLSEKNRERPLCFLYSLKARAIIHAHLSRIPLNPETLDKDRQYIVKKCPYLIQEMVNCVSQLILLAYARRIPRLPNIETIENCMKLCPMIVQAMWEYKSPLLQLPYVTDDNLKYFVNKKRYIKTIQQFAQLKHEDRRSILRNLSDEQYNDVMKVAGKMPYVEFKVKSEVIDDENPTVYTAGAIVTVTVTLIRHDMSILFGDDTKAAQNAPPQETVEDLAEKEKEQPAKKEEQAKKPVWQKQQKKGKKTNKKSSRSQKASSRSTPAKKADEKPQATNETQDVPTKKATAESGDESDTSDDEVERSDDEENENSQGDKKGSSVEEDDVEWEKFRARLHKREKVLEGRSKQSHSVHCPFFPEDKQEYWWVYISDRKSHTLLTSPYHVTDLVEEEEVQLKFTAPRWPGIYTFTVCLRSDSYLGFDQMQDIKLDVKEAPEIPTEHPQWEMSDEEEDEQEAEGSDVSEFTTDEDVEDDQD

[0046] SEQ ID NO:3

[0047] TGGATTGTATGCTCTTGTT

[0048] SEQ ID NO:4

[0049] TGAGACAATAGAAAACTGC

[0050] SEQ ID NO:5

[0051] TGGATTGTATGCTCTTGTTTTCATGGTTGCTTTGCCCACTGTTGTGGGAATGTGGTGGTACAAGTCTATTCGATATTCTGGAGACCAGGTTCTGCTTAATACTACACAGATGTATTACTATTTCTTTCA CAAAACACCTTCAATGGCTCTAAAAGAGTAATTATGATCCTTGCAGCCTCTCTGGAGTTTGAGAAGAAGCACAACAGTGAGATTGTTGAGAGACCTACTGACAATGAAGAAGTTCCTCATCTCATTAAA CAGATATCAAACCTCAGTGAGAAGAATCGTGAGCGGCCTCTGTGCTTCCTGTATTCTTTGAAGGCACGTGCTATCATTCATGCGCATCTGTCTCGAATTCCACTCAACCCAGAAACCTTGGACAAGGAT CGGCAGTACATAGTTAAAAAATGCCCATATCTTATTCAAGAAATGGTCAACTGCGTGTCCCAGCTCATTCTTCTGGCATATGCCAGGCGAATACCGAGACTGCCAAATATTGAGACAATAGAAAACTGC。

Claims

1. A dsRNA of the locust membrane protein Sec63 gene, characterized in that, The dsRNA sequence was synthesized using a fragment of the membrane protein Sec63 gene, as shown in SEQ ID NO:

5.

2. The application of the dsRNA of the locust membrane protein Sec63 gene as described in claim 1 in the control of locusts.

3. The application of the dsRNA of the locust membrane protein Sec63 gene according to claim 2 in locust control, characterized in that, dsRNA can be prepared into spray insecticides or baits, or transferred into the plant bodies of pests that feed on it.