Limited modification system coding gene, genetically engineered bacterium and application of genetically engineered bacterium in high yield of rhamnolipid

By knocking out restricted modification system and toxicity-related genes, increasing the copy number of rhamnolipid synthetic genes, and optimizing fermentation conditions, the problem of rhamnolipid yield limitation in the prior art was solved, and the construction of high-yield and low-toxic rhamnolipid engineering strains was achieved.

CN120099040APending Publication Date: 2025-06-06NORTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311643842.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-04
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to systematically and comprehensively modify the synthetic pathway of rhamnolipid, resulting in limited production.

Method used

By knocking out the restricted modification systems RM1 and RM2 in Pseudomonas aeruginosa, the type III secretion system regulatory gene exsA, and knocking out the extracellular polysaccharide synthesis gene pelA-G and alginate synthesis gene algD-F, the copy number of rhamnolipid transferase genes rhlAB and rhlC were increased, and the fermentation conditions were optimized to increase the yield of rhamnolipid.

Benefits of technology

The yield of rhamnolipids was significantly improved, the conversion efficiency of genetically engineered bacteria was enhanced, the toxicity of the strain was reduced, and the fermentation conditions were optimized to improve yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099040A_ABST
    Figure CN120099040A_ABST
Patent Text Reader

Abstract

The invention relates to the field of gene engineering, in particular to a restriction modification system coding gene, a genetically engineered bacterium and application of the restriction modification system coding gene and the genetically engineered bacterium in high-yield rhamnolipid. The coding gene is composed of a gene cluster RM1 and a gene cluster RM2. The genetically engineered bacterium does not contain limited modification system coding genes, and is constructed by an original strain with the preservation number of CCTCC (China Center For Type Culture Collection) NO: M2011287; the gene does not contain a type III secretion system regulation gene exsA, an exopolysaccharide synthesis gene pelA-G and an alginate synthesis gene algD-F; and the rhamnolipid transferase gene rhlAB and / or the rhamnolipid transferase gene rhlC are / is independently a plurality of copies. The method can effectively improve the yield of rhamnolipid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, in particular to a restriction modification system encoding gene and genetic engineering bacteria and applications thereof in high-yield rhamnolipid. Background Art

[0002] Rhamnolipids (RLs) are a new type of green biosurfactant. They have many functions of chemical surfactants. At the same time, they are non-toxic, pollution-free, and biodegradable. Therefore, they are widely used in oil pollution, environmental remediation, medicine, cosmetics, agriculture and other fields.

[0003] Pseudomonas aeruginosa (PA) is the main producer of rhamnolipids. Currently, most of the modifications to rhamnolipids are aimed at optimizing rhamnolipid production from a single perspective, such as simply optimizing fermentation or modifying strains for a certain gene, while systematic and comprehensive modifications are relatively rare.

[0004] The synthesis pathway of rhamnolipids has been studied relatively clearly, but due to its complex transcriptional regulatory network, the production of rhamnolipids is greatly limited. Therefore, the task of modifying the synthesis pathway of rhamnolipids through genetic engineering and then constructing a high-yield rhamnolipid strain has important practical value. Summary of the invention

[0005] In order to increase the production of rhamnolipid, the first aspect of the present invention provides a restriction modification system encoding gene, which is composed of a gene cluster RM1 and a gene cluster RM2, wherein the accession number of the gene cluster RM1 on NCBI is M1Q10_01380-M1Q10_01405, and the accession number of the gene cluster RM2 on NCBI is M1Q10_18660-M1Q10_18675.

[0006] The second aspect of the present invention provides the use of the restriction modification system encoding gene as described above in regulating the transformation efficiency of Pseudomonas aeruginosa plasmid and / or the rhamnolipid production.

[0007] The third aspect of the present invention provides a genetically engineered bacterium for producing rhamnolipid, which does not contain the gene cluster RM1 and / or gene cluster RM2 as described above, and is constructed from the original strain with a deposit number of CCTCCNO: M2011287.

[0008] In some embodiments, the genetically engineered bacteria does not contain the type III secretion system regulatory gene exsA.

[0009] In some embodiments, the genetically engineered bacteria do not contain the exopolysaccharide synthesis gene pelA-G and / or the alginate synthesis gene algD-F.

[0010] In some embodiments, the rhamnolipid transferase gene rhlAB and / or the rhamnolipid transferase gene rhlC are each independently multiple copies.

[0011] The fourth aspect of the present invention provides a genetically engineered bacterium for producing rhamnolipid, the genetically engineered bacterium does not contain the restriction modification system encoding gene described in claim 1, and the genetically engineered bacterium is constructed from the original strain with a deposit number of CCTCC NO: M2011287;

[0012] Among them, the genetically engineered bacteria do not contain the type III secretion system regulatory gene exsA;

[0013] Among them, the genetically engineered bacteria do not contain the exopolysaccharide synthesis gene pelA-G and the alginate synthesis gene algD-F;

[0014] Wherein, the rhamnolipid transferase gene rhlAB and / or the rhamnolipid transferase gene rhlC are each independently multiple copies.

[0015] The fifth aspect of the present invention provides the use of the genetically engineered bacteria for producing rhamnolipid as described in the third aspect and / or the fourth aspect above in high-yield rhamnolipid.

[0016] A sixth aspect of the present invention provides a method for high-yield rhamnolipid, the method comprising: fermenting and culturing the genetically engineered bacteria as described above, so that the genetically engineered bacteria synthesize rhamnolipid.

[0017] In some embodiments, the carbon source used for fermentation is at least one selected from soybean oil, corn oil, rapeseed oil, olive oil and palm oil, preferably rapeseed oil.

[0018] In some embodiments, the nitrogen source used for fermentation is selected from at least one of sodium nitrate, ammonium chloride, ammonium sulfate, potassium nitrate and urea, preferably potassium nitrate.

[0019] In some embodiments, the method comprises: fermenting and culturing the genetically engineered bacteria as described above or Pseudomonas aeruginosa CCTCCNO: M2011287 so that the genetically engineered bacteria synthesize rhamnolipid; wherein the carbon source used for fermentation is rapeseed oil, and / or the nitrogen source used for fermentation is potassium nitrate.

[0020] The present invention can achieve the following beneficial effects:

[0021] 1) The present invention found through genomic analysis that Pseudomonas aeruginosa CCTCC NO: M2011287 (hereinafter referred to as 8D strain) has two restriction modification systems RM1 and RM2, the existence of which affects the transformation efficiency of exogenous plasmids, greatly increases the difficulty of genetic manipulation, and thus restricts the yield of rhamnolipid. Based on this discovery, the present invention knocked out the two restriction modification systems RM1 and RM2, so that the transformation efficiency of the 8D strain was increased by 4-6 times, thereby providing a basis for high-yield rhamnolipid.

[0022] 2) The present invention significantly reduces the toxicity of the 8D strain by knocking out the important type III secretion system regulatory gene exsA in the 8D strain.

[0023] 3) The present invention increases the rhamnolipid production of the 8D strain by 1.21 times and 1.32 times respectively by knocking out the secondary metabolite synthesis gene cluster pelA-G, as well as algD-F and pelA-G.

[0024] 4) The present invention obtains engineered strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) by overexpressing genes rhlAB and rhlC through the shuttle expression vector pUCP20. The results show that the rhamnolipid production of strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) is 22.60 g / L and 21.60 g / L, respectively, wherein strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) are 2.02 times and 1.93 times higher than the production of strain 8D (pUCP20), respectively. By using the shuttle plasmid pAK1900, the rhamnolipid production of overexpressed engineered strains 8D (pAK-rhlAB) and 8D (pAK-rhlC) is 1.77 times and 1.48 times that of strain 8D (pAK1900), respectively.

[0025] 5) The present invention optimizes the fermentation medium of the yield engineering strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC), screens out rapeseed oil as the best C source, sodium nitrate as the best N source, and selects the best C source and N source to perform shake flask fermentation on the engineering strains. The results show that the rhamnolipid yields of strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) are 26.34 g / L and 21.17 g / L, respectively. After the fermentation medium is optimized, the yields of strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) are respectively increased by 2.33 times and 1.88 times compared with the wild type 8D (pUCP20).

[0026] 6) The rhamnolipid production of the rhamnolipid overexpression strains ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlAB) and ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlC) constructed by the low-toxicity and high-yield engineered strains of the present invention was increased by 2.54 times and 2.27 times respectively compared with that of the strain ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20).

[0027] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The plasmid transformation efficiency of the RM system mutants is shown;

[0029] Figure 2 The conjugation efficiency test of the RM system mutants is shown;

[0030] Figure 3 Comparison of toxicity among wild-type strain 8D, PAO1, and mutant ΔRM1-RM2-exsA is shown;

[0031] Figure 4 A comparison of rhamnolipid production between wild-type 8D and knockout engineered strains is shown;

[0032] Figure 5 The sizes of the oil drainage circles of 8D(pUCP20), 8D(pUCP20-rhlAB), and 8D(pUCP20-rhlC) are shown;

[0033] Figure 6 Comparison of rhamnolipid production between the wild-type strain and the overexpression engineered strain is shown;

[0034] Figure 7 The effects of different carbon and nitrogen sources on rhamnolipid production were shown;

[0035] Figure 8 The effect of low-toxicity and high-yield rhamnolipid engineering strain on improving rhamnose production was shown;

[0036] Figure 9 The results show that the shuttle plasmid pAK1900 can improve the rhamnose production of rhamnolipid engineering strains. DETAILED DESCRIPTION

[0037] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0038] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0039] The first aspect of the present invention provides a restriction modification system encoding gene, which is composed of a gene cluster RM1 and a gene cluster RM2, wherein the accession number of the gene cluster RM1 on NCBI is M1Q10_01380-M1Q10_01405, and the accession number of the gene cluster RM2 on NCBI is M1Q10_18660-M1Q10_18675.

[0040] The inventor of the present invention found in the process of research that it is difficult to screen effective clones when genetically modifying Pseudomonas aeruginosa CCTCC NO: M2011287 to construct a high-yield rhamnolipid genetic engineering bacterium. Further research found that in the gene cluster RM1 and gene cluster RM2 present in the genome of Pseudomonas aeruginosa CCTCC NO: M2011287, GE00267 in RM1 encodes a restriction endonuclease, GE00268 encodes a DNA methylase, and GE03636 in RM2 encodes a restriction endonuclease, and GE03638 encodes a DNA methylase. These two restriction modification systems greatly affect the progress of genome engineering. Based on this discovery, the applicant of the present application conducted a gene knockout experiment on these two restriction modification systems to improve the transformation efficiency and conjugation efficiency of the 8D strain, thereby providing strong support for constructing a high-yield rhamnolipid genetic engineering bacterium.

[0041] Therefore, the second aspect of the present invention provides the use of the restriction modification system encoding gene as described above in regulating the transformation efficiency of Pseudomonas aeruginosa plasmid and / or the rhamnolipid production.

[0042] It can be understood that the term "regulate" can refer to increase or enhance, or can refer to decrease or inhibit. In some embodiments, when it is envisioned to construct a genetically engineered bacterium that reduces or inhibits the efficiency of Pseudomonas aeruginosa plasmid transformation and / or rhamnolipid production, gene cluster RM1 and / or gene cluster RM2 can be introduced into the host strain, or a copy of gene cluster RM1 and / or a copy of gene cluster RM2 can be increased. In other embodiments, when it is envisioned to construct a genetically engineered bacterium that improves or enhances the efficiency of Pseudomonas aeruginosa plasmid transformation and / or rhamnolipid production, gene cluster RM1 and / or gene cluster RM2 in the host strain carrying gene cluster RM1 and / or gene cluster RM2 can be knocked out.

[0043] In a particularly preferred embodiment of the present invention, the deposit number of the Pseudomonas aeruginosa is CCTCCNO: M2011287.

[0044] In a third aspect of the present invention, a genetically engineered bacterium for producing rhamnolipid is provided, wherein the genetically engineered bacterium does not contain the gene cluster RM1 and / or gene cluster RM2 as described above, and the genetically engineered bacterium is constructed from the original strain with a deposit number of CCTCCNO: M2011287.

[0045] As described above, the genome of the original strain CCTCC NO: M2011287 has a restriction modification system consisting of gene cluster RM1 and gene cluster RM2. Those skilled in the art can use techniques known in the art to knock out gene cluster RM1 and / or gene cluster RM2, for example, by using homologous recombination technology to knock out, or by using CRISPR / Cas technology to knock out. In a preferred embodiment of the present invention, homologous recombination is performed using a three-parent hybridization method, for example, firstly, corresponding upstream and downstream primers are designed according to the target gene to be knocked out to amplify the target gene; the amplified product is connected to a plasmid (for example, pEX18Gm) and transformed into a host bacterium to amplify the plasmid to prepare a donor bacterium; then the donor bacterium, the recipient bacterium and the mediating bacterium (for example, Escherichia coli containing an assisting plasmid pRK2013) are mixed and cultured to obtain a deletion mutant.

[0046] In some embodiments of the present invention, the primers for amplifying the target gene, gene cluster RM1, include: the upstream primers are pEX-8D-RM1-up-S and pEX-8D-RM1-up-A, and the downstream primers are pEX-8D-RM1-down-S and pEX-8D-RM1-down-A, as shown in Table 1.

[0047] In some embodiments of the present invention, the primers for amplifying the target gene, gene cluster RM2, include: the upstream primers are pEX-8D-RM2-up-S and pEX-8D-RM2-up-A, and the downstream primers are pEX-8D-RM2-down-S and pEX-8D-RM2-down-A, as shown in Table 1.

[0048] Genomic analysis shows that there are many virulence factors in the 8D strain, which may cause the insecurity of the 8D strain. It was further found that the type III secretion system is an important virulence factor secretion system in the 8D strain, among which ExsA, as the central regulatory factor of the type III secretion system, plays a vital role in the entire regulatory process. Based on this discovery, in order to reduce the toxicity of the 8D strain, in some embodiments, the genetically engineered bacteria do not contain the type III secretion system regulatory gene exsA.

[0049] In some embodiments of the present invention, the accession number of the nucleotide sequence of the type III secretion system regulatory gene exsA on NCBI is M1Q10_24110.

[0050] For constructing a genetically engineered bacterium that does not contain the type III secretion system regulatory gene exsA, the method described above can be used. In order to avoid unnecessary repetition, the present invention will not go into details here.

[0051] In some embodiments, the primers for amplifying the target gene exsA include: the upstream primers are pEX-8D-exsA-up-S and pEX-8D-exsA-up-A, and the downstream primers are pEX-8D-exsA-down-S and pEX-8D-exsA-down-A, as shown in Table 1.

[0052] In some embodiments, in order to further construct a high-yield rhamnolipid genetically engineered bacterium, the genetically engineered bacterium does not contain the exopolysaccharide synthesis gene pelA-G and / or the alginate synthesis gene algD-F, so that more precursor substances flow into the rhamnolipid synthesis pathway, thereby increasing the yield of rhamnolipid.

[0053] In some embodiments of the present invention, the accession number of the nucleotide sequence of the exopolysaccharide synthesis gene pelA-G on NCBI is M1Q10_16420-M1Q10_16450.

[0054] For constructing a genetically engineered bacterium that does not contain the exopolysaccharide synthesis gene pelA-G, the method described above can be used. In order to avoid unnecessary repetition, the present invention will not go into details here.

[0055] In some embodiments, the primers for amplifying the target gene, the exopolysaccharide synthesis gene pelA-G, include: the upstream primers are pEX-8D-pel-up-S and pEX-8D-pel-up-A, and the downstream primers are pEX-8D-pel-down-S and pEX-8D-pel-down-A, as shown in Table 1.

[0056] In some embodiments of the present invention, the nucleotide sequence of the alginate synthesis gene algD-F has an accession number of M1Q10_13835-M1Q10_13885 on NCBI.

[0057] For constructing a genetically engineered bacterium that does not contain the alginate synthesis gene algD-F, the method described above can be used. In order to avoid unnecessary repetition, the present invention will not go into details here.

[0058] In some embodiments, the primers for amplifying the target gene, alginate synthesis gene algD-F, include: the upstream primers are pEX-8D-alg-up-S and pEX-8D-alg-up-A, and the downstream primers are pEX-8D-alg-down-S and pEX-8D-alg-down-A, as shown in Table 1.

[0059] In some embodiments, the nucleotide sequence of the rhamnolipid transferase gene rhlAB has an accession number of M1Q10_14195-M1Q10_14200 on NCBI.

[0060] In some embodiments, the accession number of the nucleotide sequence of the rhamnolipid transferase gene rhlC in NCBI is M1Q10_27040.

[0061] In order to further increase the yield of rhamnolipid, the rhamnolipid transferase gene rhlAB and / or the rhamnolipid transferase gene rhlC are each independently multiple copies.

[0062] Conventional methods in the art can be used to construct multiple copies of the target gene in the host bacteria. In a preferred embodiment of the present invention, the Escherichia coli-Pseudomonas aeruginosa shuttle plasmid pUCP20 is used to overexpress the rhamnolipid transferase gene.

[0063] In some embodiments, for overexpression of the rhamnolipid transferase gene rhlAB, the rhlAB gene fragment is amplified using primers pUC-rhlAB-S and pUC-rhlAB-A, and then ligated to pUCP20 to obtain plasmid pUCP20-rhlAB, and finally the obtained plasmid is transformed into a host cell.

[0064] In some embodiments, for overexpression of rhamnolipid transferase gene rhlC, rhlC gene fragment is amplified using primers pUC-rhlC-S and pUC-rhlC-A, and then ligated to pUCP20 to obtain plasmid pUCP20-rhlC, and finally the obtained plasmid is transformed into host cells.

[0065] The fourth aspect of the present invention provides a genetically engineered bacterium for producing rhamnolipid, the genetically engineered bacterium does not contain the restriction modification system encoding gene described in claim 1, and the genetically engineered bacterium is constructed from the original strain with a deposit number of CCTCC NO: M2011287;

[0066] Among them, the genetically engineered bacteria do not contain the type III secretion system regulatory gene exsA;

[0067] Among them, the genetically engineered bacteria do not contain the exopolysaccharide synthesis gene pelA-G and the alginate synthesis gene algD-F;

[0068] Wherein, the rhamnolipid transferase gene rhlAB and / or the rhamnolipid transferase gene rhlC are each independently multiple copies.

[0069] The fifth aspect of the present invention provides the use of the genetically engineered bacteria for producing rhamnolipid as described in the third aspect and / or the fourth aspect above in high-yield rhamnolipid.

[0070] A sixth aspect of the present invention provides a method for high-yield rhamnolipid, the method comprising: fermenting and culturing the genetically engineered bacteria as described above, so that the genetically engineered bacteria synthesize rhamnolipid.

[0071] In the present invention, the fermentation medium used can be a conventional fermentation medium for culturing Pseudomonas aeruginosa, for example, relative to 1 L of fermentation medium:

[0072]

[0073] Among them, relative to 1L of trace elements:

[0074] MnSO 4 :35-45mg, ZnSO 4 :40-45mg, (NH 4 ) 6 Mo 7 O 24 ·4H 2 O: 30-40mg.

[0075] In some embodiments, the carbon source used for fermentation is at least one selected from soybean oil, corn oil, rapeseed oil, olive oil and palm oil, preferably rapeseed oil.

[0076] In some embodiments, the nitrogen source used for fermentation is selected from at least one of sodium nitrate, ammonium chloride, ammonium sulfate, potassium nitrate and urea, preferably sodium nitrate.

[0077] In some embodiments, the nitrogen source is sodium nitrate and the vegetable oil is rapeseed oil.

[0078] In some embodiments, the method comprises: fermenting and culturing the genetically engineered bacteria as described above or Pseudomonas aeruginosa CCTCCNO: M2011287 so that the genetically engineered bacteria synthesize rhamnolipid; wherein the carbon source used for fermentation is rapeseed oil, and / or the nitrogen source used for fermentation is sodium nitrate.

[0079] In some embodiments of the present invention, the fermentation conditions include: temperature of 30-40°C, rotation speed of 150-250 rpm, and time of 5-10 days. In a specific embodiment, the fermentation conditions include: temperature of 37°C, rotation speed of 200 rpm, and time of 5 days.

[0080] Example

[0081] 1. The primers used in this experiment are shown in Table 1.

[0082] Table 1 Primers used in the experiment

[0083] Primer Sequence(5’→3’) SEQ ID NO: pEX-8D-RM1-up-S ATGAAGCTTTGGGGGTACTCGTGTTCA 1 pEX-8D-RM1-up-A ATGTCTAGATACAAGCTGCCACCTTCG 2 pEX-8D-RM1-down-S CGGTCTAGAGCACGCTGAAGAAGTGGA 3 pEX-8D-RM1-down-A ATCGGATCCTGAACTCATCCCTACCGC 4 pEX-8D-RM2-up-S ACGGAATTCGTAAAGGGCAAGACAAGG 5 pEX-8D-RM2-up-A CGGTCTAGATTCATGTAGGCGATTCTG 6 pEX-8D-RM2-down-S CGCTCTAGACCAAACGAATTTATGCTG 7 pEX-8D-RM2-down-A CCGAAGCTTAACGAATTTCCGTAACCT 8 pEX-8D-exsA-up-S GGCAAGCTTAGGGTGTATTGCTGCTCC 9 pEX-8D-exsA-up-A CCGTCTAGATTCACCCAGAGCTATCGC 10 pEX-8D-exsA-down-S GCGTCTAGAATACGCCCTCTTCCTTGT 11 pEX-8D-exsA-down-A AAGGGTACCATCCAGTCCTTCGTCCAG 12 pEX-8D-pel-up-S GCCAAGCTTTGTTCGTGCTCTACAGCG 13 pEX-8D-pel-up-A ACGGGTACCGCGATTCCTTTCTTGCTG 14 pEX-8D-pel-down-S ATCGGTACCACCTTCATGCTCAATCGC 15 pEX-8D-pel-down-A GCGGAATTCGTTTCGGTGGTTTTTCGG 16 pEX-8D-alg-up-S CGGAAGCTTGGGTGTTTTCTGAGTGGC 17 pEX-8D-alg-up-A GCCTCTAGATGGTCTGCCTGTACGTCA 18 pEX-8D-alg-down-S CGGTCTAGAAGGCAGCCAGCACATACT 19 pEX-8D-alg-down-A ATTGGTACCGACCACCTGGTGGTGTTC 20 pUC-rhlAB-S TTGTCTAGAGTGGCGGCAAATACCAGG 21 pUC-rhlAB-A TACAAGCTTCGTTCAGGACGCAGCCTT 22 pUC-rhlC-S TACAAGCTTAGCCCTGGTTCGCCGGGT 23 pUC-rhlC-A AACGGATCCCTAGGCCTTGGCCTTGCC 24

[0084] 2. Culture medium and reagent preparation

[0085] (1) LB medium (1 L):

[0086] Tryptone 10.0g

[0087] Yeast extract 5.0g

[0088] Sodium chloride (NaCl) 10.0g

[0089] Adjust the pH to 7.0-7.2. Sterilize at 121°C for 25 min and add 1.5% agar powder LB to make a solid culture medium.

[0090] (2) SOC medium (1 L):

[0091]

[0092] Adjust the pH to 7.0 with NaOH and sterilize at 115°C for 20 min.

[0093] (3) PBS buffer (1 L):

[0094]

[0095] Sterilize at 121℃ for 20 min and set aside.

[0096] (4) 50×TAE buffer (1 L)

[0097] Tris 242.0g

[0098] EDTA 18.612g

[0099] CH 3 COOH 57.1mL

[0100] Adjust pH to 8.3 with NaOH and store at room temperature.

[0101] (5) Fermentation medium (1 L)

[0102]

[0103] Trace elements (1L):

[0104] MnSO 4 :39.9mg, ZnSO 4 :42.8mg, (NH 4 ) 6 Mo 7 O 24 ·4H 2 O: 34.7 mg

[0105] Adjust the pH to 7.0 with NaOH and sterilize at 121°C for 20 min.

[0106] (6) 10% glycerol: prepare 100 mL of solution, i.e., 10 mL of glycerol and 90 mL of ultrapure water. Sterilize at 115°C for 20 min and store at 4°C until use.

[0107] (7) 0.3 M sucrose: weigh 10.4 g of sucrose and dilute to 100 mL. Sterilize at 115°C for 20 min and store at 4°C until use.

[0108] (8) Sulfuric acid-anthrone solution: Add 90 mL of concentrated sulfuric acid to 10 mL of distilled water, then add 0.25 g of anthrone, mix well and use immediately.

[0109] 3. Detection Methods

[0110] 3.1 Plasmid transformation efficiency detection

[0111] Plasmid transformation of Pseudomonas aeruginosa was carried out by the most commonly used heat shock method. Two plasmids with different sequences and resistances were selected: pEX18Gm (Gm R ) and pUCP20(Cb R ) were transformed into 8D strains. During the experiment, the competent cells of wild-type 8D and two mutants were adjusted to the same growth state and OD 600 The transformation experiment for each treatment was repeated three times, and the number of colonies grown was counted to calculate the transformation efficiency.

[0112] Transformation efficiency = number of colonies formed ÷ μg plasmid DNA used for transformation × 50

[0113] 3.2 Bonding efficiency detection

[0114] The plasmid conjugation experiment used the three-parent hybridization method. The specific process was based on the three-parent homologous recombination part of the gene knockout experiment. Two plasmids with different sequences and resistances, pMS402 (Kan R) and pAK1900(Cb R ) were transformed into 8D strains, and the competent cells of wild-type 8D and two mutants were adjusted to the same growth state and OD 600 The transformation experiment for each treatment was repeated three times, and the number of colonies grown was counted to calculate the success rate of conjugation. [5] .

[0115] Conjugation efficiency = number of colonies formed ÷ OD of 8D strain 600 ×50

[0116] 3.3 Cabbage infection model

[0117] (1) Cabbage pretreatment: Cut fresh cabbage into squares of the same size and use H 2 O 2 Sterilize the cabbage. Prepare sterilized filter paper in advance and sterilize it with 10 mM MgSO 4 Moisten the bottom of the petri dish and place the sterilized cabbage on top.

[0118] (2) Treatment of test strains: Shake 8D, PAO1, and ΔRM1-RM2-exsA in advance, and wait until the bacterial solution becomes turbid to measure OD 600 OD 600 After keeping the same, take 1 mL of the bacterial solution and centrifuge it. 4 Wash once, centrifuge and add 1 mL of MgSO 4 Resuspend the bacteria in the solution for later use.

[0119] (3) Inject 10 μL of bacterial solution under the epidermis of the sterilized cabbage in a clean bench. After the cabbage has completely absorbed the bacterial solution, place the culture dish in a 37°C incubator for overnight culture.

[0120] (4) When the cabbage begins to rot or necrotize, observe the effects of different bacterial solutions on the rot of the cabbage and take photos for preservation. At the same time, cut off the rotten part of the cabbage, soak it in 1 mL of sterile PBS buffer and place it at 4°C overnight. Take out the cabbage and weigh it, and dilute the soaking solution uniformly and spread it on the LB plate overnight. Count the number of bacteria in the rotten part according to the number of monoclonal clones, dilution and coating amount, and the number of bacteria is expressed in CFU / mg.

[0121] 3.4 Oil drain ring experiment

[0122] (1) Single clone 8D was selected and placed in 50 mL LB liquid medium for shaking culture at 37°C and 200 rpm for 10 h.

[0123] (2) 20 mL of liquid culture medium was transferred to 200 mL of fermentation medium for 5 days of fermentation. During this period, the bacterial liquid was taken at 10:00 am every day to measure the size of the oil circle.

[0124] (3) Take 1 mL of the fermentation broth and place it in a centrifuge tube. Centrifuge at 8,000 rpm for 1 min and take the supernatant for later use.

[0125] (4) Add 20 mL of water to the glass plate and spread 1 mL of liquid paraffin mixed with Sudan III dye (100 mL of liquid paraffin + 0.5 g of Sudan III dye) on the water.

[0126] (5) When the liquid paraffin is evenly spread on the clean water, pipette 10uL of bacterial liquid into the middle of the plate and wait for a few seconds. Observe the size of the oil drainage circle and measure the diameter of each oil drainage circle.

[0127] 3.5 Determination of rhamnolipid content

[0128] The rhamnolipid rhamnosyl group reacts with concentrated sulfuric acid and anthrone at a high temperature of 100°C to generate a blue-green substance with a maximum absorbance at 620nm. Therefore, the yield of rhamnolipid can be analyzed and calculated based on the color depth and absorbance of the reaction solution. The specific experimental process is as follows:

[0129] (1) Accurately weigh 20 mg of rhamnolipid standard powder and dissolve it in 1 ml of purified water to prepare a 20 mg / mL standard stock solution.

[0130] (2) Weigh 0.2 g of anthrone reagent and dissolve it in 100 mL of 85% sulfuric acid solution to prepare a sulfuric acid-anthrone solution.

[0131] (3) Drawing of standard curve

[0132] a. Use the stepwise dilution method to dilute the mother liquor into liquids with concentrations of 1 mg / L, 10 mg / L, 20 mg / L, 50 mg / L, 100 mg / L, and 200 mg / L for standby use.

[0133] b. Take 1 mL of each rhamnolipid solution in a clean test tube, place it in an ice water bath, add 4 mL of sulfuric acid-anthrone solution, shake well, immerse in 100℃ boiling water for 10 minutes, take out, cool naturally to room temperature, and measure its absorbance at 620nm. Make a standard curve based on the concentration and absorbance. The curve uses rhamnolipid concentration as the horizontal axis and absorbance as the vertical axis, and performs regression processing to obtain the regression equation.

[0134] (4) Determination of rhamnolipid content in samples

[0135] Take 2ml of the sample in a centrifuge tube, centrifuge at 8,000r / min for 10min, take 200μL of the supernatant and dissolve it in 1.8mL of water, mix it, take 400μL of the liquid and dissolve it in 1,600mL of water and mix it, and then get a 50-fold dilution for standby use; then take 1mL of the 50-fold dilution in a dry, clean test tube, place it in an ice water bath, add 4mL of sulfuric acid-anthrone solution, shake it well, place it in a 100℃ boiling water bath and boil it for 10min, take it out and naturally cool it to room temperature, measure the absorbance at 620nm, record the absorbance value A, repeat the measurement 3 times for each sample, and take the average value. Then calculate the rhamnolipid content in the sample according to the following formula.

[0136] C=(A-0.0366) / 0.014×N

[0137] Where:

[0138] C—Rhamnolipid concentration, mg / L.

[0139] A—absorbance value;

[0140] N—dilution multiple, N=50.

[0141] Preparation Example 1

[0142] Preparation of Pseudomonas aeruginosa competent cells

[0143] (1) Taking the 8D strain as an example, select the activated 8D single clone in advance and culture it in 10 mL LB liquid medium at 37°C in a shake flask for 8 h. Pour all the bacterial liquid into a 50 mL centrifuge tube, centrifuge it at 8,000 r / min for 5 min, and then discard the supernatant.

[0144] (2) Add 1 mL of 0.3 M sucrose solution to a 50 mL centrifuge tube and pipette evenly. Centrifuge at the same speed for 5 min. Discard the supernatant and wash again.

[0145] (3) Then add 1 mL of 10% glycerol to wash the cells again and centrifuge at the same speed for 5 min.

[0146] (4) Finally, add an appropriate amount of 10% glycerol according to the bacterial concentration, mix well, and divide for use or store in a -80°C refrigerator (only for short-term storage).

[0147] Example 1

[0148] This example is used to illustrate the knockout of RM1 and / or RM2 genes

[0149] (1) Taking the gene cluster RM1 in the 8D strain as an example, primers were used to perform PCR amplification on the upstream and downstream of RM1 (the upstream primers were pEX-RM1-up-S and pEX-RM1-up-A, and the downstream primers were pEX-RM1-down-S and pEX-RM1-down-A). The PCR amplification product was purified and then ligated to the plasmid pEX18Gm by restriction digestion. The ligation product was transformed into DH5α competent cells, and the transformation product was spread on an LB plate containing 10 μg / mL gentamicin. The positive clones were screened and verified to obtain the vector pEX-RM1.

[0150] (2) After the vector is constructed, homologous recombination is performed by the method of three-parent hybridization. The donor bacterium is the vector pEX-RM1 obtained above, the recipient bacterium is Pseudomonas aeruginosa 8D, and the mediator bacterium is Escherichia coli containing the helper plasmid pRK2013. The donor bacterium and the mediator bacterium are streaked on LB plates containing 10 μg / mL gentamicin and LB plates without antibiotics, respectively, and then cultured overnight at 37°C. The recipient bacterium is streaked on a plate containing 50 μg / mL kanamycin to collect the bacterium, and then cultured overnight at 42°C. Prepare sterile centrifuge tubes in advance for weighing, scrape the bacteria that cover the plate into the centrifuge tube and weigh it again, and the difference is the weight of the bacteria. Add an appropriate amount of PBS solution according to the concentration ratio of donor bacteria: mediator bacteria: recipient bacteria = 2:2:1 for resuspending, then aspirate 80 μl of each of the three strains and mix them together, aspirate 100 μl of the bacterial solution and spot it on the LB plate for overnight culture. The obtained bacteria were diluted at an appropriate multiple and spread on an LB plate containing Gm (50 μg / mL). The grown single clones were streaked on an LB plate containing 10% sucrose, and several single clones were picked and lysed as templates to verify the mutation results by PCR amplification. The deletion mutant was verified with an external test primer to obtain the deletion mutant ΔRM1.

[0151] (3) Similarly, the deletion mutant ΔRM1-RM2 was constructed.

[0152] (4) Detect the transformation efficiency of the deletion mutants.

[0153] The transformation efficiency results are as follows Figure 1 As shown. The transformation efficiency of the two plasmids for the mutant strains was significantly greater than that of the wild type, and the transformation efficiency of the double mutant strain was higher. Therefore, by knocking out the two restriction modification systems in the 8D strain, the transformation efficiency of the 8D strain was increased by 4-6 times, and the genetic operation system was optimized.

[0154] (5) Detect the conjugation efficiency of the deletion mutants.

[0155] The binding efficiency is Figure 2As shown, the conjugation efficiency of the two plasmids for the mutant strains is significantly higher than that of the wild type, and the efficiency of the double mutant strain is even higher. Therefore, the three-parent hybridization experiment shows that the conjugation efficiency of the double mutant strain is significantly increased by about 4 times compared with the wild type.

[0156] Example 2

[0157] This example is used to illustrate the construction of type III secretion system knockout mutants and toxicity detection

[0158] The genome fragment of the gene exsA was connected to the suicide plasmid pEX18Gm to construct the knockout vector pEX-exsA. The knockout mutant strain ΔRM1-RM2-exsA was constructed by using the three-parent hybridization method according to the method of Example 1.

[0159] After successfully constructing the mutant strain ΔRM1-RM2-exsA of the virulence factor regulatory gene exsA of the 8D strain, in order to verify whether the toxicity of the mutant strain was weakened, the toxicity of the three strains 8D, PAO1, and ΔRM1-RM2-exsA was tested using the cabbage infection model. Figure 3 As shown in Figure A, it can be seen that 8D and PAO1 can cause severe necrosis and rot after inoculation of cabbage, while the necrotic area of ​​cabbage is significantly reduced after the mutant strain ΔRM1-RM2-exsA is inoculated. Figure B shows the number of bacterial cells in the necrotic part of cabbage, showing that the number of bacterial cells of the PAO1 strain is slightly higher than that of 8D, while the number of bacterial cells of the mutant strain ΔRM1-RM2-exsA is significantly reduced. Therefore, after knocking out the virulence factor exsA, the toxicity of the 8D strain is significantly weakened, laying the foundation for the construction of low-toxic and safe rhamnolipid engineering strains.

[0160] Example 3

[0161] This example is used to illustrate the construction of secondary metabolite knockout mutants

[0162] In order to further construct a high-yield rhamnolipid engineering strain, this example uses the method of Example 1 to knock out the secondary metabolite synthesis gene clusters algD-F and pelA-G that compete with rhamnolipid precursors on the basis of the mutant strain ΔRM1-RM2-exsA, so that more precursor substances flow to the rhamnolipid synthesis pathway, thereby increasing the yield of rhamnolipid. First, the knockout vector was constructed using the principle of homologous recombination, and the genome of the exopolysaccharide pelA-G and the secondary metabolite algD-F was connected to the suicide plasmid pEX18Gm to obtain the recombinant plasmids pEX-pelA-G and pEX-algD-F.

[0163] The successfully constructed recombinant vector pEX-pelA-G was transferred into the mutant strain ΔRM1-RM2-exsA through three-parental hybridization, and the knockout mutant strain ΔRM1-RM2-exsA-pelA-G was obtained through homologous recombination. The recombinant vector pEX-algD-F was transferred into the mutant strain ΔRM1-RM2-exsA-pelA-G by the same method, and the knockout mutant strain ΔRM1-RM2-exsA-pelA-G-algD-F was obtained.

[0164] The fermentation medium was used for 5 days, where the initial C source of the fermentation medium was corn oil and the initial N source was potassium nitrate. The final yields all represented the rhamnolipid yields measured on the 5th day, and each experimental result was repeated 3 times. The rhamnolipid content was quantitatively detected using the anthrone sulfate method. Figure 4 As shown, the rhamnolipid content of the two engineered strains was significantly higher than that of the wild-type strain 8D, among which the rhamnolipid content of the mutant strain ΔRM1-RM2-exsA-pelA-G was 14.28 g / L, the rhamnolipid content of the mutant strain ΔRM1-RM2-exsA-pelA-G-algD-F was 15.55 g / L, and the rhamnolipid content of the 8D strain was 11.71 g / L. Overall, the rhamnolipid production of the engineered strain ΔRM1-RM2-exsA-pelA-G increased by 1.21 times after the transformation, and the rhamnolipid production of the engineered strain ΔRM1-RM2-exsA-pelA-G-algD-F increased by 1.32 times.

[0165] Example 4

[0166] This example is used to illustrate that multiple copies of rhamnolipid synthesis genes can increase rhamnolipid production

[0167] The multi-copy E. coli-Pseudomonas aeruginosa shuttle plasmid pUCP20 was used to perform an overexpression experiment of rhamnolipid synthesis genes. Taking the rhlAB gene as an example, the specific experimental process is as follows:

[0168] (1) The rhlAB gene fragment was amplified by PCR using the genome of 8D as a template, and the primers were pUC-rhlAB-S and pUC-rhlAB-A. The specific primer sequences are shown in Table 1.

[0169] (2) The product obtained by PCR amplification was purified and then ligated to plasmid pUCP20 by restriction digestion. The ligated product was transformed into DH5α competent cells, and the transformation product was spread on LB plates containing 100 μg / mL carbenicillin. Positive clones were screened and verified to obtain plasmid pUCP20-rhlAB.

[0170] (3) The obtained plasmid is transformed into the 8D strain, that is, the rhlAB gene can be overexpressed in the 8D strain.

[0171] (4) The same method was used to overexpress the rhlC gene in the 8D strain.

[0172] In order to detect the rhamnolipid production of engineered strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC), the oil ring method was used for preliminary detection (after 5 days of fermentation using fermentation medium, the obtained bacterial solution was uniformly diluted 10 times for detection, and each group of experiments was repeated three times and photographed and preserved). Figure 7 As shown in the figure, the diameter of the oil ring of the engineered strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) is significantly larger than that of the strain 8D (pUCP20). At the same time, the diameter of the oil ring of the same strain with antibiotics added is larger than that without antibiotics. This may be because the plasmid of the strain without antibiotics is more easily lost, which is not conducive to the increase of rhamnolipid production. The above results show that the production of rhamnolipid is greatly improved after overexpressing rhlAB and rhlC genes by multi-copy plasmids.

[0173] The anthrone sulfate method was used to quantitatively detect 8D(pUCP20), 8D(pUCP20-rhlAB) and 8D(pUCP20-rhlC) (fermentation medium was used and Cb (150 μg / mL) was added for 5 days, where the initial C source of the fermentation medium was corn oil and the initial N source was potassium nitrate. The final yields all represented the rhamnolipid yields measured on the 5th day, and each experimental result was repeated 3 times). The results are shown in Figure 8 As shown, the yield of the overexpressed engineered strain was significantly improved. The rhamnolipid yield of the 8D(pUCP20) strain was 11.20 g / L, while the rhamnolipid yields of the engineered strains 8D(pUCP20-rhlAB) and 8D(pUCP20-rhlC) were 22.60 g / L and 21.60 g / L, respectively. The rhamnolipid yields of the overexpressed engineered strains 8D(pUCP20-rhlAB) and 8D(pUCP20-rhlC) were 2.02 times and 1.93 times that of the strain 8D(pUCP20), respectively.

[0174] Example 5

[0175] This example is used to illustrate the optimization of fermentation conditions to increase rhamnolipid production

[0176] In this example, five different vegetable oils were selected as carbon sources, namely soybean oil, corn oil, rapeseed oil, olive oil, and palm oil. The culture medium conditions of the engineering strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) with the highest yield were optimized. The test results are as follows: Fig. 9, A, C, and E are all nitrogen sources of potassium nitrate, and the effect of carbon source on rhamnolipid production was tested. When the carbon source was rapeseed oil, the rhamnolipid production of engineered strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) was 23.11 g / L and 22.31 g / L, respectively. When the carbon source was palm oil, the rhamnolipid production was the lowest. And the wild type and the engineered strains after modification were the same.

[0177] Five nitrogen sources were selected for the fermentation medium: sodium nitrate, ammonium chloride, ammonium sulfate, potassium nitrate, and urea. Fig. 9 , B, D, and F are rapeseed oil as the unified carbon source to test the effect of carbon source on rhamnolipid production. The results showed that when the nitrogen source was sodium nitrate, 8D (pUCP20) and the modified engineered strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) had the highest yields, among which the wild type 8D (pUCP20) had a yield of 11.29 g / L, and the strains 8D (pUCP20-rhlAB) and 8D (pUCP20-rhlC) had yields of 26.34 g / L and 21.17 g / L, respectively, which were 2.33 times and 1.88 times the yield of the wild type 8D (pUCP20).

[0178] Therefore, it was found through screening that the best carbon source for the fermentation medium was rapeseed oil, and the best nitrogen source was sodium nitrate.

[0179] Example 6

[0180] This example is used to illustrate that the low-toxicity and high-yield rhamnolipid engineering strain can improve the rhamnose yield

[0181] According to the above examples, the overexpression vectors pUCP20-rhlAB and pUCP20-rhlC were selected in this example and transferred into the low-toxicity and high-yield engineering strain ΔRM1-RM2-exsA-pelA-G-algD-F, respectively, to successfully construct the engineering strains ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlAB) and ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlC), and the best carbon source rapeseed oil and the best nitrogen source sodium nitrate were selected. ,After 5 days of fermentation of the engineered strains, the results showed that the rhamnolipid production of the engineered strain ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlAB) was 34.12 g / L, the rhamnolipid production of ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlC) was 30.55 g / L, and the rhamnolipid production of the control strain ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20) was 13.44 g / L. The results are as follows Figure 8 Therefore, the rhamnolipid production of rhamnolipid overexpression strains ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlAB) and ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20-rhlC) constructed based on low-toxicity and high-yield engineered strains was increased by 2.54 and 2.27 times, respectively, compared with that of strain ΔRM1-RM2-exsA-pelA-G-algD-F (pUCP20).

[0182] Example 7

[0183] The shuttle plasmid pAK1900 was used to perform an overexpression experiment of rhamnolipid synthesis genes. Taking the rhlAB gene as an example, the specific experimental process is as follows:

[0184] (1) First, primers were designed based on the rhlAB gene sequence. The product should include the complete coding frame of the rhlAB gene. The rhlAB gene fragment was amplified by PCR using the 8D genome as a template. The primers were pAK-rhlAB-S and pAK-rhlAB-A, respectively.

[0185] (2) The product obtained by PCR amplification was purified and then ligated to the plasmid pAK1900 by restriction digestion. The ligation product was transformed into DH5α competent cells, and the transformation product was spread on an LB plate containing 100 μg / mL carbenicillin. The positive clones were screened and verified to obtain the vector pAK-rhlAB.

[0186] (3) The obtained plasmid is transformed into the 8D strain, that is, the rhlAB gene can be overexpressed in the 8D strain.

[0187]

[0188] The anthrone sulfate method was used to quantitatively detect 8D(pAK1900), 8D(pAK-rhlAB) and 8D(pAK-rhlC). Fig. 9 As shown, the yield of the overexpressed engineered strain was significantly improved. The rhamnolipid yield of the 8D(pAK1900) strain was 11.94 g / L, while the rhamnolipid yields of the engineered strains 8D(pAK-rhlAB) and 8D(pAK-rhlC) were 21.14 g / L and 17.74 g / L, respectively. The rhamnolipid yields of the overexpressed engineered strains 8D(pAK-rhlAB) and 8D(pAK-rhlC) were 1.77 times and 1.48 times that of the strain 8D(pAK1900), respectively.

[0189] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0190] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0191] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A restriction modification system encoding gene, It is characterized in that The coding gene consists of gene cluster RM1 and gene cluster RM2, wherein the accession number of gene cluster RM1 on NCBI is M1Q10_01380-M1Q10_01405, and the accession number of gene cluster RM2 on NCBI is M1Q10_18660-M1Q10_18675.

2. Use of the restriction modification system encoding gene according to claim 1 in regulating the transformation efficiency, conjugation efficiency or rhamnolipid production of Pseudomonas aeruginosa plasmid.

3. The use according to claim 2, in, The deposit number of the Pseudomonas aeruginosa is CCTCC NO: M2011287.

4. A genetically engineered bacterium for producing rhamnolipid, It is characterized in that The genetically engineered bacteria does not contain the gene cluster RM1 and / or the gene cluster RM2 described in claim 1, and the genetically engineered bacteria is constructed from the original strain with a preservation number of CCTCC NO: M2011287.

5. The genetically engineered bacteria according to claim 4, in, The genetically engineered bacteria do not contain the type III secretion system regulatory gene exsA; Preferably, the accession number of the nucleotide sequence of the type III secretion system regulatory gene exsA on NCBI is M1Q10_24110.

6. The genetically engineered bacterium according to claim 4 or 5, in, The genetically engineered bacteria do not contain exopolysaccharide synthesis genes pelA-G and / or alginate synthesis genes algD-F; Preferably, the nucleotide sequence of the exopolysaccharide synthesis gene pelA-G has an accession number of M1Q10_16420-M1Q10_16450 on NCBI; and / or The nucleotide sequences of alginate biosynthesis genes algD-F are registered at NCBI with accession numbers M1Q10_13835-M1Q10_13885.

7. A genetically engineered bacterium for producing rhamnolipid, It is characterized in that The genetically engineered bacteria does not contain the restriction modification system encoding gene described in claim 1, and the genetically engineered bacteria is constructed from the original strain with a deposit number of CCTCC NO: M2011287; Among them, the genetically engineered bacteria do not contain the type III secretion system regulatory gene exsA; Among them, the genetically engineered bacteria do not contain the exopolysaccharide synthesis gene pelA-G and the alginate synthesis gene algD-F; The rhamnolipid transferase gene rhlAB and / or rhamnolipid transferase gene rhlC in the genetically engineered bacteria are each independently expressed by the lac promoter; and the rhamnolipid transferase gene rhlAB and / or rhamnolipid transferase gene rhlC are each independently multiple copies.

8. Use of the genetically engineered bacteria for producing rhamnolipid according to any one of claims 4 to 7 in high-yield rhamnolipid.

9. A method for high-yield rhamnolipid, It is characterized in that The method comprises: fermenting and culturing the genetically engineered bacteria according to any one of claims 6 to 8 so that the genetically engineered bacteria synthesize rhamnolipid; Preferably, the carbon source used for fermentation is selected from at least one of soybean oil, corn oil, rapeseed oil, olive oil and palm oil, preferably rapeseed oil; and / or The nitrogen source used in the fermentation is selected from at least one of sodium nitrate, ammonium chloride, ammonium sulfate, potassium nitrate and urea, preferably potassium nitrate.

10. A method for high-yield rhamnolipid, It is characterized in that The method comprises: fermenting and culturing the genetically engineered bacteria according to claim 4 or 5 or Pseudomonas aeruginosa CCTCC NO: M2011287, so that the genetically engineered bacteria synthesize rhamnolipid; wherein the carbon source used for fermentation is rapeseed oil, and / or the nitrogen source used for fermentation is potassium nitrate.