Application of L1 protein and / or gene for coding L1 protein in regulation and control of soybean oil content and / or soybean phenotype

By increasing the expression of the L1 gene or the content of L1 protein in soybeans, and using the amino acid sequence of the L1 protein to regulate the content and phenotype of the soybean oil content, the problem of difficulty in increasing the content of soybean oil in the prior art is solved, and the effect of oil content and color change is achieved.

CN120099071AActive Publication Date: 2025-06-06CHINA AGRI UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411657635.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-20
Publication Date
2025-06-06
Estimated Expiration
2044-11-20

AI Technical Summary

Technical Problem

The prior art has not yet effectively increased the soybean oil content by regulating the corresponding traits of soybean pods.

Method used

By increasing the expression of the L1 gene in soybeans or increasing the content of L1 protein in soybeans, the amino acid sequence of the L1 protein (such as SEQ ID NO.11) is used to regulate soybean oil content and phenotype, including changing pods and seed color.

Benefits of technology

While increasing the content of soybean oil, the color of soybean pods and seeds was changed, and the application of the L1 gene in black-nose soybean Williams82 was confirmed, and it also showed great potential in other soybean genetic backgrounds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099071A_ABST
    Figure CN120099071A_ABST
Patent Text Reader

Abstract

The invention provides an application of an L1 protein and / or a gene for coding the L1 protein in regulation and control of soybean oil content and / or soybean phenotype, and belongs to the technical field of gene engineering. The invention provides an application of an L1 protein and / or a gene for coding the L1 protein in regulation and control of soybean oil content and / or soybean phenotype. The amino acid sequence of the L1 protein is as shown in SEQ ID NO.11. The invention also provides an application of the L1 protein and / or the gene for coding the L1 protein in regulation and control of soybean oil content and / or soybean phenotype. Results of the embodiment show that the L1 gene not only influences the colors of soybean pods and seeds, but also can be used for regulating and controlling the oil content formation of soybeans. Wherein the expression of the L1 gene is improved, so that soybean pods can be turned into black, the seed color presents non-uniform color deposition, meanwhile, the content of soybean oil can be improved, and the application of the L1 gene in black navel soybeans is confirmed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of L1 protein and / or a gene encoding L1 protein in regulating soybean oil content and / or soybean phenotype. Background Art

[0002] Soybean (Glycine max (Linn.) Merr.) is the world's largest oil crop, and increasing its seed oil content is an important breeding goal.

[0003] Pods are the final transit point for assimilates to be transported to seeds. They can also provide nutrients to seeds through photosynthesis. They act as both source and flow in the process of seed development, closely affecting seed development and oil formation.

[0004] However, there are currently no reports on how to increase the oil content of soybeans by regulating the corresponding traits of pods. Summary of the invention

[0005] In view of the defects in the prior art, the purpose of the present invention is to provide an application of L1 protein and / or L1 gene encoding L1 protein in regulating soybean oil content and / or regulating soybean phenotype, wherein the L1 protein can affect pod color and also has a regulating effect on soybean oil content.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] The present invention provides application of L1 protein and / or gene encoding L1 protein in regulating soybean oil content and / or soybean phenotype. The amino acid sequence of the L1 protein is shown in SEQ ID NO.11.

[0008] Preferably, the expression of the L1 gene encoding gene in soybean is increased or the content of L1 protein in soybean is increased, the oil content of soybean is increased and / or the color of soybean pods and / or seeds is changed.

[0009] Preferably, the L1 gene CDS sequence is shown as SEQ ID NO.9.

[0010] The present invention provides a biomaterial, which comprises an L1 overexpression vector and / or an engineered bacterium containing the L1 overexpression vector; the L1 overexpression vector contains an L1 gene CDS sequence; the L1 gene CDS sequence is shown in SEQ ID NO.9.

[0011] The present invention provides a method for cultivating high-oil soybeans, comprising:

[0012] High-oil soybeans can be obtained by increasing the expression of L1 gene in soybeans or increasing the content of L1 protein in soybeans.

[0013] Preferably, the method for increasing the expression of L1 gene in soybean comprises:

[0014] The biological material described in the above technical solution is transferred into soybeans.

[0015] Preferably, the soybeans include black seed coat soybeans and / or black hilum soybeans.

[0016] The present invention provides a primer set for identifying successful cultivation of high-oil soybeans, comprising an upstream primer F as shown in SEQ ID NO.5 and a downstream primer R as shown in SEQ ID NO.6.

[0017] The invention provides a method for identifying successful construction of L1 transgenic plants, comprising: observing the color of transgenic soybean pods at maturity, and if the pod color is unevenly deposited or turns black, it is determined that the L1 gene is transferred and takes effect.

[0018] Beneficial effects of the present invention

[0019] The present invention provides an application of L1 protein and / or a gene encoding L1 protein in regulating soybean oil content and / or soybean phenotype, and the amino acid sequence of the L1 protein is shown in SEQ ID NO.11. The present invention has found through research that the L1 gene is a gene that determines whether the soybean pods are black. The present invention uses black pod soybeans and yellow pod soybeans as parental isolated populations, and through a fine positioning method, determines that the gene number of the L1 gene is Glyma.19G120400. According to the annotation of the phytozome website (https: / / phytozome-next.jgi.doe.gov / ) and protein homology comparison, it is found that the gene encodes a synthase containing an HMGL-like domain. Its synthetic product affects the color of soybean pods through accumulation and oxidation. Through natural population analysis, it was found that the pod color can affect the oil content of soybean seeds under the genetic background of black seed coat or black hilum, and the oil content is positively correlated with the pod color under the genetic background of black seed coat or black hilum. Therefore, it is feasible to use the L1 gene to increase the oil content of soybeans. The results of the embodiments of the present invention show that the L1 gene not only affects the color of soybean pods and seeds, but can also be used to regulate the oil formation of soybeans; wherein, increasing the expression of the L1 gene can turn the soybean pods into black, make the color of the soybean seeds present an uneven color deposition, and at the same time increase the oil content of the soybeans, confirming the application of the L1 gene in the black navel soybean Williams82, and under other soybean genetic backgrounds, there is still great potential for cultivating high-oil soybeans using the L1 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0021] Figure 1 This is a graph showing the expression level of L1 transgenic plants in Example 2;

[0022] Figure 2 The phenotype of the pods and seeds of the L1 transgenic plant in Example 3;

[0023] Figure 3 This is the oil content graph of L1 transgenic plants and the control group in Example 3;

[0024] Figure 4 This is a partial map of the final vector of the L1 overexpression vector. DETAILED DESCRIPTION

[0025] The present invention provides application of L1 protein and / or gene encoding L1 protein in regulating soybean oil content and / or soybean phenotype. The amino acid sequence of the L1 protein is shown in SEQ ID NO.11.

[0026] SEQ ID NO.11:

[0027] .

[0028] The present invention can achieve the increase of soybean oil content by increasing the expression of L1 gene, a gene encoding L1 protein in soybean, or increasing the content of L1 protein in soybean; and can also achieve the regulation of soybean phenotype by increasing the expression of L1 gene, a gene encoding L1 protein in soybean, or increasing the content of L1 protein in soybean. In the present invention, the CDS sequence of L1 gene is shown as SEQ ID NO.9. In the present invention, the regulation of soybean phenotype includes changing the color of soybean pods and / or seeds at maturity. In the present invention, increasing the expression of L1 gene, a gene encoding L1 protein in soybean, or increasing the content of L1 protein in soybean can change the color of soybean pods at maturity to black, and at the same time make the color of seeds present uneven color deposition.

[0029] SEQ ID NO.9:

[0030]

[0031] The present invention provides a biomaterial, which comprises an L1 overexpression vector and / or an engineered bacterium containing the L1 overexpression vector; the L1 overexpression vector contains an L1 gene CDS sequence; the L1 gene CDS sequence is shown in SEQ ID NO. 9. In the present invention, the biomaterial can improve the expression of soybean L1 gene.

[0032] The present invention has no special limitation on the method for constructing the L1 overexpression vector, and any conventional construction method in the art can be used. The present invention has no special limitation on the method for constructing the engineered bacteria containing the L1 overexpression vector, and any conventional construction method in the art can be used. In the present invention, the L1 overexpression vector ultimately highly expresses L1 mRNA in the target soybean, and increases the expression level of L1 protein through translation. The present invention has no special limitation on the backbone vector of the L1 overexpression vector, and any conventional backbone vector in the art can be used. As an optional embodiment of the present invention, the backbone vector may include a pTF101 vector; the pTF101 vector is a conventional commercially available vector. The present invention has no special limitation on the engineered bacteria, and any conventional engineered bacteria in the art can be used. As an optional embodiment of the present invention, the engineered bacteria may include competent Agrobacterium cells GV3101.

[0033] The present invention provides a method for cultivating high-oil soybeans, comprising:

[0034] High-oil soybeans can be obtained by increasing the expression of L1 gene in soybeans or increasing the content of L1 protein in soybeans.

[0035] In the present invention, the soybeans include black seed coat soybeans and / or black hilum soybeans; the black hilum soybeans include Williams82 soybeans. The method for increasing the expression of L1 gene in soybeans or the method for increasing the content of L1 protein in soybeans of the present invention comprises: transferring the biological material described in the above technical scheme into the target soybeans. The present invention has no special limitation on the transfer method, and any conventional transfer method in the art can be used. As an optional embodiment of the present invention, the transfer method comprises a cotyledon node transformation method.

[0036] The present invention provides a primer set for identifying successful cultivation of high-oil soybeans, comprising an upstream primer F as shown in SEQ ID NO.5 and a downstream primer R as shown in SEQ ID NO.6. The present invention uses the primer set to perform real-time fluorescence quantitative PCR on soybean pod cDNA to determine the expression level of the soybean plant L1 gene.

[0037] The present invention also provides a method for identifying the successful construction of L1 transgenic plants, comprising: observing the color of the pods of mature transgenic soybeans to determine whether the L1 gene has been transferred and is functioning. In the present invention, if the color of the pods of mature transgenic soybeans is unevenly deposited or turns black, it means that the L1 gene has been successfully transferred and is functioning.

[0038] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0039] Example 1

[0040] Construction of L1 overexpression vector

[0041] 1. Using black pod soybean material, a parent material containing L1 allele, extract pod RNA, reverse transcribe it into cDNA, and amplify the CDS sequence of L1 gene without stop codon, as shown in SEQ ID NO.8, and the primer sequence is F: gacttaagcctaggacgcgtATGGCAGCCAAAACATCTAC (Primer 1, SEQ ID NO.1), R: gcgcgcctcccgggactagtTTCCTTTAAATCGAGCATTT (Primer 2, SEQ ID NO.2). The italic lowercase letters in the above primer sequence are the recombinant homology arm parts. The PCR reaction system is shown in Table 1, and the PCR reaction program is shown in Table 2.

[0042] Table 1 PCR reaction system

[0043] Component name Addition volume (μL) 2 × Apex HFFLPCR Master Mix 25 template 1 Upstream primer F 2.5 Downstream primer R 2.5 Deionized water 19 Total volume 50

[0044] Table 2 PCR reaction program

[0045]

[0046] The amplified product was confirmed by electrophoresis and sequencing. Both ends of the amplified product had homologous recombination arms, which could form a recombinant vector by homologous recombination with the backbone vector pTF101-p35S-MCS-3xFlag-NOS.

[0047] 2. The backbone vector pTF101-p35S-MCS-3xFlag-NOS comes from the team of Professor Kong Fanjiang of Guangzhou University, and the literature source of the backbone vector pTF101-p35S-MCS-3xFlag-NOS is (Lu, Sijia, et al. "Natural variation at the soybean J locus improves adaptation to the tropics and enhancesyield. Nature Genetics 49.5(2017):773).

[0048] 3. Linearize the pTF101-p35S-MCS-3xFlag-NOS vector with SpeI and MluI endonucleases and perform homologous recombination with the amplified product in step 1. The specific method is:

[0049] The pTF101-p35S-MCS-3xFlag-NOS vector was digested with SpeI and MluI. The digestion reaction system is shown in Table 3. After digestion at 37°C for 1 hour, the digestion product was recovered by gel excision to obtain the digested vector.

[0050] Table 3 Enzyme digestion reaction system

[0051] Component name Addition volume (μL) 10×rCutsmartBuffer 5 pTF101-p35S-MCS-3xFlag-NOS 5 SpeI 1 MqI 1 <![CDATA[ddH 2 The]]> 38 Total volume 50

[0052] Then, the homologous recombination reaction system was mixed according to Table 4, and the mixture was reacted at 50° C. for 15 min to perform a homologous recombination reaction to obtain a ligation product.

[0053] Table 4 Homologous recombination reaction system

[0054] Component name Addition volume (μL) 2×OneStepAssemblyCloningMix 5 Enzyme-cut vector 3 PCR products 2 Total volume 10

[0055] The final vector partial map of the L1 overexpression vector of the present invention is as follows Figure 4 The final vector map sequence is shown in SEQ ID NO.10. The sequence shown in SEQ ID NO.10 of the present invention is a part of the L1 overexpression vector, which includes the p35S-L1-3xFlag-NOS sequence fragment and a part of the fragment on the pTF101 vector. The rest of the sequence of the L1 overexpression vector is the same as the pTF101 vector.

[0056] SEQ ID NO.10:

[0057]

[0058] The ligation product was introduced into competent E. coli cells by heat shock method, and an overexpression vector containing L1 allele was obtained by expansion culture, PCR identification and plasmid extraction, and named as pTF101-L1.

[0059] Example 2

[0060] Genetic transformation and identification of positive individual plants

[0061] The constructed pTF101-L1 vector was transferred into competent Agrobacterium cells GV3101, and then transferred into soybean variety Williams82 by cotyledon node transformation method, and a positive plant of T0 generation was obtained, named L1oe1. The seeds of the single plant were planted in Jieze Experimental Station of China Agricultural University to obtain T1 generation plants. DNA was extracted from the T1 generation plants and PCR identification was performed. The detection vector primers were F: ATGGCAGCCAAAACATCTAC (Primer 3, SEQ ID NO.3); R: AATCATCGCAAGACCGGC (Primer 4, SEQ ID NO.4). A total of 4 T1 generation plants carrying pTF101-L1 vectors were detected. RNA from the pods of positive single plants was mixed and extracted, and reverse transcribed into cDNA. The expression of L1 gene was determined by real-time fluorescence quantitative PCR, and the expression of L1 gene of wild soybean variety Williams82 was detected as a control system. The fluorescence quantitative primers were F: CGTGGGAGGCTCTGAAATAC (Primer 5, SEQ ID NO.5); R: CTCTATCCGATCTGGCTGCA (Primer 6, SEQ ID NO.6). The relative expression was determined using GmActin as the internal reference gene, and the primer sequences were GmActin-F as shown in SEQ ID NO.7, specifically: CGGTGGTTCTATCTTGGCATC; GmActin-R as shown in SEQ ID NO.8, specifically: GTCTTTCGCTTCAATAACCCTA.

[0062] In the results of real-time fluorescence quantitative PCR, the relative expression of L1 gene between T1 transgenic lines and control lines was as follows: Figure 1 And as shown in Table 5. Figure 1 * indicates p value < 0.05, ** indicates < 0.01, *** indicates less than 0.001, and **** indicates < 0.0001, the same below. Figure 1 W82 refers to the detection result of the relative expression of L1 gene in the control line, and L1oe1 refers to the detection result of the relative expression of L1 gene in the T1 generation transgenic line.

[0063] Table 5 Relative expression of L1 genes in T1 transgenic lines and control lines

[0064]

[0065]

[0066] Depend on Figure 1 As shown in Table 5, the relative expression level of L1 gene in positive individual transgenic lines was higher than that in wild-type Williams82.

[0067] Example 3

[0068] Functional verification of L1 gene and oil content determination

[0069] The T1 transgenic lines and wild-type control material (Williams82) grown at the Jize Experimental Station of China Agricultural University were harvested. The pod and seed phenotypes were as follows: Figure 2 Its pod and seed phenotypes are shown in Figure 2 As shown, Figure 2 The scale bars in the figure are all 1 cm. The oil content of seeds of T1 generation strain L1oe1 and control material (Williams82) was determined by Soxhlet extraction. Four biological replicates were performed for each treatment, i.e., each biological sample came from a different individual plant, i.e., seeds of four Williams82 plants and seeds of four T1 generation transgenic plants. The oil content was measured by Soxhlet extraction. The results are shown in Figure 3 and Table 6. Figure 2 and Figure 3 W82 refers to the corresponding result of the wild-type control material, and L1oe1 refers to the corresponding result of the T1 generation transgenic line.

[0070] Table 6 Oil content of transgenic lines and control lines

[0071] Plant number Williams82 L1oe1 1 19.57 20.36 2 18.82 19.89 3 19.66 20.51 4 19.44 20.05

[0072] Depend on Figure 2 It can be seen that compared with the control material, the color of the pods of the positive transgenic lines changed from yellow to black or uneven black deposition, and the seeds of the positive transgenic lines showed uneven color deposition. Figure 3 It can be seen that after increasing the expression level of L1 gene, the oil content of soybean seeds was significantly increased.

[0073] In summary, the L1 gene not only affects the color of soybean pods and seeds, but can also be used to regulate the oil formation of soybeans. The present invention confirms the application of the L1 gene in black navel soybean Williams82, and there is still great potential for using the L1 gene to cultivate high-oil soybeans in other soybean genetic backgrounds.

[0074] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of L1 protein and / or gene encoding L1 protein in regulating soybean oil content and / or soybean phenotype, wherein the amino acid sequence of the L1 protein is shown in SEQ ID NO.

11.

2. The use according to claim 1, characterized in that: The expression of the coding gene L1 in soybean is increased or the content of L1 protein in soybean is increased, the oil content of soybean is increased and / or the color of soybean pods and / or seeds is changed.

3. The application according to claim 2, characterized in that: The L1 gene CDS sequence is shown in SEQ ID NO.

9.

4. A biomaterial, characterized in that: The biological material includes an L1 overexpression vector and / or an engineered bacterium containing the L1 overexpression vector; the L1 overexpression vector contains an L1 gene CDS sequence; the L1 gene CDS sequence is shown as SEQ ID NO.

9.

5. A method for cultivating high-oil soybeans, characterized in that: include: High-oil soybeans can be obtained by increasing the expression of L1 gene in soybeans or increasing the content of L1 protein in soybeans.

6. The method according to claim 5, characterized in that: Methods for increasing the expression of L1 genes in soybeans include: The biological material according to claim 4 is introduced into soybean.

7. The method according to claim 6, characterized in that: The soybeans include black seed coat soybeans and / or black hilum soybeans.

8. A primer set for identifying successful cultivation of high-oil soybeans, characterized in that: It includes an upstream primer F as shown in SEQ ID NO.5 and a downstream primer R as shown in SEQ ID NO.

6.

9. A method for identifying successful construction of L1 transgenic plants, characterized in that: include: Observe the color of the pods of genetically modified soybeans at maturity. If the color of the pods shows uneven color deposition or turns black, it is determined that the L1 gene has been transferred and is functioning.

Citation Information

Patent Citations

  • Red tartaric acid synthetase as well as related biological materials and application thereof

    CN116751759A

  • Protein for regulating and controlling color of soybean pod as well as coding gene and application thereof

    CN117025658A

  • Application of GmAAP2 gene in regulation and control of soybean grain traits

    CN118530320A