Gene LRK21 for regulating and controlling resistance of rice sheath blight disease as well as encoding protein and application of gene LRK21

Through omics and reverse genetics technology, the rice streak blight resistance gene LRK21 was identified and verified, and the problem of insufficient QTL effect of rice streak blight resistance in the existing technology was solved, and effective regulation of rice streak blight resistance was achieved, and new gene resources were provided for the improvement of rice varieties.

CN120099028APending Publication Date: 2025-06-06YANGZHOU UNIV

Patent Information

Application Number
CN202510268924.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

In the prior art, the resistance of rice to striatric blight mainly depends on quantitative trait loci (QTL) or multigene control, but most identified QTL effects are not obvious, making it difficult to effectively prevent and treat striatric blight.

Method used

Differentially expressed genes were screened through omics technology, combined with reverse genetics technology, and regulating rice streak blight resistance gene LRK21 was identified and verified, and its knockout and overexpression materials were constructed to clarify its biological function in streak blight resistance.

Benefits of technology

Knockout and overexpression of the LRK21 gene can significantly affect the resistance of rice to striae blight, provide new gene resources, and provide an important theoretical basis for the research on the resistance mechanism of rice striae blight and variety improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099028A_ABST
    Figure CN120099028A_ABST
Patent Text Reader

Abstract

The invention discloses a gene LRK21 for regulating and controlling the resistance of rice sheath blight disease as well as an encoding protein and application thereof, and belongs to the technical field of plant genetic engineering. The novel gene LRK21 for regulating and controlling the resistance of the rice sheath blight disease is identified, and the identification result of the resistance of the sheath blight disease of in-vitro leaf sheaths in a climatic chamber proves that the resistance of rice to the sheath blight disease can be weakened by knocking out the gene LRK21, and the resistance of the rice sheath blight disease can be reduced by overexpression of the gene LRK21. The result shows that the LRK21 gene participates in the regulation and control of the resistance of the rice sheath blight disease, and the disorder of the function of the LRK21 can influence the resistance of the rice to the sheath blight disease, so that an important gene resource is provided for the research on the resistance mechanism of the rice sheath blight disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a rice sheath blight resistance regulating gene LRK21 and a coded protein and application thereof. Background Art

[0002] Rice sheath blight, as one of the main fungal diseases of rice, poses a serious threat to rice yield and food security. With the increase in nitrogen fertilizer application, the promotion of compact varieties and the increase in planting density, the occurrence and spread of sheath blight has shown a trend of increasing year by year. Its incidence area ranks first among the three major rice diseases, seriously affecting my country's food production safety. At present, the prevention and control of sheath blight relies heavily on chemical agents, which not only increases production costs but also has adverse effects on the environment. Therefore, cultivating rice varieties resistant to sheath blight is the most economical and effective method.

[0003] However, rice resistance to sheath blight is a quantitative trait controlled by quantitative trait loci (QTL) or multiple genes. Currently, several QTLs for sheath blight resistance have been identified, but near-isogenic lines and multi-environment experiments have shown that most QTLs have insignificant effects. In contrast, the combination of reverse genetics with omics technologies such as genomics and transcriptomics provides a new solution to this problem. By using omics technology to screen differentially expressed genes or gene sets related to specific traits, and then using reverse genetics technology for systematic verification and cloning, we can more comprehensively and efficiently explore genetic resources related to specific biological processes. Therefore, exploring and cloning more genes involved in regulating sheath blight resistance will provide a basis for further studying the molecular mechanism of gene regulation of sheath blight resistance, which has important theoretical value. Summary of the invention

[0004] Purpose of the invention: In view of the deficiencies in the prior art, the present invention provides a gene LRK21 for regulating rice sheath blight resistance. The present invention identifies a new gene LRK21 for regulating rice sheath blight resistance, analyzes the response of the LRK21 gene to sheath blight infection and tissue expression pattern, and creates knockout and overexpression materials, thereby clarifying the biological function of LRK21 in regulating sheath blight resistance. The results will provide a basis for further studying the molecular mechanism of LRK21 gene regulating sheath blight resistance.

[0005] The present invention also provides application of the rice sheath blight resistance regulating gene LRK21.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a gene LRK21 for regulating rice resistance to sheath blight, and the CDS sequence of the gene LRK21 is shown in SEQ ID NO.1.

[0007] Among them, the primer pair used to amplify the gene LRK21 is:

[0008] LRK21-F:5'-ACCATGGCACTGATGCACACAC-3',

[0009] LRK21-R:5'-GTGTGAATTAGCTCTGGTGCAAGG-3'.

[0010] The protein encoded by the rice sheath blight resistance gene LRK21 of the present invention has an amino acid sequence as shown in SEQ ID NO.2.

[0011] The present invention is based on the gene knockout vector pCXUN-Cas9-LRK21 for regulating the rice sheath blight resistance gene LRK21.

[0012] The gene knockout vector construction method comprises the following steps: designing and synthesizing sgRNA that recognizes the target site: 5'-CCTCCTTGAGCTGACCAACGG-3', adding a linker to the first 18 base sequences of CGG as follows: LRK21_sg-F: 5'-TGTG-G(CCTCCTTGAGCTGACCAA)-3', LRK21_sg-R: 5'-AAAC-(TTGGTCAGCTCAAGGAGG)C-3'; obtaining an intermediate product by primer annealing to introduce the knockout target of LRK21, connecting the intermediate product with the enzyme-cut linear vector pOs, transforming Escherichia coli and verifying by sequencing, and finally obtaining the gene knockout vector pOs-LRK21.

[0013] The invention contains the overexpression vector LRK-OE for regulating the rice sheath blight resistance gene LRK21.

[0014] Among them, the construction method of the overexpression vector pU1301-LRK21-GFP is to design primers LRK21_OE-F: CGAACGATAGCCGGTACCATGAAGATTGCACTCTCCTT and LRK21_OE-R: GTCGACTCTAGAGGATCCTCTTCCTCCTGATAGGTCAG with a pU1301 vector linker, amplify the LRK21 gene CDS sequence, recombinantly connect it to the pU1301 vector, transform it into Escherichia coli and verify it by sequencing, and finally obtain the overexpression vector pU1301-LRK21.

[0015] The invention discloses an application of the gene LRK21, the encoded protein, the gene knockout vector or the overexpression vector in regulating resistance to rice sheath blight.

[0016] Among them, editing the rice LRK21 gene through CRISPR / Cas9 reduced the resistance to rice sheath blight and increased its susceptibility to the disease; overexpressing the LRK21 gene reduced the resistance to rice sheath blight and increased its susceptibility to the disease.

[0017] The use of the gene LRK21 of the present invention, or the encoded protein of claim 2, or the gene knockout vector of claim 4, or the overexpression vector of claim 6 in cultivating germplasm with controllable resistance to rice sheath blight.

[0018] The present invention identifies a new gene LRK21 for regulating rice sheath blight resistance based on the transcriptome of sheath blight pathogen and the obvious difference in expression before and after inoculation, and the results of in vitro sheath blight resistance identification in a climate chamber prove that knockout of the LRK21 gene can weaken the resistance of rice to sheath blight, and overexpression of LRK21 can also reduce the resistance of rice to sheath blight, indicating that the LRK21 gene is involved in regulating rice sheath blight resistance, and LRK21 function disorder will affect rice resistance to sheath blight, providing important gene resources for the study of the resistance mechanism of rice sheath blight, and having important theoretical value.

[0019] The present invention screened and identified a gene LRK21 that reduces rice sheath blight resistance when overexpressed or knocked out. The development of the gene of the present invention provides assistance for the breeding of rice varieties with multiple resistance capabilities. By regulating genes to reduce disease resistance, plants can use resources more efficiently and adapt to environments with low pathogen pressure. For example, in a drought or nutrient-deficient environment, plants may preferentially allocate resources to drought resistance or nutrient absorption-related genes rather than disease-resistant genes. For example, plants may allocate more resources to growth, reproduction or other physiological processes by reducing disease resistance, thereby improving overall adaptability. For example, by reducing disease resistance, plants can allow the coexistence of beneficial microorganisms, thereby promoting nutrient absorption, enhancing stress resistance, etc. The present invention provides more options for the development of later rice sheath blight resistance-regulated varieties, and this regulatory mechanism helps to cultivate crop varieties that are more adaptable to specific environments.

[0020] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0021] The present invention identifies a new gene LRK21 that regulates rice sheath blight resistance, providing a new gene resource for molecular genetic improvement of regulating rice sheath blight resistance. The present invention reduces rice resistance to sheath blight by knocking out the gene, and overexpression can also significantly reduce rice resistance to sheath blight, indicating that the gene LRK21 has an important function in regulating sheath blight resistance.

[0022] The present invention clones the gene LRK21 regulating rice sheath blight resistance by molecular biological methods, and proves its function of rice sheath blight resistance. The gene mining and transgenic material acquisition method of the present invention has clear operation steps, strong replicability, and good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Figure 1 is the expression pattern of LRK21 gene. Figure A shows the relative expression of LRK21 gene in response to sheath blight infection at different time periods; HPI: hours post inoculation. Figure B shows the relative expression of LRK21 gene in different tissues; R: root; S: stem; L: leaf blade; LS: leaf sheath; P: panicle.

[0024] Figure 2 Figure 1 is the change of nucleotide sequence of LRK21 triple knockout lines (lrk21-ko1, lrk21-ko2, lrk21-ko3). Figure 2 is the change of protein sequence of LRK21 triple knockout lines (lrk21-ko1, lrk21-ko2, lrk21-ko3). Figure 3 is the expression level detection of protein of LRK21 overexpression material. Figure 4 is the transcription level detection of LRK21 overexpression material.

[0025] Figure 3 The results of the identification of sheath blight resistance of three knockout lines and three overexpression lines of the LRK21 gene. Figure A shows the phenotypes and lesion length results of the three knockout lines of the LRK21 gene in vitro in the climate chamber for the identification of sheath blight resistance; Figure B shows the phenotypes and lesion length results of the three overexpression lines of the LRK21 gene in the greenhouse for the identification of sheath blight resistance at the booting stage. "*" indicates a significant difference at the 5% level, i.e., p≤0.05; "**" indicates an extremely significant difference at the 1% level, i.e., P≤0.01. Scale bar = 5 cm. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0027] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0028] The experimental methods without specific conditions in the examples are usually carried out under conventional conditions or conditions recommended by the manufacturers.

[0029] The rice genetic transformation material in the present invention is the japonica rice variety Nipponbare (NIP), which is provided by the rice germplasm resource bank of Yangzhou University.

[0030] The sheath blight strain used in the present invention is a moderately strong pathogenic strain YN-7 provided by Yangzhou University (Lee D Yet et al, BMC Genomics. 2021Apr 7; 22(1): 242.).

[0031] The knockout vector pOs and the overexpression vector pU1301 are both known vectors, as described in Targeted mutagenesis in rice using CRISPR-cas system (Miao et al, Cell Research. 2013 Oct; 23(10): 1233-1236) and OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling (Qiu et al, Molecular Plant-microbe Interactions. 2007 May; 20(5): 492-499). Both are preserved and provided by Yangzhou University.

[0032] Example 1

[0033] Identification and cloning of LRK21 gene

[0034] The cloning method of LRK21 gene comprises the following steps:

[0035] Using the genome of rice variety NIP as reference sequence, PCR amplification primers for LRK21 gene were designed:

[0036] LRK21-F:5'-ATGAAGATTGCACTCTCCTT-3',

[0037] LRK21-R:5'-CTATCTTCCTCCTGATAGGT-3',

[0038] The cDNA of rice variety NIP was used as a template for PCR amplification. The PCR amplification method was referred to the instruction manual of NoviZan Phanta Max Super-Fidelity DNA Polymerase. The PCR amplification product was recovered and purified (Tiangen Ordinary Agarose Gel DNA Recovery Kit DP209) and sequenced (Qingke Biotechnology Co., Ltd.) to obtain the correct CDS sequence of the LRK21 gene.

[0039] The nucleotide sequence encoded by the CDS sequence of the rice LRK21 gene of the present invention is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.2.

[0040] Example 2

[0041] Analysis of expression characteristics of LRK21 gene

[0042] RNA samples from different tissues (roots, stems, leaves, leaf sheaths, and panicles) of rice varieties susceptible to NIP were collected during the booting period, and the total RNA of each rice sample was extracted using the Trizol method. The first-strand cDNA was synthesized by ⅢRT SuperMix for qPCR (Nanjing Novizan Biotechnology Co., Ltd.) reverse transcriptase, and the synthesis method was carried out according to the instructions of its reverse transcriptase. Using the cDNA of the above-mentioned different tissues as templates, the rice OsActin gene was used as an internal reference gene (OsActin gene quantitative primers qActin-F: 5'-CTAAGCCAAGAGGAGCTGTTAT-3' and qActin-R: 5'-ATAACAGATAGGCCGGTTGAAA-3'), and LRK21 gene specific quantitative primers (qLRK21-F: 5'-ACCATGGCACTGATGCACACAC-3' and qLRK21-R: 5'-GTGTGAATTAGCTCTGGTGCAAGG-3') were used for real-time quantitative PCR to detect the expression level of the LRK21 gene in different rice tissues. The qRT-PCR reaction system was: qPCR Master Mix (Nanjing Novogene Biotechnology Co., Ltd.) 5μL, front and back primers 0.5μl (10μmol / L), cDNA template 5μl (100ng / μl). The qRT-PCR reaction was performed using the Bio-Rad CFX96 TouchTM fluorescent quantitative PCR instrument under the following conditions: 95°C pre-denaturation for 3min; 95° denaturation for 15s, 60° annealing extension for 30s, 40 cycles. The expression value data were converted and analyzed using the 2-△△ct method. The reaction conditions were: 95°C, 30sec, 95°C, 10sec, 60°C, 10sec, 40 cycles of reaction; 95°C, 15sec, 60°C, 60sec, 95°C, 15sec to read the melting curve.

[0043] NIP was cultured in a normal field environment until the end of tillering and inoculated with Rhizoctonia solani YN-7. The embedding method was used for inoculation (Pan Xuebiao, Journal of Jiangsu Agricultural College, 1997, (03): 28-33). The 1 cm long and 2 mm wide wood bark (covered with hyphae) attached with Rhizoctonia solani YN-7 hyphae was carefully embedded into the leaf sheath 1 cm-2 cm below the second leaf of the rice. The rice leaf sheath tissues of the 1 cm section above and below the inoculum were cut before inoculation (0 h) and 6 h, 9 h, 12 h, 24 h and 48 h after inoculation, and stored in liquid nitrogen. The experimental process of RNA extraction, reverse transcription and qRT-PCR was the same as the above steps for determining the expression level of rice tissue.

[0044] like Figure 1 As shown in A, the LRK21 gene showed a characteristic of continuous up-regulation after infection by sheath blight. Figure 1 As shown in B, the LRK21 gene showed a constitutive expression pattern, that is, it was expressed in all tissues, but the expression level was relatively high in leaves and sheaths.

[0045] Example 3

[0046] Vector construction, genetic transformation and detection

[0047] 1. Steps for constructing CRISPR / Cas9 knockout vector for rice LRK21 gene:

[0048] (1) Select a target site with high knockout efficiency, design and synthesize sgRNA that recognizes the target site. The sequence is sgRNA: 5'-CCTCCTTGAGCTGACCAACGG-3', and add a linker to the first 18 base sequences of CGG as follows: LRK21_sg-F: 5'-TGTG-G(CCTCCTTGAGCTGACCAA)-3', LRK21_sg-R: 5'-AAAC-(TTGGTCAGCTCAAGGAGG)C-3'.

[0049] (2) The intermediate product was obtained by primer annealing to introduce the knockout target of LRK21. The reaction system and conditions were as follows: 1 μL of the front primer LRK21_sg-F (10 μM), 1 μL of the rear primer LRK21_sg-R (10 μM), 8 μL of Anneal Buffer (1xTE buffer, 50 mM NaCl), 95°C for 10 min, and then decreased to 20°C at 0.1°C / sec.

[0050] (3) Use restriction endonuclease BsaI (Takara) to cut the specific restriction site on the pOs vector to make it linear. The restriction endonuclease reaction system and conditions are as follows: plasmid 1 μg, 10x buffer 5 μL, BsaI 1 μL, ddH 2O to 50 μL, incubate at 37°C for 2-3 h, and recover using the DNA purification kit (Tian Gen Ordinary Agarose Gel DNA Recovery Kit DP209).

[0051] (4) The annealed intermediate product was connected to the pOs linear vector after enzyme digestion. The connection reaction system and conditions were as follows: 2 μL of annealed product, 2 μL of linear vector, 0.5 μL of 10x T4 DNA Ligase Buffer, 0.5 μL of T4 DNA Ligase, and room temperature for 15 min.

[0052] (5) Transform E. coli DH5α. After the DH5α competent cells melt, add the ligation product from the previous step, place on ice for 30 min, heat shock at 42°C for 90 sec, place on ice for 2 min, add 700 μL of LB liquid medium without antibiotics, culture at 37°C at 200 rpm for 1 h, centrifuge at 5000 rpm for 1 min, discard most of the supernatant, retain 100 μL of the liquid, pipette and mix, spread on an LB solid medium plate containing kanamycin, and culture at 37°C for 12 h.

[0053] (6) Pick a single clone and place it in liquid LB medium containing kanamycin, culture it at 37°C for 6 h, and perform a PCR reaction on the bacterial solution. The PCR reaction is performed according to the conventional PCR amplification instructions of Novizan 2× Taq Master Mix (Dye Plus), where the primer sequences of the PCR reaction are:

[0054] M13F: 5'-TGTAAAACGAGCGGCCAGT-3',

[0055] LRK21_sg-R: 5'-AAACTTGGTCAGCTCAAGGAGGC-3',

[0056] The positive monoclonal bacterial solution was expanded, the plasmid was extracted and sequenced for verification. The plasmid extraction kit was (NoviZan Plasmid Mini Kit), and the sequencing company was Qingke Biotechnology Co., Ltd.

[0057] (7) The recombinant positive plasmid was transformed into Agrobacterium EHA105. The reaction system and conditions were as follows: 50 μL EHA105 competent cells, 1 μL recombinant plasmid, ice bath for 5 min, liquid nitrogen quick freezing for 5 min, 37°C water bath for 5 min, ice bath for 5 min. Add 700 μL LB liquid medium without antibiotics, culture at 28°C 200 rpm for 2 h, centrifuge at 5000 rpm for 1 min, discard most of the supernatant, keep 100 μL of liquid, pipette and mix, spread on LB solid medium plate containing kanamycin and rifampicin antibiotics, and culture at 28°C for two days.

[0058] (8) Pick a single clone and place it in a liquid LB medium containing kanamycin and rifampicin, culture it at 28°C for two days, and perform a PCR reaction on the bacterial solution, where the PCR reaction is the same as step (6). The positive single clone bacterial solution can be used for subsequent rice genetic transformation experiments.

[0059] 2. The steps for constructing the overexpression vector are as follows:

[0060] (1) Using the LRK21 gene CDS as the reference sequence, primers with pU1301 vector linkers were designed and synthesized. The primer sequences were: LRK21_OE-F: CGAACGATAGCCGGTACCATGAAGATTGCACTCTCCTT and LRK21_OE-R: GTCGACTCTAGAGGATCCTCTTCCTCCTGATAGGTCAG. Then, using the LRK21 gene CDS as a template, a high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase) was used for amplification to obtain the LRK21 gene CDS fragment with pU1301 vector linkers.

[0061] (2) The overexpression vector pU1301 was linearized by restriction endonucleases KpnI and BamHI (Takara). The restriction endonucleases and reaction conditions were the same as those in step 1 (3).

[0062] (3) Through homologous recombination enzyme (NoviZan IIOne Step Cloning Kit) was used to connect the LRK21 gene CDS with the linearized vector pU1301-GFP to obtain the recombinant plasmid pU1301-LRK21. Further, the overexpression vector Agrobacterium culture was obtained according to the methods (5)-(8) in step 1.

[0063] 3. The constructed knockout and overexpression vector Agrobacterium culture was sent to Weimi Biotechnology Co., Ltd. for rice genetic transformation, and the recipient rice variety was Nipponbare (NIP). After the rice genetic transformation was completed, the knockout lines (lrk21-ko1, lrk21-ko2 and lrk21-ko3) and overexpression lines (LRK21-OE#1, LRK21-OE#3 and LRK21-OE#11) were obtained for plant testing.

[0064] 4. Detection of genetically modified rice plants

[0065] (1) For the knockout plants, primers were designed and synthesized on both sides of the knockout target site, and the obtained T0 transgenic plants were sequenced. The sequencing primer sequences were:

[0066] LRK21-CXF: 5'GTGCCAGCGATGACCAGTTCG 3',

[0067] LRK21-CXR: 5'GCTGCCAGTGCTGTGGATAGATTG 3'.

[0068] like Figure 2 As shown in A, there are three types of mutations in the transgenic knockout lines, among which lrk21-ko1 has an insertion of base A, lrk21-ko2 has a deletion of one base C, and lrk21-ko3 has a deletion of seven bases. All three types of mutations lead to frameshift mutations in the LRK21 protein ( Figure 2 B).

[0069] (2) For the overexpressed plants, 11 T0 plants were first tested by Western Blot using GFP antibody ( Figure 2 C); then the RNA levels of the three strains LRK21-OE#1, LRK21-OE#3 and LRK21-OE#11 with higher protein expression were further tested, such as Figure 2 As shown in D, compared with the wild type, the expression levels of the LRK21 gene in the three overexpressed strains increased by 26.31, 24.13, and 27.40 times, respectively. The primer sequences for qRT-PCR were qLRK21-F: 5'-ACCATGGCACTGATGCACACAC-3' and qLRK21-R: 5'-GTGTGAATTAGCTCTGGTGCAAGG-3'.

[0070] Example 4

[0071] Identification of resistance to sheath blight in transgenic rice plants

[0072] The greenhouse sheath blight pathogen inoculation method was used to identify the sheath blight resistance of the wild type (WT, NIP), knockout lines (lrk21-ko1, lrk21-ko2 and lrk21-ko3) and overexpression lines (LRK21-OE#1, LRK21-OE#3 and LRK21-OE#11) of this gene.

[0073] The method for identifying resistance to greenhouse sheath blight is as follows:

[0074] When the rice plants grow to the 3-leaf stage, they are transplanted into long pots, with 5 plants per pot. After culturing to the end of tillering, they are moved to the glass greenhouse. When the rice plants grow to the early stage of booting, they are inoculated by embedding method. Before inoculation, the plants with natural disease and dead plants and small or redundant tillers are pruned. Use tweezers to carefully embed the 1cm long and 2mm wide wood bark (covered with hyphae) with the hyphae of Rhizoctonia solani YN into the inner side of the leaf sheath 1cm below the third leaf pillow from top to bottom. Each seedling is inoculated with 5 stems with relatively consistent growth periods. After inoculation, ensure that there is a water layer of no less than 1cm in the long pot, set the temperature and light conditions in the greenhouse to 14h light (30℃) / 10h dark (24℃), and use a spray humidifier to control the humidity in the greenhouse at 75%-90%. Investigate the length of the lesions 7d after inoculation.

[0075] When using greenhouse artificial inoculation, Figure 3 As shown in A, the average lesion lengths of the three transgenic knockout lines lrk21-ko1, lrk21-ko2, and lrk21-ko3 were between 13.45 and 14.10 cm, which were significantly or extremely significantly higher than those of the wild-type NIP plants (10.55 cm); Figure 3 As shown in Figure B, the average lesion lengths of the three transgenic overexpression lines LRK21-OE#1, LRK21-OE#3, and LRK21-OE#11 were between 17.47 and 18.53 cm, which were also significantly higher than those of the wild-type NIP plants (15.7 cm). The above results indicate that the gene LRK21 is involved in regulating rice sheath blight resistance, and the disorder of LRK21 function will affect rice resistance to sheath blight.

Claims

1. A gene LRK21 regulating rice resistance to sheath blight, characterized in that: The CDS sequence of the gene LRK21 is shown in SEQ ID NO.

1.

2. The gene LRK21 for regulating rice resistance to sheath blight according to claim 1, characterized in that: The primer pair used to amplify the gene LRK21 is: LRK21-F:5'-ACCATGGCACTGATGCACACAC-3', LRK21-R:5'-GTGTGAATTAGCTCTGGTGCAAGG-3'.

3. A protein encoded by the rice sheath blight resistance gene LRK21 according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

4. A gene knockout vector pOs-LRK21 for regulating the rice sheath blight resistance gene LRK21 according to claim 1.

5. The gene knockout vector pOs-LRK21 according to claim 4, characterized in that: The gene knockout vector construction method comprises the following steps: designing and synthesizing sgRNA that recognizes the target site: 5'-CCTCCTTGAGCTGACCAACGG-3', adding a linker to the first 18 base sequences of CGG as follows: LRK21_sg-F: 5'-TGTG-G(CCTCCTTGAGCTGACCAA)-3', LRK21_sg-R: 5'-AAAC-(TTGGTCAGCTCAAGGAGG)C-3'; obtaining an intermediate product by primer annealing to introduce the knockout target of LRK21, connecting the intermediate product with the linear vector pOs cut by enzyme, transforming Escherichia coli and verifying by sequencing, and finally obtaining the gene knockout vector pOs-LRK21.

6. An overexpression vector pU1301-LRK21 containing the rice sheath blight resistance regulating gene LRK21 according to claim 1.

7. The overexpression vector pU1301-LRK21-GFP according to claim 6, characterized in that: The overexpression vector pU1301-LRK21 is constructed by designing primers LRK21_OE-F: CGAACGATAGCCGGTACCATGAAGATTGCACTCTCCTT and LRK21_OE-R: GTCGACTCTAGAGGATCCTCTTCCTCCTGATAGGTCAG with a pU1301 vector linker, amplifying the LRK21 gene CDS sequence, recombining and connecting it to the pU1301 vector, transforming Escherichia coli and verifying by sequencing, and finally obtaining the overexpression vector pU1301-LRK21-GFP.

8. Use of the gene LRK21 according to claim 1, or the encoded protein according to claim 2, or the gene knockout vector according to claim 4, or the overexpression vector according to claim 6 in regulating resistance to rice sheath blight.

9. The use according to claim 8, characterized in that: By editing the rice LRK21 gene through CRISPR / Cas9, the resistance of rice to sheath blight is reduced and its susceptibility is increased; by overexpressing the LRK21 gene, the resistance of rice to sheath blight is reduced and its susceptibility is increased.

10. Use of the gene LRK21 according to claim 1 or the encoded protein according to claim 2 or the gene knockout vector according to claim 4 or the overexpression vector according to claim 6 preferably in cultivating germplasm for regulating rice sheath blight resistance.

Citation Information

Patent Citations

  • Novel nucleic acid sequences and their use in methods for achieving pathogen resistance in plants

    CA2459251A1

  • Gene OsDTC2 for regulating and controlling sheath blight resistance of rice as well as encoding protein and application of gene OsDTC2

    CN118497218A

  • Gene OsNeK2, encoding protein thereof and application of gene OsNeK2 in regulation and control of rice sheath blight resistance

    CN118531024A

  • Improvement of disease resistance of plant by introducing transcription factor gene

    WO2006126671A1

Cited By

  • OsLRK19 gene and application thereof in enhancing sheath blight resistance of rice

    CN119913176A

  • OsLRK19 gene and its application in enhancing rice resistance to sheath blight

    CN119913176B