Bio-macromolecular cell in-situ positioning and quantitative detection method based on dumbbell-shaped DNA probe

Abstract

The invention discloses a dumbbell-shaped DNA probe-based biomacromolecule cell in-situ positioning and quantitative detection method and also discloses a dumbbell-shaped DNA probe-based complex, two single-stranded DNA tag probes are utilized to identify and combine two sites of biomacromolecules at the same time, and by designing a dumbbell-shaped DNA probe sequence, the biomacromolecule cell in-situ positioning and quantitative detection method is obtained. The purpose of hybridizing the DNA nano-particle structure and the fluorescently-labeled DNA probe is achieved, and bright spots are shown under a fluorescence microscope; and finally, positioning and quantifying the bright spot to realize positioning and quantitative detection of the target to be detected.

Description

Technical Field

[0001] The invention belongs to the field of in-situ positioning and quantitative detection of biological macromolecules, and specifically relates to a dumbbell-shaped DNA probe and a combined method for in-situ positioning and quantitative detection of biological macromolecule cells based on the dumbbell-shaped DNA probe. Background Art

[0002] As a new epigenetic control layer, RNA methylation modification plays a key role in regulating cellular functions, affecting RNA metabolism, stability, and translation. 6 A) stands out as the most common and abundant modification within mRNA, exerting a profound influence on a wide range of mRNA-related processes. 6 A modification is intricately intertwined with transcriptional regulation, signal transduction, and DNA damage response. 6 A modification plays a central role in the regulation of molecular diseases, including cancer, neurological disorders, and cardiovascular diseases. 6 A has become an important target for drug development. Therefore, accurate analysis of RNA m 6 A modification is of vital importance for deepening our understanding of molecular mechanisms and discovering new therapeutic targets.

[0003] Previous studies have shown that 6 The effect of A modification on RNA function is mainly affected by the RNA sequence (methylation motif) where the modification occurs and the degree of methylation. Therefore, most current RNA methylation detection technologies rely on RNA sequencing or quantitative PCR methods. These methods generally involve isolating transcripts from cell populations to analyze methylation sites and determine methylation levels. For example, the early MeRIP-seq / m6A-seq method was able to screen methylation sites in RNA fragments of approximately 200 nucleotides in length at high throughput, but its base resolution capability was limited. In recent years, methods such as PA-m6A-seq (close to 23 nucleotide base resolution) and miCLIP / m6A-CLIP (approximately 1 nucleotide base resolution) derived from m6A-seq have improved the base resolution of methylation analysis. In addition, the DART-seq method not only improves base resolution, but also reduces dependence on antibodies. Although sequencing technology has significantly improved efficiency in identifying methylation sites, quantitative accuracy remains a challenge. In order to improve quantitative accuracy, methods such as m6A-LAIC-seq and MeRIP-qRT-PCR have been developed to assess the levels of specific methylation sites. These methods for analyzing methylated RNA sequences and determining methylation levels have led to the identification of many m 6A methylation functional motif and key molecules of methylation regulation, such as methyltransferases (writers), demethylases (erasers), and methylation reader proteins (readers), have accelerated the verification of methylation functions.

[0004] However, advances in single-cell studies have revealed a new 6 An important aspect of A function: it is not limited to methylation motifs and modification levels, but also involves the spatial distribution of methylated mRNAs within the cell. Recent findings emphasize that m 6 The effect of A modification on the subcellular localization of mRNAs in neuronal cells reveals that methylated mRNAs located in different cellular compartments exhibit different functions. In addition, the subcellular environment where mRNA is located has an important influence on the amount and localization of the protein it produces, which is of great significance for the repair and development of neural damage. However, there is a lack of in situ visualization of mRNAs. 6 A's tools hinder the 6 A comprehensive understanding of the molecular mechanism of mRNA subcellular localization mediated by A. 6 The regulatory mechanism of A requires not only accurate recognition of methylation motifs and m 6 In addition, it is necessary to obtain the details of the subcellular spatial distribution of methylated mRNAs. 6 Drugs that regulate mRNAs often affect the methylation of multiple mRNAs, making it necessary to analyze multiple mRNA targets simultaneously. Therefore, it is urgent to develop in situ multiplexed methods to visualize mRNAs in cells. 6 A, to meet these analytical needs. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes.

[0006] The technical problem that the present invention needs to solve is to provide a complex based on a dumbbell-shaped DNA probe.

[0007] The final technical problem to be solved by the present invention is to provide an application of the dumbbell-shaped DNA probe-based complex in the localization and quantitative detection of methylation specific sites and methylation modifications of mRNA molecules in cells.

[0008] Technical solution: In order to solve the above technical problems, the present invention provides a method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes, comprising the following steps:

[0009] 1) using at least two single-stranded DNA label probes to specifically recognize and bind to different binding sites, different binding positions or different biomolecules on the target biomacromolecule in the sample to be analyzed;

[0010] 2) After the single-stranded DNA tag probe binds, it is hybridized with the same dumbbell-shaped DNA probe to form a stable ternary hybridization structure;

[0011] 3) The dumbbell-shaped DNA probe is made to form a complete closed dumbbell structure as a template for rolling circle amplification through an in situ ligation reaction, and one of the single-stranded DNA label probes is used as a primer for rolling circle replication to form a DNA nanoparticle structure;

[0012] 4) The DNA nanoparticle structure is hybridized with a target-specific fluorescently labeled DNA probe to present a bright spot under a fluorescence microscope. Through the different fluorescent colors of the bright spot and the results of different rounds of imaging, in situ positioning and quantitative detection of multiple target biomacromolecules are achieved.

[0013] Wherein, the single-stranded DNA label probe in step 1) comprises a target-specific oligonucleotide fragment and / or a target-specific site binding molecule. Preferably, the target-specific site binding molecule directly or indirectly interacts with the target-specific site. Preferably, the target-specific site binding molecule comprises one or more of antibodies, antibody fragments, aptamers, oligonucleotides or small molecules.

[0014] Wherein, the sample to be analyzed in step 1) includes one or more of cultured cells or their lysates, frozen tissue sections or paraffin-embedded tissue sections; the target biomacromolecules include one or more of nucleic acids, chemically modified nucleic acids, proteins, protein crosslinks, protein complexes, polypeptides or proteoglycans.

[0015] Wherein, the dumbbell-shaped DNA probe in step 2) is formed by self-hybridization of a single-stranded DNA, including at least one closed single-stranded DNA loop and one single-stranded DNA loop with a gap, the two dumbbell loops are connected by a double-stranded DNA with complementary hybridization in the middle, and at least one of the sequences of the two dumbbell loops is target specific. Preferably, the sequence of the dumbbell-shaped DNA probe contains at least a sequence identical to that of a specific fluorescent-labeled probe.

[0016] Among them, the step of forming a DNA nanoparticle structure by rolling circle replication in step 3) is as follows: different target-specific single-stranded DNA tags mediate different corresponding dumbbell-shaped DNA probe ligation reactions and rolling circle amplification reactions, and each time the target-specific single-stranded DNA tag undergoes a copy of rolling circle amplification using the dumbbell-shaped DNA probe as a template, a single-stranded DNA sequence unit that is completely complementary to the dumbbell-shaped DNA probe sequence is added to the 3' end of its nucleic acid sequence, and finally after multiple copies of the rolling circle amplification, the rolling circle amplification product forms a DNA nanoparticle structure under the promotion of specific reagents.

[0017] Wherein, the specific reagent includes a molecular crowding reagent. Preferably, the molecular crowding reagent includes one or more of polyethylene glycol, polyacrylic acid, polyvinyl alcohol, polyamino acid, dextran, cellulose, and dextran.

[0018] Wherein, the target-specific fluorescently labeled probes in step 4) are labeled with the same fluorescent group or different fluorescent groups. Preferably, the fluorescent groups labeled with nucleic acids of the target-specific fluorescently labeled probes are one, multiple or more.

[0019] The present invention also includes a complex based on a dumbbell-shaped DNA probe, wherein the complex includes a dumbbell-shaped DNA probe, a single-stranded DNA label probe 1 and a single-stranded DNA label probe 2, wherein the dumbbell-shaped DNA probe is formed by self-hybridization of a single-stranded DNA, and includes at least one closed single-stranded DNA loop and a single-stranded DNA loop with a gap, wherein the two dumbbell loops are connected by a double-stranded DNA with complementary hybridization in the middle, wherein a partial sequence of the single-stranded DNA label probe 1 is complementary to a portion of the single-stranded DNA loop with a gap, and a partial sequence of the single-stranded DNA label probe 2 is complementary to a portion of the closed single-stranded DNA loop.

[0020] Among them, the 5' end of the dumbbell-shaped DNA probe is phosphorylated and the 3' end has a hydroxyl group. The sequence of the single-stranded DNA label probe 1 is shown in SEQ ID NO.1, the sequence of the single-stranded DNA label probe 2 is shown in SEQ ID NO.2, the dumbbell-shaped DNA probe sequence is shown in SEQ ID NO.3, and the target-specific fluorescent labeled DNA probes are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0021] The present invention also includes the use of the dumbbell-shaped DNA probe-based complex in the localization and quantitative detection of methylation specific sites and methylation modifications of mRNA molecules in cells.

[0022] The present invention also includes a method for detecting the location and quantification of methylation specific sites and methylation modifications of mRNA molecules in cells based on a dumbbell-shaped DNA probe complex, and the detection method is the same as the detection method described above.

[0023] The detection method of the present invention is to incubate and combine the sample to be tested with a pair of single-stranded DNA label probes specific to different targets, and then the paired single-stranded DNA label probes combined at two sites of the same target can form a spatial proximity effect, which promotes the stable hybridization of their DNA labels with the same dumbbell-shaped DNA probe, and in a rolling circle amplification reaction mediated by the dumbbell-shaped DNA probe, one of the single-stranded DNA labels is extended, and finally a target-specific DNA nanoparticle structure is formed under the action of a molecular crowding reagent. After the DNA nanoparticle structure is combined with a specific fluorescent labeling probe, a detectable fluorescent bright spot is formed, and the purpose of in-situ positioning and quantitative detection of specific biological macromolecules in cells is achieved through the different fluorescent colors of the bright spot and the results of different rounds of imaging.

[0024] Among them, in the pair of target-specific single-stranded DNA label probes, at least one probe's DNA label also has target specificity.

[0025] Among them, the target-specific pair of single-stranded DNA label probes can simultaneously hybridize with the two dumbbell ring sequences of a corresponding dumbbell-shaped DNA probe. After hybridization, the gap in one of the dumbbell rings can be connected by DNA ligase in a DNA ligase system to form a closed dumbbell ring without a gap.

[0026] Among them, the target-specific pair of single-stranded DNA label probes respectively contain a target-specific site binding molecule and a single-stranded DNA sequence, the two are interconnected into one, and the target-specific site binding molecule interacts and binds specifically with the target-specific site; under conditions that promote the mutual binding between the target-specific site and the target-specific site binding molecule, the target-specific site binding molecule and the sample to be analyzed are incubated, and unbound target-specific site binding molecules are optionally removed.

[0027] Further, the target specific site binding molecule of a pair of target-specific single-stranded DNA tag probes can be an antibody or an antibody fragment. When the target specific site binding molecule is an antibody or an antibody fragment, the single-stranded DNA tag can be coupled to its constant region.

[0028] Wherein, the single-stranded DNA tag can be connected to the target specific site binding molecule through an intermediate linker. In some embodiments, an intermediate linker comprises streptavidin and / or biotin.

[0029] Among them, when the detection method is used to simultaneously detect multiple specific biological macromolecules, multiple pairs of target-specific single-stranded DNA label probes can be used simultaneously. The multiple pairs of target-specific single-stranded DNA label probes can respectively hybridize with the two dumbbell ring sequences of the corresponding dumbbell-shaped DNA probe. After hybridization, the dumbbell rings with gaps can be connected by DNA ligase in the same DNA ligase system to form closed dumbbell rings without gaps.

[0030] Wherein, each target-specific dumbbell ring comprises a target-specific DNA sequence and a sequence that is partially or completely identical to a specific fluorescent labeling probe sequence.

[0031] Among them, the rolling circle amplification mediated by the dumbbell-shaped DNA probe can amplify one single-stranded DNA label in a pair of single-stranded DNA label probes that are simultaneously bound to the target. The specific process is as follows: single-stranded DNA labels with different target specificities mediate different corresponding dumbbell-shaped probe ligation reactions and rolling circle amplification reactions. After each copy of the rolling circle amplification using the dumbbell-shaped DNA probe as a template, the target-specific single-stranded DNA label will add a single-stranded DNA sequence unit that is completely complementary to the dumbbell-shaped DNA probe sequence at the 3' end of its nucleic acid sequence. Finally, after multiple copies of the rolling circle amplification, the target-specific single-stranded DNA label will form a long single-stranded DNA with multiple repeating sequence units, and the long single-stranded DNA will spontaneously form a DNA nanoparticle structure.

[0032] Among them, the DNA nanoparticle structures corresponding to the different targets, after combining with the target-specific fluorescent labeling probes, form detectable fluorescent bright spots. Through the different fluorescent colors of the bright spots and the results of different rounds of imaging, the purpose of in situ positioning and quantitative detection of multiple specific biological macromolecules in cells can be achieved.

[0033] The DNA nanoparticle structure is connected to a target specific site through a target specific site binding molecule, wherein each target specific site binding molecule binds to a site of a target, so each DNA nanoparticle structure corresponds to a target molecule, wherein the number and corresponding positions of bright spots generated by the DNA nanoparticle structure in different analysis samples indicate the number and positions of the analyzed targets.

[0034] Among them, the number and position of the DNA nanoparticle structure are generated by hybridizing the DNA nanoparticle structure with the corresponding target-specific fluorescent labeling probe, so that each DNA nanoparticle structure can emit specific fluorescence under specific excitation light, and analyzed using a fluorescence microscope or a fluorescence scanning instrument; multiple DNA nanoparticle structures corresponding to multiple targets are distinguished by hybridization with target-specific fluorescent labeling probes with different excitation / emission wavelengths; when the fluorescence microscope or fluorescence scanning instrument cannot distinguish more fluorescent labels, multiple rounds of hybridization imaging can be performed to achieve analysis of DNA nanoparticle structures corresponding to more targets.

[0035] Further, target-specific fluorescently labeled probes with different sequences can be labeled with the same fluorescent group, and this method only requires a single excitation wavelength and detector. In other embodiments, fluorescently labeled probes with different sequences can be different labels. This method can utilize multiple excitation wavelengths and multi-channel detectors.

[0036] Furthermore, when the detection method is used to simultaneously detect multiple specific biomacromolecules, it also includes removing the bound target-specific fluorescently labeled probes from the DNA nanoparticle structure by applying an external electric field or a buffer solution to achieve visualization analysis of other target-specific DNA nanoparticle structures in the next round.

[0037] Furthermore, in some embodiments, the nucleic acid of the target-specific fluorescently labeled probe may be labeled with one, multiple or more fluorophores.

[0038] Wherein, the external electric field is electrophoresis, and the buffer solution is a phosphate buffered saline solution or a phosphate buffered saline solution containing a surfactant Triton X-100 or Tween20.

[0039] Preferably, the DNA ligase is T4 DNA ligase.

[0040] Wherein, the polymerase used in the rolling circle amplification reaction is a DNA polymerase, preferably a DNA polymerase with strand displacement activity.

[0041] Furthermore, the DNA polymerase having strand displacement activity is preferably phi29 polymerase.

[0042] The present invention provides a method for in situ detection of specific biological macromolecules (such as mRNA methylated at a specific site) in cells. The detection method uses two single-stranded DNA label probes to simultaneously identify and bind to two sites of the biological macromolecule to be detected (such as mRNA methylation specific site and methylation modification), thereby causing the two single-stranded DNA labels of the probe to be close in space, and then can be stably hybridized with the added dumbbell-shaped DNA probe at the same time, and then use dumbbell-shaped DNA probe-mediated rolling circle amplification to amplify one of the single-stranded DNA labels, and the amplified product can spontaneously form a DNA nanoparticle structure through sequence self-hybridization; after the DNA nanoparticle structure is hybridized with the fluorescently labeled DNA probe, a bright spot can be presented under a fluorescent microscope; finally, by positioning and quantifying the bright spot, the positioning and quantitative detection of the target to be detected is achieved.

[0043] It should be understood that before analyzing a sample, its target is known, suspected, unknown or unsuspected. Whether the target-specific single-stranded DNA label probe can bind to the analysis sample depends on whether a given target or target site exists in the sample to be analyzed (for example: when a given target exists on the sample to be analyzed, the target-specific single-stranded DNA label probe can bind to the sample to be analyzed; when a given target exists on the sample to be analyzed and the target has a corresponding site, the target-specific single-stranded DNA label probe can bind to the sample to be analyzed). "Bound to the analysis sample" means that the target-specific single-stranded DNA label probe binds to its corresponding target or target-specific site.

[0044] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the dumbbell-shaped DNA probe and the detection method based on the dumbbell-shaped DNA probe of the present invention can locate and quantify one or more targets in the sample to be analyzed in situ in the cell; it can also locate and quantify targets or target complexes with specific sites in the sample to be analyzed in situ in the cell, especially RNA molecular targets methylated at specific sites. The method can realize the digital quantification of the target to be tested or the target with specific sites by counting the number of in situ fluorescent bright spots, thereby improving the quantitative accuracy; the system relies on the adjacent interaction of the three probes, and only when there are corresponding sites at the target to be tested can the adjacent effect between the probes and the subsequent rolling circle amplification be triggered, thereby ensuring the high specificity and high selectivity of the method; in addition, the self-hybridization structure of the dumbbell-shaped DNA probe limits the spatial distance of the adjacent connection, and the method improves the number of adjacent connection probe gaps, significantly improving the detection efficiency of the method, and providing researchers with an efficient, highly accurate and easy-to-operate detection method. Furthermore, in order to improve the versatility and detection throughput of the method, this method can be combined with multiple detection technology. By simply changing part of the probe sequence, multiple targets or sites of interest can be detected simultaneously. This flexible strategy can also be combined with other downstream detection methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a schematic diagram of the design principles of the single-stranded DNA label probe and dumbbell-shaped DNA probe provided by the present invention.

[0046] Figure 2 This is a schematic diagram of the principle of the combined method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes provided by the present invention.

[0047] Figure 3 The combined method provided by the present invention is used to analyze the detection results of methylated mRNA at specific sites in cells.

[0048] Figure 4 The combined method provided by the present invention is used to analyze the detection results of methylated mRNA at specific sites in cells after artificial gene manipulation. DETAILED DESCRIPTION

[0049] The dumbbell-shaped DNA probe and the combination method based on the dumbbell-shaped DNA probe provided by the present invention are described in detail below in conjunction with the accompanying drawings and specific embodiments of the specification, but they should not be construed as limiting the scope of protection of the present invention.

[0050] In the present invention, the term "target" is any biological component that is desired to be observed or quantitatively analyzed and for which there is a specific binding molecule. In some embodiments, the target can be an engineered or non-naturally occurring biomolecule. This "biomolecule" is any molecule produced by a living organism, including macromolecules, such as proteins, proteoglycans, lipids and nucleic acids, and small molecules, such as metabolites and natural products. Examples of biomolecules include, but are not limited to, DNA, RNA, cDNA, or DNA products of RNA subjected to reverse transcription.

[0051] Example 1 Design of single-stranded DNA label probe and dumbbell-shaped DNA probe

[0052] (1) Sequence information

[0053] Tag sequence of single-stranded DNA tag probe 1 (SEQ ID NO. 1): GACGC TAATA GTTAA GACGC TTTAATCGTG GATCAGTCTAGACAT GTCAC TAACA TCATC ATTCA AAGTT CTCGAATCAT GTATC ACGCTGTATG CGGTG GACGATGGAG GGGCC

[0054] Sequence of single-stranded DNA labeling probe 2 (SEQ ID NO. 2): CCTGT CTCAAGTGTC GCTCT CTCTATGGAA AGAAT GGTTA CTAAT CGAAG GACGC GACCC AACGG ACTAC CTTGC ACTAT GAGAACTAGACACTC TT

[0055] Dumbbell DNA probe 1 sequence and modification group (SEQ ID NO.3): PHO / TAGCG TCCAG TGAGC ACTGCTTACT CAAAG AGTGT CTAGT TCTGC CCGCG CCGAG GTGTC AGCAG TGCAT GAACC TTAAC TAT

[0056] Fluorescently labeled DNA probe 1 sequence and modification group (SEQ ID NO.4): FAM / CGCGC CGAGG T

[0057] Fluorescently labeled DNA probe 2 sequence and modification group (SEQ ID NO.5): Cy3 / CGCGC CGAGG T

[0058] See also Figure 1In this embodiment, a dumbbell-shaped single-stranded DNA label probe and a schematic diagram of the principle design of the dumbbell-shaped DNA probe are shown. Among them, the dumbbell-shaped DNA contains a double-stranded DNA structure of complementary hybridization and two dumbbell ring structures, and the sequence lengths of the two types of structures are not unique. Dumbbell ring 2 is a closed structure without a gap, while dumbbell ring 1 has a gap, the 5' end of the sequence at the gap is modified with a phosphate group, and the 3' end has a hydroxyl group. In addition, this embodiment also shows the sequences of single-stranded DNA label probes 1 and 2, wherein the 5' end of the single-stranded DNA label probe 1 has a sequence that continuously hybridizes with the dumbbell ring 1, the length and base composition of the sequence are not unique, and the hybridization part covers the gap of the dumbbell ring 1. At this time, the gap can be connected under the action of DNA ligase, and then a closed dumbbell ring is formed. The 3' end of the single-stranded DNA label probe 1 can be connected to a target-specific binding molecule, and the specific binding molecule is one or more of an antibody, an antibody fragment, an aptamer, an oligonucleotide or a small molecule. In addition, the 3' end of the single-stranded DNA label probe 2 has a sequence that continuously hybridizes with the dumbbell ring 2, and the length and base composition of the sequence are not unique. The 5' end of the single-stranded DNA label probe 2 can be connected to a target-specific binding molecule, and the specific binding molecule is one or more of an antibody, an antibody fragment, an aptamer, an oligonucleotide or a small molecule. In the sequence of the dumbbell ring 2, there is also a continuous sequence with the same sequence composition as the fluorescent-labeled DNA probe 1 or 2, and the length and base composition of the sequence are not unique. Therefore, only when the single-stranded DNA label probe 1 is used as a template for an amplification reaction with the dumbbell-shaped DNA after the gap connection, can a sequence that is complementary to the fluorescent-labeled DNA probe 1 or 2 be generated, thereby ensuring the specificity of the fluorescent signal.

[0059] Example 2 In situ localization and quantitative detection of biomacromolecules in cells based on dumbbell-shaped DNA probes

[0060] (1) Experimental materials and reagents:

[0061] HeLa cell line was obtained from ATCC cell bank; cell culture grade phosphate buffered saline (PBS solution, without calcium chloride and magnesium chloride, 1× PBS pH 7.4) was purchased from the United States DMEM culture medium (containing penicillin-streptomycin double antibody) was purchased from Keygen Biotechnology; Trypsin was purchased from the United States Sterile fetal bovine serum (FBS) was purchased from Israel Bovine serum albumin (BSA) was purchased from Amresco, USA; Glass Bottom Cell Culture Dish was purchased from Wuxi Nice Biotechnology Co., Ltd.; streptavidin was purchased from Bioss, USA; biotinylation kit was purchased from Abcam, UK; biotin, formamide, dimethyl sulfoxide (DMSO) and polyethylene glycol tert-octylphenyl ether (Triton X-100) were purchased from Sigma-Aldrich, USA; 4′,6-diamidino-2-phenylindole (DAPI) was purchased from Boster, Wuhan; solid-phase RNase scavenger was purchased from Shanghai Biotech; RNase inhibitor for reaction was purchased from Novizan Biotechnology; anti-m 6 Antibody A was purchased from SYSY (Synaptic Systems), USA. T4 DNA ligase and phi29 DNA polymerase were purchased from New England Biolabs. All oligonucleotide probes, biotinylated oligonucleotide probes, phosphorylated oligonucleotide probes, and fluorescent group-modified oligonucleotide probes were synthesized and prepared by Shanghai Sangon Biotechnology and Thermo Fisher Scientific, and the purification level was HPLC grade. siRNA was commissioned to Genentech for synthesis. dNTPs were purchased from Beijing Saibaisheng Biotechnology Co., Ltd. Salmon sperm DNA solution was purchased from Thermo Fisher Scientific (China) Co., Ltd. Ammonium chloride and sodium hydroxide were purchased from Sinopharm Chemical Reagent Co., Ltd. Deionized water (water outlet measurement value 18.2 MΩ) was used in the experiment from Explorer series Water Purification system, a water purification instrument purchased from Blue Oxide Pharmaceuticals, USA. The water used in cell-grade experiments was analytical-grade water sterilized by high pressure. The water used in other molecular biology experiments was purchased from Watsons distilled water. All other reagents were of analytical grade. The fluorescence microscope was a Nikon ECLIPSE Ni microscope purchased from Nikon Corporation of Japan.

[0062] Tag sequence of single-stranded DNA tag probe 1 (SEQ ID NO. 1): GACGC TAATA GTTAA GACGC TTTAATCGTG GATCA GTCTA GACAT GTCAC TAACA TCATC ATTCA AAGTT CTCGA ATCAT GTATC ACGCTGTATG CGGTG GACGA TGGAG GGGCC

[0063] Single-stranded DNA label probe 2 sequence (SEQ ID NO.2): CCTGT CTCAA GTGTC GCTCT CTCTA TGGAAAGAAT GGTTA CTAAT CGAAG GACGC GACCC AACGG ACTAC CTTGC ACTAT GAGAA CTAGA CACTCTT

[0064] Dumbbell DNA probe 1 sequence and modification group (SEQ ID NO.3): PHO / TAGCG TCCAG TGAGC ACTGCTTACT CAAAG AGTGT CTAGT TCTGC CCGCG CCGAG GTGTC AGCAG TGCAT GAACC TTAAC TAT

[0065] Fluorescently labeled DNA probe 1 sequence and modification group (SEQ ID NO.4): FAM / CGCGC CGAGG T

[0066] Fluorescently labeled DNA probe 2 sequence and modification group (SEQ ID NO.5): Cy3 / CGCGC CGAGG T

[0067] (2) Cell culture experimental steps, contents and conditions:

[0068] The HeLa cell line culture system is: DMEM medium (Keygen Biotechnology) containing 10% FBS and 50U / mL penicillin and 50μg / mL streptomycin double antibody mixed solution. The cell culture conditions are: 95% relative humidity, 5% carbon dioxide gas, 37°C. When the cell confluence is 70-90%, start passaging. For inoculation of imaging experiments: HeLa cells are inoculated in a confocal dish. When the cells are attached and the confluence reaches 30%-50%, subsequent experiments can be carried out.

[0069] (3) Oligonucleotide tagging antibody modification experimental steps, contents and conditions:

[0070] For the method of modifying antibodies using biotinylated DNA probes, firstly, a 1.34 μM biotinylated probe (single-stranded DNA label probe 1) and a 1.34 μM streptavidin solution were prepared, and then 25 μL of the biotinylated probe solution and the streptavidin solution were taken, mixed thoroughly, and incubated at 37°C for 45 min to obtain a reaction mixture. Then, 50 μL of 0.67 μM biotinylated antibody (anti-m 6A antibody) and gently mix in a mixing instrument at 4°C and react overnight. Finally, add 382.5 μL of antibody incubation buffer (including 0.5 mg / mL salmon sperm DNA, 1 mM biotin, 8 mM Na 2 HPO 4 , 2 mM NaH 2 PO 4 , 150 mM NaCl, 0.1% BSA, 0.025% Tween20, pH 7.4), let stand at room temperature for 20 min, then divide and store in a 4°C refrigerator.

[0071] (4) Target detection experimental steps, contents and conditions:

[0072] First, the 10 5 Add 1 mL of pre-cooled 4% paraformaldehyde fixative to each confocal dish of HeLa cells and incubate at room temperature for 15 minutes, then remove the excess fixative and wash three times with PBS buffer. To permeabilize the cell membrane, add 1 mL of 0.5% Triton X-100 permeabilization agent to each dish, permeabilize for 5 minutes at room temperature, and rinse three times with PBS buffer to wash away the excess permeabilization solution. To block nonspecific sites in the cells, add 100 μL of blocking solution with a final concentration of 2.5 mg / mL salmon sperm DNA, 2.5 mM glycine, 5% BSA, and 1 U / μL RNase inhibitor, and block at 37°C for 1.5 hours. Then add the anti-m-conjugated prepared in step 3 at a final concentration of 15 ng / μL 6100 μL of the reaction system of the antibody incubation solution of the single-stranded DNA label probe 1 of antibody A and the RNase inhibitor with a final concentration of 1 U / μL was added to a small dish and reacted overnight at 4° C. for 16 hours. After the reaction was completed, the cells were washed 3 times with PBS. Then, single-stranded DNA label probe 2 with a final concentration of 0.5 μM and dumbbell-shaped DNA probe 1 with a final concentration of 0.5 μM, sodium citrate buffer with a final concentration of 2× (Thermo Fisher Scientific, catalog number: AM9770) and RNase inhibitor with a final concentration of 1 U / μL were added, and the total reaction system was 100 μL, and the probe hybridization process was completed at 37°C. After washing 3 times, T4 DNA ligase with a final concentration of 0.1 U / μL, 1×T4 DNA ligase buffer and RNase inhibitor with a final concentration of 1 U / μL were added, and the total connection system was 100 μL for 30 minutes to complete the connection circularization of the template to obtain a complete closed dumbbell structure. For the RCA (rolling circle amplification) reaction, dNTPs (10 mM, 5 μL), 1×phi29 DNA ligase (10 U / μL, 5 μL) and its buffer (10x Phi29Buffer, 10 μL) and 1U / μL were added. Rnase inhibitor (40U / μL, added volume 2.5μL), DEPC water was added to the total reaction volume of 100μL, reacted for 1h, and then washed three times. Finally, a mixed solution containing a final concentration of 0.5μM fluorescent probe, a final concentration of 0.5mg / mL salmon sperm DNA, and a final concentration of 2× sodium citrate buffer was added, and the total system was 100μL for imaging the generated RCA products and staining the cell nuclei with DAPI.

[0073] See also Figure 2 In this embodiment, the present invention provides a schematic diagram of the principle of a combined method for in situ localization and quantitative detection of biological macromolecules (such as methylation sites on RNA) in cells based on dumbbell-shaped DNA probes. The specific principle is described as follows:

[0074] First, the cells are cultured and processed according to the method of item (2) above, "Cell culture experimental steps, contents and conditions", to obtain the cell sample to be analyzed; and the probe is prepared according to the methods of items (1) and (3) to obtain the oligonucleotide-labeled antibody, that is, Figure 2The single-stranded DNA label probe 1 in the sample is treated according to the method of item (4), and then the single-stranded DNA label probe 1 is incubated with the cell sample and the excess single-stranded DNA label probe 1 is removed; according to the probe information provided in item (1), the single-stranded DNA label probe 2 and the dumbbell-shaped DNA probe are incubated, and the excess single-stranded DNA label probe 2 and the dumbbell-shaped DNA probe are removed; therefore, a ternary hybridization structure of "single-stranded DNA label probe 1-dumbbell-shaped DNA probe-single-stranded DNA label probe 2" is formed on the RNA to be analyzed having the target methylation site, rather than the RNA to be analyzed A or the RNA to be analyzed that does not have the target methylation site will not be able to form the ternary hybrid structure; then, according to the method of item (4), the gap of the dumbbell ring in the ternary hybrid structure is subjected to a ligation reaction to make it a closed dumbbell ring, and an amplification reaction is performed to amplify and extend the single-stranded DNA label probe 2, and the amplification product can spontaneously form a DNA nanoparticle structure through sequence self-hybridization; after the DNA nanoparticle structure is hybridized with the fluorescently labeled DNA probe, a bright spot can be presented under a fluorescent microscope; finally, by locating and quantifying the bright spot, the positioning and quantitative detection of the target to be detected is achieved. The principle demonstrated in this embodiment can not only be used for RNA methylation site analysis, but also can be expanded to the detection and analysis of other biological components that are expected to be observed or quantitatively analyzed and have their specific binding molecules. In some cases, the target can also be an engineered or non-naturally occurring biological molecule. This "biological molecule" is any molecule produced by a living organism, including macromolecules such as proteins, proteoglycans, lipids and nucleic acids, as well as small molecules such as metabolites and natural products. Examples of biological molecules include, but are not limited to: DNA, RNA, cDNA, or DNA products of RNA subjected to reverse transcription.

[0075] Example 3 Detection results of the dumbbell-shaped DNA probe combination provided by the present invention for analyzing methylated mRNA at specific sites in cells

[0076] In this example, the specific experimental materials and reagents, cell culture experimental steps, contents and conditions, oligonucleotide tag labeling antibody modification experimental steps, contents and conditions, target detection experimental steps, contents and conditions, etc., refer to Example 2. The experimental results are shown in Figure 3 The experimental group in the imaging figure is a combination method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes provided by the present invention, and the methylation of 1217th adenosine on the target gene ACTB (Beta-actin, actin β) RNA in HeLa cells (m 6A) Representative imaging of the detection of the target signal, the result shows that the target signal presents a series of fluorescent bright spots that are clearly distinguished from the background, indicating that this is the result presented under a fluorescence microscope after the DNA nanoparticle structure formed by the rolling circle amplification of the single-stranded DNA label probe 2 and hybridized with the fluorescent labeled DNA probe. The elliptical signal with a central area exceeding 10 microns is the nuclear imaging signal obtained according to the operation of item (4) in Example 2. The sequence of the target gene ACTB is as follows: The bold A in the sequence is the 1217th adenosine methylation (m 6 A) Site:

[0077]

[0078] ACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGAT

[0079] CGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCA

[0080] AGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAG

[0081] GCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTTGCGC

[0082] AGAAAACAAGATGAGATTGGCATGGCTTTATTTGTTTTTTTTGTTTTGTTTTGG

[0083] TTTTTTTTTTTTTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGT

[0084] GACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGG

[0085] ACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTT

[0086] GTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCACTTCTCTCTAAGGAG

[0087] AATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTC

[0088] GTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTTATTT

[0089] TGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCCTTCCCCCTTTTTTGTCCCC

[0090] CAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAG

[0091] CCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCACACCT

[0092] TAAAAATGA

[0093] In order to further prove the bright spot specificity of the above-mentioned DNA nanoparticle structure formation, this example also shows the results of 8 groups of parallel control experiments, namely control group 1 (the label of the single-stranded DNA label probe 1 is not bound to the anti-m 6 A antibody), control group 2 (cells were not incubated with single-stranded DNA label probe 1), control group 3 (cells were not incubated with dumbbell-shaped DNA probe), control group 4 (no ligation reaction operation), control group 5 (the anti-m 6 A antibody does not bind to the label of single-stranded DNA label probe 1), control group 6 (the label sequence of single-stranded DNA label probe 1 is changed, and it cannot hybridize with the dumbbell-shaped DNA probe), control group 7 (cells are not incubated with single-stranded DNA label probe 2), control group 8 (the sequence of the single-stranded DNA label probe 2 is changed, and it cannot hybridize with the RNA to be analyzed in the cell). For experimental results, see Figure 3 The imaging results of the eight groups of parallel control experiments could not effectively produce fluorescent bright spots similar to those in the experimental group. Figure 3 The histogram statistical results in also show that the control group cannot effectively generate quantitative fluorescent bright spot data similar to the experimental group, and all control groups have significant differences from the experimental group data (two-tailed unpaired T test, **** represents P < 0.0001). The above results show that the combined method provided by the present invention has good detection specificity.

[0094] Example 4 The dumbbell-shaped DNA probe combination provided by the present invention is used to analyze the detection results of methylated mRNA at specific sites in cells after artificial gene manipulation

[0095] In this example, the specific experimental materials and reagents, the experimental steps, contents and conditions of oligonucleotide tag-labeled antibody modification, the experimental steps, contents and conditions of target detection, etc., refer to Example 2.

[0096] First, the antibody modification was performed according to the steps, contents and conditions of the oligonucleotide tag antibody modification experiment in Example 2; secondly, the two groups of samples (control group and siMETTL3 group) of this example were subjected to the following cell culture operations and transfection experimental treatments respectively:

[0097] Cell culture (including transfection experiment) Experimental steps, contents and conditions: HeLa cell line culture system: DMEM medium (Keygen Biotechnology) containing 10% FBS and 50U / mL penicillin and 50μg / mL streptomycin double antibody mixed solution. Cell culture conditions: 95% relative humidity, 5% carbon dioxide gas, 37°C. When the cell confluence is 70-90%, start subculturing. For inoculation of imaging experiments: 10 5 HeLa cells were inoculated in a confocal dish. When the cells adhered to the wall and the degree of confluence reached 30%-50%, the cells could be subjected to downstream transfection experiments. That is, first, 24 microliters of 10 μM siRNA was added to two 300 μl Opti-MEM culture media (Opti-MEM culture media purchased from Gibco, USA) as the experimental group (targeting the METTL3 gene, siMETTL3 (siRNA) sequence: GCAAGU AUG UUC ACU AUG ATT) or 24 microliters of water were added instead of siRNA as the control group, and the mixture was gently mixed and allowed to stand at room temperature; then, two 300 μl Opti-MEM culture media were prepared, 18 microliters of Lipofectamine transfection agent (Lipofectamine RNAi MAX transfection agent, purchased from Thermo Fisher, USA) were added, and the mixture was gently mixed and allowed to stand at room temperature for 15 minutes. Then, the experimental group and control group solutions were combined and mixed with the two prepared Opti-MEM culture media, and incubated at room temperature for 5 minutes. After the incubation process is completed, the two mixtures are added to the above-mentioned cell samples, 100 microliters of the mixture / culture dish, and incubated at 37°C, 95% relative humidity and 5% carbon dioxide gas. The transfection time is controlled within 48 hours. Subsequently, according to the instructions for specific experimental materials and reagents, cell culture experimental steps, contents and conditions, oligonucleotide tag labeling antibody modification experimental steps, contents and conditions, target detection experimental steps, contents and conditions, etc. in Example 2, operations and sample processing are performed.

[0098] Then, according to the target detection experimental steps, contents and conditions in Example 2, the two groups of samples (control group and siMETTL3 group) of this example were detected respectively.

[0099] METTL3 (Methyltransferase 3, N6-Adenosine-Methyltransferase Complex Catalytic Subunit, Chinese name is methyltransferase 3, N6-adenosine methyltransferase complex catalytic subunit), the enzyme is involved in the post-transcriptional methylation of adenosine residues in eukaryotic mRNA (forming N6-methyladenosine). This example artificially reduced the expression of the METTL3 gene in the cell sample (siMETTL3 group) through the above-mentioned transfection experiment. Therefore, theoretically, the methylation level of mRNA in the cell will be reduced accordingly. For results, see Figure 4 The imaging results showed that compared with the control group, the number of corresponding signal bright spots generated by the same methylation site in the HeLa cell mRNA to be analyzed (GAPDH gene, Glyceraldehyde-3-phosphate dehydrogenase, Chinese name is glyceraldehyde-3-phosphate dehydrogenase) in the siMETTL3 group decreased. Figure 4 The histogram statistical results in also show that the number of fluorescent bright spots generated by the siMETTL3 group is significantly reduced (two-tailed unpaired T test, **** represents P < 0.0001), which is consistent with the above theoretical expectation, that is, after the METTL3 gene level in the cell is artificially reduced, the methylation level of the mRNA in the cell will be reduced accordingly, and the combination method provided by the present invention can detect the reduction of this methylation level. The above results show that the combination method provided by the present invention has good detection accuracy.

Claims

1. A method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes, characterized in that: The following steps are involved: 1) using at least two single-stranded DNA label probes to specifically recognize and bind to different binding sites, different binding positions or different biomolecules on the target biomacromolecule in the sample to be analyzed; 2) After the single-stranded DNA tag probe binds, it is hybridized with the same dumbbell-shaped DNA probe to form a stable ternary hybridization structure; 3) Through in situ ligation reaction, the dumbbell-shaped DNA probe forms a complete closed dumbbell structure as a template for rolling circle amplification, and one of the single-stranded DNA label probes is used as a primer for rolling circle replication to form a DNA nanoparticle structure; 4) The DNA nanoparticle structure is hybridized with a target-specific fluorescently labeled DNA probe to present a bright spot under a fluorescence microscope. The different fluorescent colors of the bright spot and the results of different rounds of imaging can realize in situ positioning and quantitative detection of multiple target biomacromolecules.

2. The method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes according to claim 1, characterized in that: The single-stranded DNA label probe in step 1) comprises a target-specific oligonucleotide fragment and / or a target-specific site binding molecule. Preferably, the target-specific site binding molecule directly or indirectly interacts with the target-specific site. Preferably, the target-specific site binding molecule comprises one or more of antibodies, antibody fragments, aptamers, oligonucleotides or small molecules.

3. The method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes according to claim 1, characterized in that: The sample to be analyzed in step 1) includes one or more of cultured cells or their lysates, frozen tissue sections or paraffin-embedded tissue sections; the target biomacromolecules include one or more of nucleic acids, chemically modified nucleic acids, proteins, protein crosslinks, protein complexes, polypeptides or proteoglycans.

4. The method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes according to claim 1, characterized in that: The dumbbell-shaped DNA probe in step 2) is formed by self-hybridization of a single-stranded DNA, including at least one closed single-stranded DNA loop and one single-stranded DNA loop with a gap, the two dumbbell loops are connected by a double-stranded DNA with complementary hybridization in the middle, and at least one of the sequences of the two dumbbell loops is target specific. Preferably, the sequence of the dumbbell-shaped DNA probe contains at least a sequence identical to that of a specific fluorescent-labeled probe.

5. The method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes according to claim 1, characterized in that: The steps of forming a DNA nanoparticle structure by rolling circle replication in step 3) are as follows: different target-specific single-stranded DNA tags mediate different corresponding dumbbell-shaped DNA probe ligation reactions and rolling circle amplification reactions, and each time the target-specific single-stranded DNA tag undergoes a copy of rolling circle amplification using the dumbbell-shaped DNA probe as a template, a single-stranded DNA sequence unit that is completely complementary to the dumbbell-shaped DNA probe sequence is added to the 3' end of its nucleic acid sequence. Finally, after multiple copies of the rolling circle amplification, the rolling circle amplification product forms a DNA nanoparticle structure under the promotion of specific reagents.

6. The method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes according to claim 5, characterized in that: The specific reagent includes a molecular crowding reagent. Preferably, the molecular crowding reagent includes one or more of polyethylene glycol, polyacrylic acid, polyvinyl alcohol, polyamino acid, dextran, cellulose, and dextran.

7. The method for in situ localization and quantitative detection of biological macromolecules in cells based on dumbbell-shaped DNA probes according to claim 1, characterized in that: In step 4), the target-specific fluorescently labeled probes are labeled with the same fluorescent group or with different fluorescent groups. Preferably, the fluorescent groups labeled with nucleic acids of the target-specific fluorescently labeled probes are one, multiple or more.

8. A complex based on a dumbbell-shaped DNA probe, characterized in that: The complex includes a dumbbell-shaped DNA probe, a single-stranded DNA label probe 1 and a single-stranded DNA label probe 2. The dumbbell-shaped DNA probe is formed by self-hybridization of a single-stranded DNA, and includes at least one closed single-stranded DNA ring and a single-stranded DNA ring with a gap. The two dumbbell rings are connected by a double-stranded DNA with complementary hybridization in the middle. A partial sequence of the single-stranded DNA label probe 1 is complementary to a portion of the single-stranded DNA ring with a gap, and a partial sequence of the single-stranded DNA label probe 2 is complementary to a portion of the closed single-stranded DNA ring.

9. The dumbbell-shaped DNA probe-based complex according to claim 8, characterized in that: The 5' end of the dumbbell-shaped DNA probe is phosphorylated and the 3' end has a hydroxyl group. The sequence of the single-stranded DNA label probe 1 is shown in SEQ ID NO.1, the sequence of the single-stranded DNA label probe 2 is shown in SEQ ID NO.2, the sequence of the dumbbell-shaped DNA probe is shown in SEQ ID NO.3, and the target-specific fluorescent labeled DNA probes are shown in SEQ ID NO.4 and SEQ ID NO.

5.

10. Use of the dumbbell-shaped DNA probe-based complex according to claim 8 or 9 in the localization and quantitative detection of methylation specific sites and methylation modifications of mRNA molecules in cells.

Images