Construction method capable of realizing fluorescence screening of zebrafish tp53 gene knockout homozygote

Abstract

The invention relates to the technical field of gene engineering, and discloses a construction method capable of realizing fluorescence screening of zebrafish tp53 gene knockout homozygote, which comprises the following steps: S1, introducing a knockin plasmid I, Cas9 protein and sgRNA with an antisense strand target sequence as shown in SEQ ID NO: 14 into a zebrafish fertilized egg, and culturing to obtain a strain I; the knock-in plasmid I comprises a left arm, a termination sequence, a right arm and a fluorescence labeling gene I which are arranged in sequence, and the left arm contains a target sequence of sgRNA; s2, replacing the fluorescence labeled gene I in the S1 with a fluorescence labeled gene II, and repeating the S1 to obtain a strain II; and S3, mating the strain I and the strain II, and screening offspring expressing the fluorescent marker genes I and II at the same time. According to the method disclosed by the invention, targeted knockout of the tp53 gene in the zebrafish can be well realized, and the workload of screening and identifying the homozygote can be reduced and the cost can be reduced in the processes of homozygote construction and subculture.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a construction method for zebrafish tp53 gene knockout homozygotes capable of fluorescence screening. Background Art

[0002] tp53 can act as a transcription factor and affect physiological processes such as apoptosis, embryonic development, stress and DNA repair by regulating the expression of multiple downstream target genes. Studies have shown that the tp53 gene, as a tumor suppressor gene, can participate in cell proliferation and tumor growth by blocking the cell cycle. Its deletion or mutation is closely related to the occurrence and development of various cancers and is one of the key targets for cancer treatment. The construction of tp53 gene knockout homozygotes will help to further study the physiological function and mechanism of action of the tp53 gene, and can be used to establish animal models of related diseases, promoting the study of disease development mechanisms and treatment methods.

[0003] As a relatively new model vertebrate, zebrafish shows high similarity with humans in pathophysiology, development and genetics. It has shown its unique advantages and broad prospects in many research fields of life sciences and has been widely used in the study of various human disease models. The CRISPR / Cas9 system can achieve site-specific knockout and knock-in of genes, and has the advantages of flexible target selection, simple operation and high efficiency. At present, in the process of constructing zebrafish gene knockout homozygotes, the subculture process requires a lot of PCR and sequencing verification work, which has the problems of large identification workload and high subculture cost. Summary of the invention

[0004] In order to solve the above technical problems, in the process of constructing zebrafish gene knockout homozygotes using the CRISPR / Cas9 system, the identification workload is large and the cost of subculture is high. The present invention provides a construction method for zebrafish tp53 gene knockout homozygotes that can be fluorescently screened. The method can better achieve targeted knockout of the tp53 gene in zebrafish, and can reduce the workload of screening and identifying homozygotes and reduce costs during homozygote construction and subculture.

[0005] The specific technical scheme of the present invention is: A method for constructing zebrafish tp53 gene knockout homozygotes capable of fluorescence screening comprises the following steps: S1: Introduce a knock-in plasmid I, a Cas9 protein, and an sgRNA with an antisense strand target sequence such as that shown in SEQ ID NO: 14 into a zebrafish fertilized egg, and culture to obtain a strain I; the knock-in plasmid I comprises a left arm, a termination sequence, a right arm, and a fluorescent marker gene I arranged in sequence, the left arm and the right arm respectively contain the genomic sequences of the 5' upstream and 3' downstream of the gene knockout target segment, and the left arm also contains the target sequence of the sgRNA; S2: Replace the fluorescent marker gene I in S1 with fluorescent marker gene II, repeat S1, and obtain strain II; S3: Mate strains I and II, screen out offspring that express both fluorescent marker gene I and fluorescent marker gene II, and obtain zebrafish tp53 gene knockout homozygotes.

[0006] The present invention adopts sgRNA with a specific target (the target sequence on the antisense chain is shown in SEQ ID NO: 14), which has high activity and specificity. In combination with the left arm, termination sequence and right arm in the knock-in plasmid, the termination sequence can be inserted into the exon of the zebrafish tp53 gene, effectively disrupting the expression of the zebrafish tp53 gene and achieving targeted knockout of the gene.

[0007] In addition, the present invention uses knock-in plasmids with fluorescent marker gene I and fluorescent marker gene II to construct strain I and strain II respectively, and then mates strain I and strain II to construct tp53 gene knockout homozygotes. This method can achieve the following effects: in the mating offspring of strain I and strain II, the tp53 gene knockout heterozygotes only express the fluorescent marker gene I, or only express the fluorescent marker gene II, and the tp53 gene knockout homozygotes simultaneously express the fluorescent marker gene I and the fluorescent marker gene II. Therefore, there is no need to perform PCR and sequencing verification. By observing the traits corresponding to the fluorescent marker gene I and the fluorescent marker gene II, the tp53 gene knockout homozygotes can be screened out from the offspring. Therefore, the screening and identification process is simple, which can reduce the workload of screening and identifying the homozygotes during homozygote construction and subculture breeding, and reduce costs.

[0008] Preferably, in step S1, the termination sequence is the 3'UTR sequence of the zebrafish gapdh gene.

[0009] Furthermore, in step S1, the termination sequence is as shown in SEQ ID NO:10.

[0010] Preferably, in step S3, before mating, strain I and strain II are screened, and the screened individuals are then mated; the screening process is as follows: individuals expressing fluorescent marker gene I and having the termination sequence successfully inserted into the exon of the tp53 gene are screened from strain I, and individuals expressing fluorescent marker gene II and having the termination sequence successfully inserted into the exon of the tp53 gene are screened from strain II.

[0011] Furthermore, the step of selecting individuals in which the termination sequence is successfully inserted into the exon of the tp53 gene from strains I and II includes: extracting genomic DNA from zebrafish of strains I and II, respectively, and performing PCR amplification using primer pairs with sequences as shown in SEQ ID NO: 17 and SEQ ID NO: 18.

[0012] Preferably, in step S1, the sequence of the left arm is as shown in SEQ ID NO:9, and the sequence of the right arm is as shown in SEQ ID NO:11.

[0013] Preferably, in step S1, the fluorescent marker gene I is an eye marker red fluorescent protein gene; in step S2, the fluorescent marker gene II is an eye marker green fluorescent protein gene.

[0014] Furthermore, in step S1, the sequence of the fluorescent marker gene I is shown as SEQ ID NO:12; and in step S2, the sequence of the fluorescent marker gene II is shown as SEQ ID NO:13.

[0015] Preferably, in step S1, the preparation step of the knock-in plasmid I comprises: amplifying nucleic acids respectively comprising a left arm sequence, a termination sequence, a right arm sequence and a fluorescent marker gene I sequence by PCR, and connecting them into a pMD-19T vector in sequence to obtain a knock-in plasmid I.

[0016] Furthermore, in the preparation process of knock-in plasmid I, the zebrafish genome was used as a template and a primer pair with sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2 was used to amplify the nucleic acid containing the left arm sequence by PCR.

[0017] Furthermore, the termination sequence is the 3'UTR sequence of the zebrafish gapdh gene; in the preparation of the knock-in plasmid I, the zebrafish genome is used as a template and the primer pair shown in SEQ ID NO:3 and SEQ ID NO:4 is used to amplify the nucleic acid containing the termination sequence by PCR.

[0018] Furthermore, in the preparation process of knock-in plasmid I, the zebrafish genome was used as a template and a primer pair with sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6 was used to amplify the nucleic acid containing the right arm sequence by PCR.

[0019] Preferably, in step S1, the step of preparing the sgRNA comprises: using the pT7-sgRNA plasmid as a template, using a primer pair with sequences as shown in SEQ ID NO: 15 and SEQ ID NO: 16, performing PCR amplification, and then performing in vitro transcription to obtain sgRNA.

[0020] Compared with the prior art, the present invention has the following advantages: (1) The present invention uses sgRNA with a specific target, combined with a specific left arm sequence, a termination sequence and a right arm sequence in the knock-in plasmid, to better insert the termination sequence into the exon of the zebrafish tp53 gene, effectively disrupt the expression of the zebrafish tp53 gene, and achieve targeted knockout of the gene.

[0021] (2) By using the method of the present invention, during the process of homozygous construction and subculture, the tp53 gene knockout homozygous can be screened out from the offspring by observing the traits corresponding to the fluorescent marker gene I and the fluorescent marker gene II, which can reduce the workload of screening and identification and reduce costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the map of knock-in plasmid I.

[0023] Figure 2 This is the map of knock-in plasmid II.

[0024] Figure 3 This is a gel image of PCR identification of wild-type ("WT"), tp53 gene knockout heterozygous ("+ / -"), and tp53 gene knockout homozygous ("+ / +") zebrafish.

[0025] Figure 4 Gel image showing validation of Ki (tp53-gapdh 3'UTR) knock-in.

[0026] Figure 5 Schematic diagram of fluorescence identification of tp53 gene knockout homozygotes. Note: Since the difference between red fluorescence and green fluorescence cannot be shown in the non-colored figure, Figure 5 Color images were used.

[0027] Figure 6 This is a gel image of RT-PCR identification of wild-type ("WT"), tp53 gene knockout heterozygous ("+ / -"), and tp53 gene knockout homozygous ("+ / +") zebrafish. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with the embodiments.

[0029] Overall embodiment A method for constructing zebrafish tp53 gene knockout homozygotes capable of fluorescence screening comprises the following steps: S1: Introduce a knock-in plasmid I, a Cas9 protein, and an sgRNA with an antisense strand target sequence such as that shown in SEQ ID NO: 14 into a zebrafish fertilized egg, and culture to obtain a strain I; the knock-in plasmid I comprises a left arm, a termination sequence, a right arm, and a fluorescent marker gene I arranged in sequence, the left arm and the right arm respectively contain the genomic sequences of the 5' upstream and 3' downstream of the gene knockout target segment, and the left arm also contains the target sequence of the sgRNA; S2: Replace the fluorescent marker gene I in S1 with fluorescent marker gene II, repeat S1, and obtain strain II; S3: Mate strains I and II, screen out offspring that express both fluorescent marker gene I and fluorescent marker gene II, and obtain zebrafish tp53 gene knockout homozygotes.

[0030] As a specific embodiment, in step S1, the sgRNA preparation step includes: using the pT7-sgRNA plasmid as a template, using a primer pair with sequences as shown in SEQ ID NO: 15 and SEQ ID NO: 16, performing PCR amplification, and then performing in vitro transcription to obtain sgRNA.

[0031] As a specific embodiment, in step S1, the terminator sequence is the 3'UTR sequence of the zebrafish gapdh gene. In this specific embodiment: Optionally or preferably, the termination sequence is shown in SEQ ID NO:10.

[0032] As a specific implementation, in step S1, the sequence of the left arm is shown as SEQ ID NO:9, and the sequence of the right arm is shown as SEQ ID NO:11.

[0033] As a specific implementation, in step S1, the fluorescent marker gene I is an eye marker red fluorescent protein gene; in step S2, the fluorescent marker gene II is an eye marker green fluorescent protein gene. In this specific implementation: Optionally or preferably, the sequence of the fluorescent marker gene I is shown in SEQ ID NO: 12; Optionally or preferably, the sequence of the fluorescent marker gene II is as shown in SEQ ID NO:13.

[0034] As a specific embodiment, in step S1, the preparation step of the knock-in plasmid I includes: amplifying nucleic acids containing a left arm sequence, a termination sequence, a right arm sequence and a fluorescent marker gene I sequence by PCR, and connecting them into the pMD-19T vector in sequence to obtain a knock-in plasmid I. In this specific embodiment: Optionally or preferably, in the process of preparing the knock-in plasmid I, the zebrafish genome is used as a template and a primer pair with sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2 is used to amplify the nucleic acid containing the left arm sequence by PCR; Optionally or preferably, the termination sequence is the 3'UTR sequence of the zebrafish gapdh gene; in the preparation of the knock-in plasmid I, the zebrafish genome is used as a template, and a primer pair with sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4 is used to amplify the nucleic acid containing the termination sequence by PCR; Optionally or preferably, during the preparation of knock-in plasmid I, the zebrafish genome is used as a template and a primer pair with sequences as shown in SEQ ID NO:5 and SEQ ID NO:6 is used to amplify the nucleic acid containing the right arm sequence by PCR.

[0035] As a specific implementation, in step S3, before mating, strain I and strain II are screened, and the screened individuals are then mated. The screening process is as follows: individuals expressing fluorescent marker gene I and the termination sequence successfully inserted into the tp53 gene exon are screened from strain I, and individuals expressing fluorescent marker gene II and the termination sequence successfully inserted into the tp53 gene exon are screened from strain II. In this specific implementation: Optionally or preferably, the step of screening out individuals in which the termination sequence is successfully inserted into the exon of the tp53 gene from strains I and II comprises: extracting genomic DNA from zebrafish of strains I and II, respectively, and performing PCR amplification using primer pairs as shown in SEQ ID NO: 17 and SEQ ID NO: 18. Specific embodiments The present invention is described below by specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention, and the attached claims and any equivalents thereof are the protection scope of the present invention.

[0037] Unless otherwise defined, all technical terms and scientific terms used in the present invention have the same meanings as those commonly understood by ordinary technicians in the field to which the present disclosure belongs. Unless otherwise specified, the raw materials and equipment used in the present invention are conventional raw materials and equipment in the field and can be obtained from conventional commercial channels; unless otherwise specified, the methods used in the present invention are conventional methods in the field.

[0038] Example 1: Construction of knock-in plasmid Using the zebrafish genome as a template, the upstream and downstream primers LF and LR (sequences are shown in Table 1) were used to amplify the nucleic acid containing the left homology arm (left arm) sequence by PCR.

[0039] Table 1 Primer sequences for left homology arm amplification Primer name Primer sequences Sequence number LF gtaaaacgacggccagtgCAGCCTTCTGGACACGACAT SEQ ID NO:1 LR CGGACCACTTCAGCCACATG SEQ ID NO:2 Using the zebrafish genome as a template, the upstream and downstream primers gapdh-F and gapdh-R (sequences shown in Table 2) were used to amplify the nucleic acid containing the gapdh 3'UTR sequence (ie, the zebrafish gapdh gene 3'UTR) by PCR.

[0040] Table 2 Gapdh 3'UTR amplification primer sequences Using the zebrafish genome as a template, upstream and downstream primers RF and RR (sequences shown in Table 3) were used to amplify the nucleic acid containing the right homology arm (right arm) sequence by PCR.

[0041] Table 3 Right homology arm amplification primer sequences Using the DsRed plasmid for marking zebrafish eyes as a template, the upstream and downstream primers TF and TR (sequences are shown in Table 4) were used to amplify the nucleic acid containing the eye-marking red fluorescent protein gene sequence (i.e., T-frt-cryaa-DsRed-pA-frt fusion sequence) by PCR.

[0042] Using the EGFP plasmid that marks zebrafish eyes as a template, the upstream and downstream primers TF and TR (sequences are shown in Table 4) were used to amplify the nucleic acid containing the eye-marking green fluorescent protein gene sequence (i.e., T-frt-cryaa-EGFP-pA-frt fusion sequence) by PCR.

[0043] Table 4 Primer sequences for amplification of eye-marking red / green fluorescent protein genes The left homology arm sequence, right homology arm sequence, gapdh 3'UTR sequence and eye marker red fluorescent protein gene sequence obtained by PCR amplification were sequentially connected into pMD-19T vector (purchased from Takara) to obtain knock-in plasmid I. The plasmid map is shown in Figure 1 shown.

[0044] The left homology arm sequence, right homology arm sequence, gapdh 3'UTR sequence and eye marker green fluorescent protein gene sequence obtained by PCR amplification were sequentially connected into the pMD-19T vector (purchased from Takara) to obtain knock-in plasmid II. The plasmid map is shown in Figure 2 shown.

[0045] In knock-in plasmid I and knock-in plasmid II, the left homology arm sequence, right homology arm sequence, gapdh 3'UTR sequence, eye marker red fluorescent protein gene sequence, and eye marker green fluorescent protein gene sequence are as follows: (1) The left homology arm sequence is shown in SEQ ID NO: 9, with a length of 800 bp, including the genomic sequence 5' upstream of the gene knockout target segment and the target sequence of the sgRNA. The specific sequence is as follows: .

[0046] (2) The gapdh 3'UTR sequence is shown in SEQ ID NO: 10, with a length of 234 bp. The specific sequence is as follows: ATGTGACCCCTTTGCTGTTTCTTTTTTTTGATACGCGACCATTCTCCCATCTGGTTGAATGTTTGCACCACGTGCCTGGAAGGAAATTACATGCTTAAATTGAAGACCAATATTATTTTTATATACTCTGTTCTGTTTCGTGTGTGAGGTTAAAAATAAATGTTGACTTCAAAGGCTTTTCTGTCTGTTAACAACTTGCGATGGAATAAAAGTCCTCTGTTTGTGAGAAATGGA.

[0047] (3) The right homology arm sequence is shown in SEQ ID NO: 11, with a length of 774 bp, and includes the genomic sequence 3' downstream of the gene knockout target segment. The specific sequence is as follows: CAGATGCCCCCATCATGAGCGAACCCCGGATGGAGATAGTACAGACATTTTTTTTTCCATATCCATTCTTGCATCATTCTAGGCCTGCACTATTAATTGATTTTARGTTAAACCAAAATGACGATTTGAAAAGGTGTGTTTTTTTTTTGTTGTTTTTTGCCAGAAACTGTGATTATTTTGTTTATTACTATGGCGAGGGAGGCAAGTGTGTGTAATTAAAACGATCCAACTAATGTTAGTTAAAAAGCAAACAACCGTTACAGCAGACCCCCAAACCAATATGTGGAGATGAAATGAAAGCTGCTAACTTCATTTCTGCTCTGCTTCTCTCGTTCACTCTCTTGTTTTGGCTGTTACAGTGATTCTTGTGGATCCACACACGCACACGAGCACAATTTTATATATAGTTTTAGTTAAATTTAAAATACTTTAGTTATTTTCTTAATTTGTCATGACGGCTGACAACTTTATTGTATTGTATTATATAAAAAGTGGTTTCAAATAAACAGTAGCATAGTGTACTTTGTGATTATGATTGGTCTTTTTTGGTGCTGTTAAAGCCACCACATCAAACCTGCAGCTCTTAAAAAATTAGTAAATTGCATTTTTAAATTGCAATTTTGATCAGATAAATCGCAATTAGATTTTTTTTTTCAAATCGTGCAGCCCTACACTGGAATACACAAGCTAAACAATTATAAGGTGTTTACTTTTTGCACTGAAAGTTAATATCTTGTCTGTTTTCTCCCTGCTCAGACTTGGCGCCTGCTGGTC。

[0048] (4) The gene sequence of the eye-labeled red fluorescent protein is shown in SEQ ID NO:12, with a length of 1564bp. The specific sequence is as follows:

[0049] (5) The eye marker green fluorescent protein gene sequence is shown in SEQ ID NO: 13, with a length of 1606 bp. The specific sequence is as follows:

[0050] Example 2: Synthesis of sgRNA The DNA sequence used to prepare sgRNA (sgRNA target sequence on the antisense strand) is shown in SEQ ID NO: 14, and is as follows: GGACTTCTTATAGATGGCAG (reverse strand, on the antisense strand).

[0051] Using pT7-sgRNA plasmid (obtained from the School of Life Sciences, Peking University) as a template, primers tp53 11s-F and T7gRNA-R (sequences shown in Table 5) were used to obtain an in vitro transcription template by PCR amplification, and then HiScribe TM T7 (lot number 10158087, New England Biolabs, USA) was used for in vitro transcription and mirVana TM The miRNA Isolation Kit (Ambion) was used to recover and obtain sgRNA.

[0052] Table 5 sgRNA transcription template amplification primer sequences Example 3: Zebrafish strain husbandry and microinjection Adult zebrafish were cultured using the aquatic animal culture system of Shanghai Haisheng Company in the following environment: water temperature 28°C, pH 7.5±0.5, and photoperiod of 14 h light / 10 h dark.

[0053] The embryos were maintained in a 10-fold diluted Hank's solution. The pH of Hank's solution was 7.2, and the components and concentrations of each component were as follows: 140 mmol / L NaCl, 5.4 mmol / L KCl, 0.25 mmol / L Na 2 HPO 4 , 0.44mmol / LKH 2 PO 4 , 1.3mmol / L CaCl 2 , 1.0mmol / L MgSO 4 , 4.2mmol / L NaHCO 3 .

[0054] A liquid containing 800 ng / μL Cas9 protein, 320 ng / μL sgRNA (obtained in Example 2) and 15 ng / μL knock-in plasmid I (obtained in Example 1) was injected into one-cell stage zebrafish fertilized eggs by microinjection, and the injection volume per fertilized egg was 1 nL. The fertilized eggs developed into zebrafish under in vitro culture conditions (i.e., the embryonic rearing conditions described above), and zebrafish strain I was obtained.

[0055] A liquid containing 800 ng / μL Cas9 protein, 320 ng / μL sgRNA (obtained in Example 2) and 15 ng / μL knock-in plasmid II (obtained in Example 1) was injected into one-cell stage zebrafish fertilized eggs by microinjection, and the injection volume per fertilized egg was 1 nL. The fertilized eggs developed into zebrafish under in vitro culture conditions (i.e., the embryonic rearing conditions described above), and zebrafish strain II was obtained.

[0056] Example 4: Construction and verification of zebrafish tp53 gene knockout homozygotes After completing microinjection and in vitro culture to obtain zebrafish strain I and zebrafish strain II in Example 3, fertilized eggs produced by the two strains of zebrafish were collected respectively. When they were cultured to 3 dpf, embryos with red fluorescence expressed in the eyes were screened from zebrafish strain I, and embryos with green fluorescence expressed in the eyes were screened from zebrafish strain II using a stereofluorescence microscope.

[0057] Genomic DNA was extracted from the screened embryos, and the gapdh 3'UTR sequence was correctly inserted into the zebrafish tp53 gene exon by PCR, and a 1030 bp band was amplified (e.g. Figure 4 The PCR products were sequenced, and the sequencing results showed that the gapdh 3'UTR sequence was correctly inserted into the zebrafish tp53 gene exon, thus obtaining the tp53-gapdh 3'UTR-cryaa-DsRed knock-in strain (referred to as "knock-in strain I") and the tp53-gapdh3'UTR-cryaa-EGFP knock-in strain (referred to as "knock-in strain II"). In the above PCR method verification process, the primer sequences used are shown in Table 6, the PCR reaction system is shown in Table 7, and the PCR reaction program is as follows: 95°C 5min; 94°C 30s, 58°C 30s, 72°C 1min, 35cycles; 72°C 5min.

[0058] Table 6 Knock-in verification primer sequences Primer name Primer sequences Sequence number tp53-KI-seqF1 5'-GCTAGTGAAGACGCATTAGGGT-3' SEQ ID NO:17 gapdh-R 5'-TCCATTTCTCACAAACAGAGG-3' SEQ ID NO:18 Table 7 PCR reaction system Element Dosage <![CDATA[dd H 2 The]]> 35.75μL 10×buffer 5μL dNTP 4μL tp53-KI-seqF1 2μL gapdh-R 2μL Template DNA 1μL Extaq enzyme 0.25μL Totol 50μL Knock-in strain I and knock-in strain II were mated, and zebrafish with eyes expressing both red and green fluorescence were selected from the mating offspring (e.g. Figure 5 As shown), tp53 gene knockout homozygous zebrafish individuals were obtained.

[0059] From the mating offspring of knock-in strain I and knock-in strain II, zebrafish whose eyes express both red and green fluorescence, zebrafish whose eyes express only red fluorescence, and zebrafish whose eyes express only green fluorescence were selected, and wild-type zebrafish ("WT") were taken as controls, and genomic DNA was extracted for PCR amplification. The primer sequences are shown in Table 8, the PCR system is shown in Table 7 above, and the PCR reaction procedure is as follows: 95℃5min; 94℃30s, 58℃30s, 72℃30s, 35cycles; 72℃5min. The PCR products were subjected to gel electrophoresis, and the gel image obtained is as follows Figure 3 As shown. Figure 3 In the experiment, the wild type (WT) had only one band of 135 bps, the tp53 knockout heterozygote (the eyes only expressed red or green fluorescence) had two bands of 369 bps and 135 bps, and the tp53 knockout homozygote (the eyes expressed both red and green fluorescence) had only one band of 369 bps. The above PCR results show that under the system of the present invention, the tp53 knockout homozygote in the mating offspring of the knock-in strain I and the knock-in strain II can be accurately identified based on the trait (fluorescence color expressed by the eyes).

[0060] From the mating offspring of knock-in strain I and knock-in strain II, 20 embryos with eyes expressing only red fluorescence, only green fluorescence, and both red and green fluorescence were selected, and total RNA was extracted by Trizol (Invitrogen). After reverse transcription (HifairTMII 1st Strand cDNA Synthesis SuperMix for qPCR, Yisheng), RT-PCR identification was performed. The primer sequences used are shown in Table 8, the PCR reaction system is shown in Table 7 above, and the PCR reaction program is as follows: 95°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 15 s, 35 cycles; 72°C for 5 min.

[0061] Table 8 PCR and RT-PCR identification primer sequences Primer name Primer sequences Sequence number tp53-F2 5'-GCCCCGTTCAAATGGTGGT-3' SEQ ID NO:19 tp53-R2 5'-CTCCATCCGGGGTTCGCTC-3' SEQ ID NO:20 The RT-PCR product was subjected to gel electrophoresis, and the obtained gel image was as follows: Figure 6As shown, both WT and tp53 knockout heterozygotes can amplify a band of 135 bps, while tp53 knockout homozygotes do not amplify a band of 135 bps. The above RT-PCR results show that under the system of the present invention, tp53 knockout homozygotes can be accurately identified based on the trait (fluorescent color expressed by the eyes).

[0062] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for constructing zebrafish tp53 gene knockout homozygotes by fluorescence screening, characterized in that: The following steps are involved: S1: Introduce a knock-in plasmid I, a Cas9 protein, and an sgRNA with an antisense strand target sequence such as that shown in SEQ ID NO: 14 into a zebrafish fertilized egg, and culture to obtain a strain I; the knock-in plasmid I comprises a left arm, a termination sequence, a right arm, and a fluorescent marker gene I arranged in sequence, the left arm and the right arm respectively contain the genomic sequences of the 5' upstream and 3' downstream of the gene knockout target segment, and the left arm also contains the target sequence of the sgRNA; S2: Replace the fluorescent marker gene I in S1 with fluorescent marker gene II, repeat S1, and obtain strain II; S3: Mate strains I and II, screen out offspring that express both fluorescent marker gene I and fluorescent marker gene II, and obtain zebrafish tp53 gene knockout homozygotes.

2. The construction method according to claim 1, characterized in that: In step S1, the termination sequence is the 3'UTR sequence of the zebrafish gapdh gene.

3. The construction method according to claim 2, characterized in that: In step S1, the termination sequence is shown as SEQ ID NO:

10.

4. The construction method according to claim 1, characterized in that: In step S3, before mating, strains I and II are screened, and the screened individuals are then mated; the screening process is as follows: individuals expressing fluorescent marker gene I and whose termination sequence is successfully inserted into the exon of the tp53 gene are screened from strain I, and individuals expressing fluorescent marker gene II and whose termination sequence is successfully inserted into the exon of the tp53 gene are screened from strain II.

5. The construction method according to claim 4, characterized in that: The step of selecting individuals with the termination sequence successfully inserted into the exon of the tp53 gene from strains I and II includes: extracting genomic DNA from zebrafish of strains I and II, respectively, and performing PCR amplification using primer pairs with sequences as shown in SEQ ID NO: 17 and SEQ ID NO:

18.

6. The construction method according to claim 1 or 2, characterized in that: In step S1, the sequence of the left arm is shown as SEQ ID NO:9, and the sequence of the right arm is shown as SEQ ID NO:

11.

7. The construction method according to claim 1, characterized in that: In step S1, the fluorescent marker gene I is an eye marker red fluorescent protein gene; in step S2, the fluorescent marker gene II is an eye marker green fluorescent protein gene.

8. The construction method according to claim 7, characterized in that: In step S1, the sequence of the fluorescent marker gene I is shown in SEQ ID NO:12; in step S2, the sequence of the fluorescent marker gene II is shown in SEQ ID NO:

13.

9. The construction method according to claim 1, characterized in that: In step S1, the preparation step of the knock-in plasmid I includes: amplifying nucleic acids containing a left arm sequence, a termination sequence, a right arm sequence and a fluorescent marker gene I sequence respectively by PCR, and connecting them into the pMD-19T vector in sequence to obtain a knock-in plasmid I.

10. The construction method according to claim 1, characterized in that: In step S1, the preparation step of the sgRNA includes: using the pT7-sgRNA plasmid as a template, using a primer pair with sequences as shown in SEQ ID NO: 15 and SEQ ID NO: 16, performing PCR amplification, and then performing in vitro transcription to obtain sgRNA.

Images