Application of L2 gene and / or L2 protein in controlling soybean oil content and / or regulating soybean phenotype
By increasing the expression of the L2 gene or the content of L2 protein in soybeans and using L2 protein to affect the color of soybean pods, the problem of difficulty in increasing the content of soybean oil in the prior art is solved, and effective regulation of soybean oil content and phenotype is achieved.
Patent Information
- Application Number
- CN202411633602.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2044-11-15
AI Technical Summary
The prior art has not yet found an effective method to increase the soybean oil content by regulating the corresponding traits of soybean pods.
By increasing the expression of the L2 gene in soybeans or increasing the content of L2 protein in soybeans, L2 protein is used to affect the color of the pods, thereby regulating the content of soybean oil.
The effect of increasing the content of soybean oil was achieved, and the color of soybean pods and seeds was changed, confirming the application potential of the L2 gene in regulating soybean oil content and phenotype.
Smart Images

Figure CN120099070A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of L2 gene and / or L2 protein in regulating soybean oil content and / or regulating soybean phenotype. Background Art
[0002] Soybean (Glycine max (Linn.) Merr.) is the world's largest oil crop, and increasing its seed oil content is an important breeding goal.
[0003] Pods are the final transit point for assimilates to be transported to seeds. They can also provide nutrients to seeds through photosynthesis. They act as both source and flow in the process of seed development, closely affecting seed development and oil formation.
[0004] However, there are currently no reports on how to increase the oil content of soybeans by regulating the corresponding traits of pods. Summary of the invention
[0005] In view of the defects in the prior art, the purpose of the present invention is to provide an application of L2 protein and / or L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype, wherein the L2 protein can affect the pod color and further has a regulating effect on the soybean oil content.
[0006] The objective of the present invention is achieved through the following technical solutions:
[0007] The present invention provides the use of L2 protein and / or L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype. The amino acid sequence of the L2 protein is shown in SEQ ID NO.14.
[0008] Preferably, the expression of the gene L2 encoding the L2 protein in soybean is increased or the content of the L2 protein in soybean is increased, the oil content of soybean is increased and / or the color of soybean pods and / or seeds is changed.
[0009] Preferably, the L2 gene CDS sequence is shown as SEQ ID NO.3.
[0010] The present invention provides a biomaterial, which comprises a genome vector and / or an engineered bacterium containing the genome vector; the genome vector comprises an L2 gene promoter sequence, an L2 gene CDS sequence and an L2 gene terminator sequence; the L2 gene CDS sequence is shown in SEQ ID NO.3.
[0011] Preferably, the L2 gene promoter sequence is shown as SEQ ID NO.1; the L2 gene terminator sequence is shown as SEQ ID NO.2.
[0012] The present invention provides a method for cultivating high-oil soybeans, comprising:
[0013] High-oil soybeans can be obtained by increasing the expression of L2 genes in target soybeans or increasing the content of L2 protein in soybeans.
[0014] Preferably, the method for increasing the expression of L2 gene in target soybean comprises:
[0015] The biological material described in the above technical solution is transferred into the target soybean.
[0016] Preferably, the target soybeans include black seed coat soybeans and / or black hilum soybeans.
[0017] The present invention provides a primer set for identifying successful cultivation of high-oil soybeans, comprising an upstream primer F as shown in SEQ ID NO.12 and a downstream primer R as shown in SEQ ID NO.13.
[0018] The invention provides a method for identifying successful construction of L2 transgenic plants, comprising: observing the color of pods of mature transgenic soybeans to determine whether the L2 gene has been transferred and is functioning.
[0019] Beneficial effects of the present invention
[0020] The present invention provides an application of L2 protein and / or L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype, and the amino acid sequence of the L2 protein is shown in SEQ ID NO.14. The present invention finds through research that L2 gene controls soybean pod color. L2 gene determines whether the pod color is brown. The present invention uses brown pod soybean and yellow pod soybean as parental separation populations, and through the method of fine positioning, determines that the gene number of L2 gene is Glyma.03G005700. According to the annotation of phytozome website (https: / / phytozome-next.jgi.doe.gov / ) and protein homology comparison, it is found that the gene encodes a synthase containing HMGL-like domain. Its synthetic product affects soybean pod color through accumulation and oxidation. Through natural population analysis, it is found that pod color may affect soybean seed oil content under the genetic background of black seed coat or black hilum. Therefore, it is feasible to use L2 gene to increase soybean oil content. The results of the embodiments of the present invention show that the L2 gene not only affects the color of soybean pods and seeds, but can also be used to regulate the oil formation of soybeans; wherein, increasing the expression of the L2 gene can cause the soybean pods to turn brown, and cause the color of the soybean seeds to present an uneven color deposition, while increasing the oil content of the soybeans, confirming the application of the L2 gene in the black navel soybean Williams82, and under other soybean genetic backgrounds, there is still great potential for cultivating high-oil soybeans using the L2 gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.
[0022] Figure 1 This is a graph showing the expression levels of L2 transgenic plants in Example 2;
[0023] Figure 2 The phenotype of the pods and seeds of the L2 transgenic plants in Example 3;
[0024] Figure 3 This is the oil content of L2 transgenic plants and the control group in Example 3. DETAILED DESCRIPTION
[0025] The present invention provides the use of L2 protein and / or L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype, and the amino acid sequence of the L2 protein is shown in SEQ ID NO.14.
[0026] SEQ ID NO.14:
[0027] .
[0028] The present invention provides an application of an L2 protein encoding gene L2 gene in controlling soybean oil content and / or regulating soybean phenotype.
[0029] The present invention can increase the oil content of soybeans and / or regulate the phenotype of soybeans by increasing the expression of the L2 gene encoding the L2 protein in soybeans or increasing the content of the L2 protein in soybeans. In the present invention, the CDS sequence of the L2 gene is shown as SEQ ID NO.3. In the present invention, regulating the phenotype of soybeans can include changing the color of soybean pods and / or seeds at maturity. In the present invention, increasing the expression of the L2 gene encoding the L2 protein in soybeans or increasing the content of the L2 protein in soybeans can change the color of soybean pods at maturity to brown, and at the same time make the color of seeds present uneven color deposition.
[0030] SEQ ID NO.3:
[0031]
[0032] The present invention provides a biomaterial, which comprises a genome vector and / or an engineered bacterium containing the genome vector; the genome vector comprises an L2 gene promoter sequence, an L2 gene CDS sequence and an L2 gene terminator sequence; the L2 gene CDS sequence is shown in SEQ ID NO. 3. In the present invention, the biomaterial can improve the expression of soybean L2 gene.
[0033] The present invention has no special limitation on the construction method of the genome vector, and any conventional construction method in the art can be used. The present invention has no special limitation on the construction method of the engineered bacteria containing the genome vector, and any conventional construction method in the art can be used.
[0034] In the present invention, the L2 gene promoter sequence is shown as SEQ ID NO.1; the L2 gene terminator sequence is shown as SEQ ID NO.2. The present invention has no special limitation on the backbone vector of the genome vector, and any conventional backbone vector in the art may be used. As an optional embodiment of the present invention, the backbone vector may include a pTF101 vector; the pTF101 vector is a conventional commercially available vector. The present invention has no special limitation on the engineering bacteria, and any conventional engineering bacteria in the art may be used. As an optional embodiment of the present invention, the engineering bacteria may include competent Agrobacterium cells GV3101.
[0035] SEQ ID NO.1:
[0036]
[0037] SEQ ID NO.2:
[0038]
[0039] The present invention provides a method for cultivating high-oil soybeans, comprising:
[0040] High-oil soybeans can be obtained by increasing the expression of L2 genes in target soybeans or increasing the content of L2 protein in soybeans.
[0041] In the present invention, the target soybeans include black seed coat soybeans and / or black hilum soybeans; the black hilum soybeans include Williams82 soybeans. The method of the present invention for increasing the expression of L2 gene in the target soybeans includes: transferring the biological material described in the above technical solution into the target soybeans. The present invention has no special limitation on the transfer method, and any conventional transfer method in the art can be used. As an optional embodiment of the present invention, the transfer method includes cotyledon node transformation method.
[0042] The present invention provides a primer set for identifying successful cultivation of high-oil soybeans, comprising an upstream primer F as shown in SEQ ID NO.12 and a downstream primer R as shown in SEQ ID NO.13. The present invention uses the primer set to perform real-time fluorescence quantitative PCR on soybean pod cDNA to determine the expression level of the soybean plant L2 gene.
[0043] The present invention also provides a method for identifying successful construction of L2 transgenic plants, comprising: observing the color of the pods of mature transgenic soybeans to determine whether the L2 gene has been transferred and is functioning. In the present invention, if the color of the pods of mature transgenic soybeans is unevenly deposited or turns brown, it means that the L2 gene has been successfully transferred and is functioning.
[0044] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0045] Example 1
[0046] Construction of L2 genome vector
[0047] Using the parent material brown pod soybean material containing the L2 allele, genomic DNA was extracted, and the 3kb promoter sequence before the CDS of the L2 gene was amplified by PCR as shown in SEQ ID NO.1, and the 1.75kb terminator sequence after the CDS was amplified as shown in SEQ ID NO.2; using the cDNA of the pods of the parent material brown pod soybean material, the CDS sequence of the L2 gene was amplified by PCR as shown in SEQ ID NO.3. The promoter primer sequences are F: aagcttgcatgcctgcaggtcgactctagaGCATCTTAATCTTCATCTTC (Primer 1, SEQ ID NO.4), R: gtggatgttttggctgccatGGATTAATGCAAGATTGATA (Primer 2, SEQ ID NO.5); the terminator primer sequences are F: TGCTCGATTCAAAGGAATGA (Primer 3, SEQ ID NO.6), R: aggaacagctatgacatgattacgaattcAGTTATAGAAGTCCCATCAA (Primer 4, SEQ ID NO.7); the CDS primer sequences are F: ATGGCAGCCAAAACATCCAC (Primer 5, SEQ ID NO.8), R: tcattcctttgaatcgagcaTTTTGTTTAGTGCAGTAATA (Primer 6, SEQ ID NO.9).
[0048] The PCR reaction system is shown in Table 1, and the PCR reaction program is shown in Table 2.
[0049] Table 1 PCR reaction system
[0050] Component name Addition volume (μL) 2 × Apex HFFLPCR Master Mix 25 template 1 Upstream primer F 2.5 Downstream primer R 2.5 Deionized water 19 Total volume 50
[0051] Table 2 PCR reaction program
[0052]
[0053] The homologous recombination arm in the primer sequence is the italic lowercase letter part, and the fragments obtained by the above amplification all include the homologous recombination arm. Among them, the fragments including the above homologous recombination arm, that is, the 3kb promoter sequence before the CDS of the L2 gene including the homologous recombination arm, the L2 gene CDS sequence including the homologous recombination arm, and the 1.75kb terminator sequence after the CDS of the homologous recombination arm, can all be directly synthesized by an artificial synthesis method.
[0054] After the above fragments are amplified, each amplified fragment is connected in sequence by homologous recombination. Specifically, the pTF101 vector is linearized by using EcoRI and XbaI endonucleases, and homologous recombination is performed with the above three fragments.
[0055] The pTF101 vector was digested with XbaI and EcoRI. The digestion reaction system is shown in Table 3. After digestion at 37°C for 1 hour, the digestion product was recovered by gel excision to obtain the digested vector.
[0056] Table 3 Enzyme digestion reaction system
[0057] Component name Addition volume (μL) 10×rCutsmartBuffer 5 pTF101 5 Xgf 1 EcoRI 1 <![CDATA[ddH 2 The]]> 38 Total volume 50
[0058] The homologous recombination reaction system was mixed according to Table 4, and the mixture was reacted at 50° C. for 15 min to perform a homologous recombination reaction to obtain a ligation product.
[0059] Table 4 Homologous recombination reaction system
[0060] Component name Addition volume (μL) 2×OneStepAssemblyCloningMix 5 Enzyme-cut vector 3.5 PCR product (promoter) 0.5 PCR product (CDS) 0.5 PCR product (terminator) 0.5 Total volume 10
[0061] The ligation product was introduced into competent E. coli cells by heat shock method, and a genomic vector containing L2 allele was obtained by expansion culture, PCR identification and plasmid extraction, and named pTF101-L2.
[0062] Example 2
[0063] Genetic transformation and identification of positive individual plants
[0064] The pTF101-L2 vector constructed above was transformed into competent Agrobacterium cells GV3101, and then transformed into soybean variety Williams82 by the cotyledon node transformation method to obtain three T0 generation positive plants, named L2co1, L2co2, and L2co3, respectively. Seeds were harvested from each plant and planted in lines (L2co1, L2co2, and L2co3 were planted alone) at the Jieze Experimental Station of China Agricultural University to obtain T1 generation plants. DNA was extracted from individual plants and PCR identification was performed. The primers for detecting the vector were F: CCGTACTTATACCTACCTACTC (Primer 7, SEQ ID NO.10); R: GTGGATGTTTTGGCTGCCAT (Primer 8, SEQ ID NO.11), and ≥4 positive plants carrying the vector were detected in each line. RNA from the pods of positive individual plants was mixed and extracted, and reverse transcribed into cDNA. The expression of L2 gene was determined by real-time fluorescence quantitative PCR, and the expression of L2 gene of wild soybean variety Williams82 was detected as a control system. The fluorescence quantitative primers were F: GCACGGGGTTTAGGGTGTAC (Primer 9, SEQ ID NO.12); R: GCACGAGCAGCCTCTATTGT (Primer 10, SEQ ID NO.13). The relative expression was determined using GmActin as the internal reference gene, and its primer sequence was GmActin-F as shown in SEQ ID NO.15, specifically: CGGTGGTTCTATCTTGGCATC; GmActin-R as shown in SEQ ID NO.16, specifically: GTCTTTCGCTTCAATAACCCTA.
[0065] In the results of real-time fluorescence quantitative PCR, the relative expression of L2 gene in transgenic lines and control lines is as follows Figure 1 And as shown in Table 5. Figure 1 * indicates p value < 0.05, ** indicates < 0.01, *** indicates less than 0.001, and **** indicates < 0.0001, the same below.
[0066] Table 5 Relative expression of L2 gene in transgenic lines and control lines
[0067]
[0068] Depend on Figure 1 As shown in Table 5, the relative expression level of L2 gene in positive individual transgenic lines was higher than that in wild-type Williams82.
[0069] Example 3
[0070] Functional verification of L2 gene and determination of oil content
[0071] The T1 transgenic lines and wild-type control material (Williams82) grown at the Jize Experimental Station of China Agricultural University were harvested. The pod and seed phenotypes were as follows: Figure 2 As shown, Figure 2 The scale bars in the figure are all 1 cm. The oil content of seeds of T1 generation strains L2co1, L2co2 and L2co3 and the control material (Williams82) was determined by Soxhlet extraction. Four positive plants were selected from each transgenic line as biological replicates, and four plants were also selected as biological replicates for the control material. The results of oil content determination are shown in Figure 3 and Table 6.
[0072] Table 6 Oil content of transgenic lines and control lines
[0073]
[0074] Depend on Figure 2 It can be seen that compared with the control material, the color of the pods of the positive transgenic lines changed from yellow to brown or uneven brown deposition, and the seeds of the positive transgenic lines showed uneven color deposition. Figure 3 It can be seen that after increasing the expression level of L2 gene, the oil content of soybean seeds was significantly increased.
[0075] In summary, the L2 gene not only affects the color of soybean pods and seeds, but can also be used to regulate the oil formation of soybeans. The present invention confirms the application of the L2 gene in black navel soybean Williams82, and there is still great potential for cultivating high-oil soybeans using the L2 gene in other soybean genetic backgrounds.
[0076] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Application of L2 protein and / or L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype, wherein the amino acid sequence of the L2 protein is shown in SEQ ID NO.
14.
2. The use according to claim 1, characterized in that: The expression of the L2 gene encoding the L2 protein in soybean is increased or the content of the L2 protein in soybean is increased, the oil content of soybean is increased and / or the color of soybean pods and / or seeds is changed.
3. The application according to claim 2, characterized in that: The L2 gene CDS sequence is shown in SEQ ID NO.
3.
4. A biomaterial, characterized in that: The biological material includes a genome vector and / or an engineered bacterium containing the genome vector; the genome vector contains an L2 gene promoter sequence, an L2 gene CDS sequence and an L2 gene terminator sequence; the L2 gene CDS sequence is shown in SEQ ID NO.
3.
5. The biomaterial according to claim 4, characterized in that: The L2 gene promoter sequence is shown in SEQ ID NO.1; the L2 gene terminator sequence is shown in SEQ ID NO.
2.
6. A method for cultivating high-oil soybeans, characterized in that: include: High-oil soybeans can be obtained by increasing the expression of L2 genes in target soybeans or increasing the content of L2 protein in soybeans.
7. The method according to claim 6, characterized in that: The method for increasing the expression of L2 gene in target soybean comprises: The biological material according to claim 4 or 5 is introduced into target soybean.
8. The method according to claim 7, characterized in that: The target soybeans include black seed coat soybeans and / or black hilum soybeans.
9. A primer set for identifying successful cultivation of high-oil soybeans, characterized in that: It includes an upstream primer F as shown in SEQ ID NO.12 and a downstream primer R as shown in SEQ ID NO.
13.
10. A method for identifying successful construction of L2 transgenic plants, characterized in that: include: Observe the color of the pods of mature transgenic soybeans to determine whether the L2 gene has been transferred and is functioning.
Citation Information
Patent Citations
Application of L2 protein or coding gene thereof in regulating plant pod color
CN116621960A
Protein for regulating and controlling color of soybean pod as well as coding gene and application thereof
CN117025658A
Soybean coding gene GmRWOS1 and application thereof in synergistic regulation of soybean grain weight and oil content
CN117843744A