A kiwifruit AcMYC2 gene, its encoded protein, and its applications

Abstract

The application discloses a kiwi fruit AcMYC2 gene, a coding protein and application thereof, and belongs to the technical field of crops. A new gene AcMYC2 in a bHLH gene family is found from the kiwi fruit, and the CDS nucleotide sequence of the gene is shown as SEQ ID NO. 1. It is found by the application that the antioxidant enzyme activity in the kiwi fruit can be inhibited by silencing the kiwi fruit AcMYC2 gene, the hydrogen peroxide content in the kiwi fruit is significantly increased, and the fruit softening process under postharvest low-temperature storage conditions is accelerated; the original pectin content degradation speed is significantly reduced by overexpressing the kiwi fruit AcMYC2 gene, the antioxidant enzyme activity in the fruit is enhanced, the fruit softening process under postharvest low-temperature storage conditions is delayed, the storage time of the postharvest fruit is prolonged, the cold resistance of the fruit under postharvest low-temperature storage conditions is improved, and the storage resistance of the fruit is positively regulated.

Description

Technical Field

[0001] This invention belongs to the field of crop science and technology, specifically relating to the AcMYC2 gene of kiwifruit, its encoded protein, and its applications. Background Technology

[0002] Methyl jasmonate (MeJA) is a ubiquitous growth regulator in plants, playing multiple roles. MYC2 is a transcription factor in the jasmonic acid signaling pathway, playing a crucial role in promoting fruit enlargement and enhancing crop disease resistance. However, the MYC2 transcription factor in kiwifruit has not been reported, and its molecular mechanism remains unexplored.

[0003] Kiwifruit (Actinidia chinensis), belonging to the Actinidiaceae family, is one of the world's fastest-growing high-end fruits in recent years. It is a climacteric fruit, and low-temperature storage is commonly used to extend its shelf life. Fruit softening is an important indicator of the fruit's internal quality and a crucial characteristic during ripening and post-harvest storage. Excessive softening after harvest shortens the fruit's storage and shelf life, accelerates spoilage, and severely damages its commercial value and economic benefits.

[0004] Low-temperature storage is the most common method for delaying post-harvest ripening of fruits and vegetables and maintaining fruit quality. Low temperatures can effectively inhibit the physiological metabolism of kiwifruit, weaken respiration intensity, reduce ethylene release rate, and delay the occurrence of peak respiration and ethylene release rates, thus effectively extending the storage period of kiwifruit and improving its storage quality. However, maintaining fruit quality and meeting consumer needs under long-term storage conditions presents certain difficulties and also increases the risk of chilling injury, leading to deterioration in fruit quality. Therefore, strengthening research on low-temperature storage mechanisms and elucidating the fruit softening regulation network under low temperatures can ensure the quality of post-harvest kiwifruit and provide theoretical support for commercial operations. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a kiwifruit AcMYC2 gene and its encoded protein and its application to regulate the fruit softening process of kiwifruit under postharvest low-temperature storage conditions and improve the cold damage resistance of kiwifruit under postharvest low-temperature storage conditions.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides an AcMYC2 gene, wherein the AcMYC2 gene is derived from kiwifruit, and the CDS nucleotide sequence of the AcMYC2 gene is shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention provides the application of the AcMYC2 gene in improving the low-temperature storage performance of fruits.

[0009] The fruit in question is either a kiwi or a tomato.

[0010] The improvement of fruit's low-temperature storage performance includes: regulating the fruit softening process under post-harvest low-temperature storage conditions and / or improving the fruit's resistance to chilling injury under post-harvest low-temperature storage conditions.

[0011] By overexpressing the AcMYC2 gene in kiwifruit, the expression of the AcMYC2 gene was promoted, the softening process of the fruit under postharvest low-temperature storage conditions was delayed, the cold damage resistance of the fruit under postharvest low-temperature storage conditions was improved, and the storage tolerance of the postharvest fruit was positively regulated.

[0012] Alternatively, by silencing the AcMYC2 gene in kiwifruit, the expression of the AcMYC2 gene can be suppressed, thereby accelerating the softening process of the fruit under postharvest low-temperature storage conditions.

[0013] In a third aspect, the present invention provides the application of the protein encoded by the AcMYC2 gene in improving the low-temperature storage performance of fruits, characterized in that the amino acid sequence of the protein encoded by the AcMYC2 gene is shown in SEQ ID NO.2.

[0014] Using the AcMYC2 protein sequence from kiwifruit, homologous proteins from kiwifruit and tomato were retrieved and collected from NCBI. Phylogenetic trees were constructed using Mega5.1, revealing that AcMYC2 clustered with tomato SlMYC1 (Solyc10g009290.1.1) and SlMYC2 (Solyc01g096370.4.1) in a group with 86% homology.

[0015] By promoting the activity of the AcMYC2 gene-encoded protein in kiwifruit, the softening process of fruit under postharvest low-temperature storage conditions can be delayed, the resistance to chilling injury under postharvest low-temperature storage conditions can be improved, and the storage tolerance of postharvest fruit can be positively regulated.

[0016] Alternatively, the softening process of fruit under postharvest low-temperature storage conditions can be promoted by inhibiting the activity of the protein encoded by the AcMYC2 gene in kiwifruit.

[0017] The beneficial effects of this invention are:

[0018] This invention discovered a gene, AcMYC2, from the bHLH gene family in kiwifruit, with its CDS nucleotide sequence shown in SEQ ID NO.1. Studies revealed a significant positive correlation between AcMYC2 gene expression and fruit storage performance under postharvest low-temperature storage conditions. This invention further found that silencing the AcMYC2 gene inhibits the activity of antioxidant enzymes in kiwifruit, significantly increases hydrogen peroxide content, and accelerates fruit softening under postharvest low-temperature storage conditions. Overexpression of the AcMYC2 gene significantly reduces the degradation rate of protopectin, enhances antioxidant enzyme activity, slows down fruit softening under postharvest low-temperature storage conditions, prolongs postharvest fruit storage time, and improves the fruit's resistance to chilling injury under these conditions, positively regulating fruit storability. The findings of this invention provide new insights for cultivating storable fruit varieties, helping to reduce fruit storage losses and improve production efficiency. Attached Figure Description

[0019] Figure 1 PCR amplification of the full-length cDNA of the AcMYC2 gene.

[0020] Figure 2 Subcellular localization of AcMYC2 protein.

[0021] Figure 3 To validate the transcriptional level of AcMYC2-silenced kiwifruit.

[0022] Figure 4 The determination of physiological indicators for softening kiwifruit fruit; among which, Figure 4 In section A, the determination of soluble solids content is performed. Figure 4 B represents the assay of PG enzyme activity. Figure 4 C in the figure represents the mass fraction of soluble pectin. Figure 4 D represents the mass fraction of soluble pectin.

[0023] Figure 5 The antioxidant enzyme activity and H2O2 accumulation of kiwifruit in different groups under two storage conditions were determined; among them, Figure 5 In section A, POD enzyme activity was measured. Figure 5 B represents the assay of SOD enzyme activity. Figure 5 C represents the APX enzyme activity assay. Figure 5 D represents the determination of hydrogen peroxide content.

[0024] Figure 6 The determination of physiological indicators of tomato fruit softening; among them, Figure 6 In section A, PG enzyme activity is detected. Figure 6 In the middle, B represents the firmness of the fruit. Figure 6 In this context, C represents the mass fraction of originally soluble pectin. Figure 6 D represents the mass fraction of soluble pectin.

[0025] Figure 7 The antioxidant enzyme activity and H2O2 accumulation of tomato fruits in different groups under two storage conditions were determined; among them, Figure 7 In section A, POD enzyme activity was measured. Figure 7 B represents the assay of CAT enzyme activity. Figure 7 C represents the assay of SOD enzyme activity. Figure 7 D represents the determination of hydrogen peroxide content.

[0026] Figure 8 The lycopene content in tomato fruits was determined under two storage conditions. Detailed Implementation

[0027] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0028] As mentioned earlier, kiwifruit is a climacteric fruit, and low-temperature storage is commonly used to extend its shelf life. However, under prolonged low-temperature storage conditions, fruit quality is difficult to maintain, and the fruit is also prone to chilling injury, leading to deterioration in quality. AcMYC2 is a novel gene from the bHLH gene family discovered in kiwifruit. For gene function research, changes in a single or a few bases can affect gene function. Current technology has not yet investigated the role of the AcMYC2 gene in the storability of kiwifruit under postharvest low-temperature storage conditions.

[0029] Based on this, the present invention provides a kiwifruit AcMYC2 gene, its encoded protein, and its application to regulate the fruit softening process under postharvest low-temperature storage conditions, improve the fruit's resistance to chilling injury under these conditions, and positively regulate the fruit's storability. This application first discovered a novel gene, AcMYC2, from the bHLH gene family in kiwifruit, whose CDS nucleotide sequence is shown in SEQ ID NO.1, as follows:

[0030] SEQ ID NO.1:

[0031] ATGACGGACTACCGATTACCGACGATGAATCTGTTGACGGACGATGCGGCCTCGATGTTCGTGACCTCCGATCTGACGGCGCTATGGCCGCAGCCGCCGTCATCCTCCGCCTCCAACTCCACCGCCACGGCGCCGCATCCGGCGTTCTTCAACCAGGAGACCCTCCAGCAGCGGCTTCAGGCCCTGATCGAGTGGGCCCGGGAGAGCTGGACCTACGCCATCTTCTGGCAGCCGTCGGCGGACTTCTCAGCTGGCGGATCTGTGCTCGGTTGGGGAGA

[0032] CGGCTACTACAAAGGCGACGAAGACAAGGCCAAGCACGCGGCGGCGGCGCCGTCG

[0033] TCGGAGGAGCAGGCGCACCGTAAGAAGGTCCTCCGCGAGCTAAGCTCGCTGATCTC

[0034] AGACGCACCGCCGTTGGCCGACGACACGGTGGAGGAGGAAGTCACCGACACCGAG

[0035] TGGTTCTTCCTCGTGTCGATGACTCAGTCGTTCGTCAATGGCAGCGGGCTTCCGGGT

[0036] CAGGCCCATTTCAGCTCATCCCCGATTTGGGTCACCGGATCCGAGCGTCTCGCGGCT

[0037] TCGCCCTGCGAGCGAGCGAGACAAGGCCAATTGTTCGGGTTACGGACCATGGTGTG

[0038] TATACCGTCCGTTAACGGAGTCTTGGAATTAGGTTCGACCCAATTGATCTTTCAGAG

[0039] TTCGGATCTGATGAATAAGGTTAGGATTTTATTCAATTTCAATAGTATCGAATCTAT

[0040] CGATACGGGCTCGTGGTCGGTGCCCGAAGAATCCGATCCTTCAACCGTGTATTTAAC

[0041] CGATCCTGCGGCTGAAATCAGAGAATCGGTGAACACTACTTCTCCATCAATTCTATC

[0042] TAATAGTCATCAATTGTCAAAGCACATCGAATTCGAAAACCCTATTGCAATTCAGG

[0043] CTTCAAATCACAACACCCACCCACAAAACCAACAACAATTTGCCAGAAAATTAAAT

[0044] TTTTTTGAATTTGGCCATGACGGGAGTAGTATTCGGAATGATAATTCGTTTTCATGC

[0045] AAGCCCGAGTCCGGTGAGGTATTGAGTTTTGGGGAAAGTAAGAAGAGCTCGTGTAG

[0046] TGCAAATGTCAATCCCTTAACGGGTCATTCCCAATTCGGGGCTGCGAAGGATACGA

[0047] ATAAGAAGAGATCAGTCACTTCCCGGGGTAGCGACGAAGAAGGCATGCTTTCGTTT

[0048] GGCTCGGGTGTGATCTTGCCCTCTTCAGGGGCAGTGAAGTCGAGCTGCGGTGGTGG

[0049] TGGAGATTCAGACCACTCTGATCTCGAAGCATCCGTGATTCGTGAGGCTGAGAGCA

[0050] GCAGAGTCATAGATCCGGAGAAAAAGCCTCGCAAGCGGGGGAGAAAGCCCGCGAA

[0051] TGGAAGGGCAGAGCCATTGAATCACGTTGAGGCTGAAAGGCAGAGGCGAGAAAAG

[0052] CTTAACCAGAGGTTCTATGCGCTCAGGGCGGTGGTTCCAAATGTGTCGAAAATGGA

[0053] CAAAGCTTCGCTTCTTGGAGACGCCATTTCTTACATCAACCAGCTCAAATCCAAGCT

[0054] TCTAGCTGCAGAGTCTGACAAGGAAGAAATGAGGGACCAAATGGAGGCTTTGAAG

[0055] AAAGAATTGGCCAGTGAAAAATCTCGATTTTCAGGTCCACATCCACCTGATAAAAA

[0056] TCTCAAAACACCCAATCACCATGGAAGCCATCTGATAGATGTGGATATTGATGTGA

[0057] AGATAATTGGGAGGGACGCGATGATTCGGATCCAGTGTAACAAGAAGAACCACCCT

[0058] GCAGCGAGGCTAATGTCGGCTCTGAGAGAGCTAGACCTCGATGTGCACCATGCCAG

[0059] TGTGTCGGTAGTGAATGATTTGATGATCCAACAGGCCTCTGTGAAGATGGGTGGTC

[0060] GATTTTACACCCAAGAGCAGCTCAAGCTTGCTCTATCGTCTAAAATTGCTGATATTC

[0061] GATAA。

[0062] The amino acid sequence of the protein encoded by the AcMYC2 gene is shown in SEQ ID NO.2, as follows:

[0063] SEQ ID NO.2:

[0064] .

[0065] Furthermore, the study found a significant positive correlation between the expression of the kiwifruit AcMYC2 gene and fruit firmness under postharvest low-temperature storage conditions. Silencing the kiwifruit AcMYC2 gene inhibited the activity of antioxidant enzymes in the kiwifruit fruit, significantly increased the hydrogen peroxide content in the kiwifruit fruit, and accelerated the softening process of the fruit under postharvest low-temperature storage conditions. Overexpression of the kiwifruit AcMYC2 gene significantly reduced the degradation rate of protopectin content, enhanced the activity of antioxidant enzymes in the fruit, delayed the softening process of the fruit under postharvest low-temperature storage conditions, extended the storage time of the postharvest fruit, and improved the fruit's resistance to chilling injury under postharvest low-temperature storage conditions.

[0066] The specific embodiments of the present invention will be described in further detail below with reference to examples. The following detailed descriptions are illustrative and intended to provide further explanation of this application, rather than limiting the scope of the invention.

[0067] Example 1: Cloning of the AcMYC2 gene and subcellular localization of the protein encoded by the AcMYC2 gene

[0068] (1) Cloning of the AcMYC2 gene

[0069] Kiwifruit DNA was extracted as a template, and Actin was used as an internal reference gene (Yolanda Ferradás, Laura Rey, Martínez, Manuel Rey, M a Victoria González, Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit, Plant Physiology and Biochemistry, Volume 102, 2016, Pages 27-36.), based on the CDS sequence of AcMYC2 predicted by transcriptome sequencing, primers shown in SEQ ID NO.3-SEQ ID NO.4 were designed to amplify the AcMYC2 gene, and primers shown in SEQ ID NO.5-SEQ ID NO.6 were used to amplify Actin. The amplification results are as follows. Figure 1 As shown, the amplified band was recovered by agarose gel electrophoresis to obtain an AcMYC2 gene fragment of 1911 bp.

[0070] SEQ ID NO.3:

[0071] GAGCTCGGTACCCGGGGATCCATGAATCTGTTGACGGAC;

[0072] SEQ ID NO.4:

[0073] TTCTCCTTTACTCATGTCGACTCGAATATCAGCAATTTTAG.

[0074] SEQ ID NO.5:

[0075] CCACCACGGAGACGGAGCAC;

[0076] SEQ ID NO.6:

[0077] TGCAGATCTTCGTGAAAACC.

[0078] (2) Subcellular localization of the AcMYC2 gene-encoded protein

[0079] To clarify the cellular localization of the AcMYC2 protein, the CDS of AcMYC2 was ligated into the 35S::Pzp211-GFP expression vector. The constructed fusion plasmid and p35S::GFP plasmid were then transformed into Agrobacterium GV3101, which transiently infected Nicotiana benthamiana. After 2 days of culture, two-photon laser confocal microscopy revealed that the fluorescence of p35S::GFP was distributed in the cytoplasm and nucleus, while the AcMYC2 fusion green protein fluorescence was localized in the nucleus. Figure 2 The nuclear indicator DAPI, with its blue fluorescence, is localized to the cell nucleus. The two overlap in the fusion diagram, indicating that the AcMYC2 protein is localized to the cell nucleus.

[0080] Example 2: Obtaining AcMYC2 gene silencing positive fruits and overexpression positive fruits

[0081] 1. Obtaining AcMYC2 gene-silenced positive fruits

[0082] (1) A 360bp AcMYC2-specific gene fragment was amplified using the primers shown in SEQ ID NO.7-SEQ ID NO.8. The AcMYC2-specific gene fragment was then homologously recombinated with the TRV2 vector to obtain TRV2-MYC2.

[0083] pTRV2-F:AGAAGGCCTCCATGGGGATCCAATTAGGTTCGACCCAAT (SEQ ID NO.7);

[0084] pTRV2-R:GGGACATGCCCGGGCCTCGAGAATTATCATTCCGAATACTACT (SEQ ID NO. 8).

[0085] (2) TRV-mediated virus silencing technology was used to transiently silence kiwifruit fruits. The specific method is as follows: Sixty 'Taishan No. 1' kiwifruit fruits of uniform size and free from pests and diseases during the color-changing stage were divided into three equal portions as infection materials. A mixed bacterial suspension of equal volumes of TRV2-MYC2 and TRV1 was injected using a disposable sterile syringe (1 mL). 100 μL was injected evenly from two horizontal directions perpendicular to the fruit's central axis, to a depth of approximately 2 cm. Fruits injected with sterile water and fruits injected with empty vector served as negative controls. Repeat injections were performed at the same injection site every one day after the first injection, for a total of two injections. All fruits were placed in a 25℃ constant temperature incubator in the dark, with a relative humidity of 70%.

[0086] 2. Obtaining positive fruits from AcMYC2 gene overexpression vectors

[0087] The constructed AcMYC2-GFP vector (obtained by homologous recombination of the AcMYC2 gene fragment obtained in Example 1 with the p35S::GFP plasmid vector) was transformed into Agrobacterium LBA4404, and the tomato (Solanumlycopersicum, Micro Tom) was genetically transformed using the leaf disc method. Positive plants were screened to obtain overexpression lines.

[0088] Example 3: Verification of AcMYC2 Silencing Fruit Transcription Level

[0089] To detect the expression of the AcMYC2 gene in kiwifruit after harvest, RNA was extracted from wild-type (WT), empty vector (TRV2), and AcMYC2-silenced plants using conventional methods and reverse transcribed into cDNA. The AcMYC2 gene was then verified by qRT-PCR using primers shown in SEQ ID NO.9-SEQ ID NO.10.

[0090] QRT-AcMYC2-F: GCCGCAGGATCGGTTAAATA (SEQ ID NO.9);

[0091] QRT-AcMYC2-R: CTACTACAAAGGCGACGAAGAC (SEQ ID NO. 10).

[0092] The results showed that the relative expression level of the AcMYC2 gene was lowest in AcMYC2 gene-silenced positive plants. With WT as the control group, the relative expression level of the AcMYC2 gene in the silenced group decreased by 61.75%, while the relative expression levels in the empty vector group and the WT group were almost unchanged. Figure 3 ).

[0093] Example 4: Effects of AcMYC2 gene silencing on kiwifruit fruit quality

[0094] (1) Cell wall metabolism

[0095] Fruits from wild-type kiwifruit (WT), empty vector group (TRV2), and AcMYC2 gene-silenced positive plants (AcMYC2-silenced) were stored at 4℃ for 7 days. Fruits from wild-type kiwifruit (WT), empty vector group (TRV2), and AcMYC2 gene-silenced positive plants (AcMYC2-silenced) stored at room temperature for 7 days were used as controls. The soluble solids content, soluble content, original soluble pectin mass fraction, and PG enzyme activity in the fruits of different treatments were measured.

[0096] The test results showed that, after AcMYC2 silencing in kiwifruit, compared with room temperature storage (NT), the soluble solids content, soluble and original soluble pectin mass fraction, and PG enzyme activity of kiwifruit stored at low temperature (CT) decreased. Under the same low temperature condition of 4℃, compared with the empty control group, the soluble solids content increased by 9.6%. Figure 4 In the middle A), PG activity increased by more than 28.5% ( Figure 4 In the middle B group, the soluble pectin mass fraction increased by more than 26.3%. Figure 4 (C). These data indicate that the expression level of the AcMYC2 gene is negatively correlated with the storage time of 'Taishan No. 1' kiwifruit under low-temperature storage conditions.

[0097] (2) Antioxidant enzyme activity and reactive oxygen species

[0098] SOD, POD, and APX are antioxidant enzymes in the fruit, playing an important role in scavenging reactive oxygen species and maintaining the normal physiological metabolic activities of kiwifruit.

[0099] Fruits from wild-type (WT), empty vector (TRV2), and AcMYC2 gene-silenced positive plants were stored at 4℃ for 7 days. Fruits from wild-type (WT), empty vector (TRV2), and AcMYC2 gene-silenced positive plants stored at room temperature for 7 days were used as controls. The antioxidant enzyme activity and H2O2 accumulation of each group of kiwifruit under the two storage conditions were measured to explore whether AcMYC2 affects antioxidant enzyme activity and reactive oxygen species accumulation under low temperature storage.

[0100] Experimental results showed that compared with normal temperature storage (NT), the activity of peroxidase in kiwifruit was significantly increased and the content of reactive oxygen species (ROS) was reduced under low temperature (CT) conditions, indicating that low temperature storage helps improve the quality of kiwifruit. Under low temperature conditions, compared with the empty group, silencing AcMYC2 reduced the POD activity in kiwifruit by 45.2%. Figure 5 In the middle A), SOD activity decreased by 43.2% ( Figure 5 In the middle B), APX activity decreased by 23.3% ( Figure 5 (C). The hydrogen peroxide content increased by 28.6% (C). Figure 5 (D). The above results indicate that under low temperature conditions, silencing AcMYC2 significantly inhibits the activity of antioxidant enzymes in 'Taishan No. 1' kiwifruit, significantly increases the hydrogen peroxide content in 'Taishan No. 1' kiwifruit, and accelerates the softening process of kiwifruit under postharvest low-temperature storage conditions.

[0101] Example 5: Effects of AcMYC2 gene overexpression on tomato fruit quality

[0102] (1) Effect of AcMYC2 overexpression on tomato fruit firmness under low temperature storage

[0103] Tomato fruits harvested from wild-type (WT), empty vector (35S-GFP), and AcMYC2 overexpression positive plants (OE) at the color-breaking stage (the transition period from green to red ripe fruit, with yellow or light red spots appearing around the fruit navel, and less than 10% of the fruit being red) for 10 days were stored at 4℃ for 7 days. Tomato fruits from wild-type (WT), empty vector (35S-GFP), and AcMYC2 overexpression positive plants (OE) stored at room temperature for 7 days (at the color-breaking stage of 10 days) were used as controls. The firmness of the overexpression tomato fruits treated with low temperature and room temperature was tested using a CTX texture analyzer, and the activities of soluble pectin, soluble pectin, and PG in each group of tomatoes under the two storage conditions were measured.

[0104] The results showed that tomato fruit firmness was significantly higher under low-temperature storage (CT) than under normal-temperature storage (NT). At 4℃, overexpression of AcMYC2 reduced PG enzyme activity by more than 15.3%. Figure 6 In the case of B), the soluble pectin mass fraction decreased by more than 28.3%. Figure 6 In the middle (D), the mass fraction of soluble pectin increased by more than 26.3% ( Figure 6 (C) After AcMYC2 overexpression, the degradation rate of protopectin content during fruit ripening was significantly reduced, and the accumulation of soluble pectin decreased, indicating that AcMYC2 gene overexpression inhibited protopectin degradation. In conclusion, under low temperature conditions, increased AcMYC2 expression is beneficial to enhancing the firmness of tomato fruits, and overexpression of AcMYC2 increases the storage tolerance of tomato fruits.

[0105] (2) Effects of AcMYC2 overexpression on antioxidant enzyme activity and reactive oxygen species in tomato under low temperature conditions

[0106] Fruits from wild-type tomato (WT), empty vector group (35S-GFP), and AcMYC2 overexpression positive plants (OE1, 2, 3) were stored at 4℃ for 7 days. Fruits from wild-type tomato (WT), empty vector group (35S-GFP), and AcMYC2 overexpression positive plants (OE) stored at room temperature for 7 days were used as controls. The antioxidant enzyme activity and H2O2 accumulation of tomatoes in each group under the two storage conditions were measured.

[0107] Experimental results showed that, compared with normal temperature storage (NT), low temperature treatment (CT) significantly increased the activities of SOD, POD, and CAT, while reducing the reactive oxygen species content in tomato fruits. Under low temperature treatment, the activities of SOD, POD, and CAT in overexpressing tomato fruits were higher than those in the unexpressed group. These results demonstrate that low temperature affects the antioxidant enzyme activity of tomatoes by influencing AcMYC2 expression.

[0108] (3) Effect of AcMYC2 overexpression on lycopene content in tomato fruit

[0109] Lycopene, an important antioxidant in tomato fruit, possesses antioxidant, bactericidal, and free radical scavenging properties. Fruits from wild-type (WT), empty vector (35S-GFP), and AcMYC2 overexpression-positive plants (OE) were stored at 4℃ for 7 days, with fruits from these three groups stored at room temperature for 7 days serving as controls. The lycopene content of each group of fruits under the two storage conditions was determined.

[0110] The method for determining lycopene content is as follows: Weigh 1.5g of tomato fruit, grind it thoroughly in a mortar, transfer it to a 10mL centrifuge tube, add 6mL of a mixed solution of n-hexane:acetone:ethanol = 1:1:1, shake it in a shaker at 150rpm for 30min, add 2mL of distilled water after shaking, centrifuge at 5000×g for 15min, take the supernatant and measure the absorbance at 502nm.

[0111] The results showed that, in all components, the lycopene content in tomato fruits after low-temperature storage was higher than that after normal-temperature storage. Low-temperature storage reduced the decrease in lycopene content. Under low-temperature storage conditions, the lycopene content in overexpressed transgenic tomato fruits was 28.4%, 33.1%, and 31.6% higher than that in the empty vector group, respectively. This indicates that the increase in AcMYC2 expression increased the lycopene content in tomato fruits.

[0112] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of this application should be included within the scope of protection of this application.

Claims

1. AcMYC2 Application of a gene in improving low-temperature storage performance of fruits, the gene AcMYC2 The CDS nucleotide sequence of the gene is shown as SEQ ID NO. 1, the fruits are kiwi fruits or tomato fruits, and the improving low-temperature storage performance of the fruits comprises: Overexpression AcMYC2 Genes, Promoting AcMYC2 Expression of genes, delaying the softening process of fruits under postharvest low temperature storage conditions, positively regulating the storage tolerance of postharvest fruits.

2. AcMYC2 The use of a protein encoded by a gene for improving the low-temperature storage properties of fruits, characterized in that The AcMYC2 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 2, the fruit is a kiwi fruit or a tomato fruit, and the improvement of the low-temperature storage performance of the fruit comprises overexpression of the AcMYC2 protein, promotion of expression of the AcMYC2 protein, delay of the softening process of the fruit under postharvest low-temperature storage conditions, and positive regulation of the storage tolerance of the postharvest fruit.

Images