Helicobacter pylori PCR-CRISPR fluorescence detection method for targeting 16S rRNA gene
Through the PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene, combined with the cascade reaction of PCR amplification and the CRISPR-Cas system, the problems of insufficient sensitivity and poor timeliness in the existing technology are solved, and high-sensitivity and rapid Helicobacter pylori detection are achieved, which is suitable for environments with limited resources.
Patent Information
- Application Number
- CN202510424455.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-06-06
AI Technical Summary
The existing Helicobacter pylori detection technology has problems such as insufficient sensitivity, poor timeliness and high equipment dependence, making it difficult to achieve rapid and accurate detection in resource-limited environments.
The PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene was adopted. The detection sensitivity was significantly improved through the cascade reaction of PCR amplification and the CRISPR-Cas system, and the detection was completed within 2 hours without the need for an expensive fluorescence quantifier.
It has achieved a significant improvement in detection sensitivity, with a detection limit of 1×10-6ng/μL, which shortens the detection time and is suitable for primary medical institutions, reduces the detection cost and operation threshold, and improves the specificity and repetition of the detection.
Smart Images

Figure CN120099152A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biological detection technology, and in particular to a Helicobacter pylori PCR-CRISPR fluorescence detection method targeting 16S rRNA gene. Background Art
[0002] Helicobacter pylori infection is one of the main causes of gastritis, peptic ulcers and even gastric cancer. In order to effectively treat and prevent this disease, a rapid and accurate detection method is urgently needed. Currently, the detection technologies on the market are mainly divided into several categories, each of which has its limitations.
[0003] First, although traditional detection methods such as culture and immunological testing can achieve rapid screening to a certain extent, these methods are either time-consuming (culture method requires 2 to 3 days) or have limited sensitivity and specificity (immunological testing has a sensitivity of 70% to 85% and a specificity of about 80% to 90%), and are easily interfered by cross-reactions. Immunological testing cannot effectively distinguish between current infection and past infection, which is a major limitation in clinical application.
[0004] Secondly, molecular biological detection methods, such as conventional PCR and real-time fluorescence quantitative PCR (qPCR), improve the sensitivity of detection by amplifying pathogen-specific genes (such as 16S rRNA, ureA, etc.), and the detection time can be shortened to several hours. Although qPCR can significantly improve the detection sensitivity, its detection limit can reach 1×10 -5 -1×10 -4 ng / μL, but because it relies on expensive fluorescence quantification instruments and cannot completely avoid false positives caused by nonspecific amplification, it affects its use in resource-limited environments. In addition, metagenomic sequencing (mNGS) technology can detect all microbial nucleic acids in samples without bias and has extremely high sensitivity, but there are challenges in equipment cost and data analysis complexity, making it difficult to widely promote in primary medical institutions.
[0005] Finally, the emerging CRISPR-Cas system has been gaining more and more attention in recent years because of its excellent specificity and signal amplification capabilities. However, when used alone, it usually requires a pre-amplification step, such as recombinase polymerase amplification (RPA) or isothermal amplification (LAMP), which increases the complexity and cost of the operation, and has not yet been effectively applied in Helicobacter pylori detection. Therefore, the development of a simpler, faster, more sensitive and cost-effective detection method is a technical challenge that needs to be solved urgently. Summary of the invention
[0006] In view of the above problems, the present invention aims to provide a Helicobacter pylori PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene. By targeting the Helicobacter pylori 16S rRNA gene and combining PCR amplification with the cascade reaction of the CRISPR-Cas system, the detection sensitivity is significantly improved, and no complex instruments are required, and the detection can be completed within 2 hours.
[0007] The technical solution of the present invention is as follows:
[0008] The present invention provides a PCR-CRISPR fluorescence detection method for Helicobacter pylori targeting the 16SrRNA gene, comprising the following steps: S1: extracting genomic DNA from gastric mucosal tissue, saliva or feces samples; S2: using the genomic DNA as a template, using a specific primer pair to perform PCR amplification to obtain a PCR amplification product, wherein the specific primer pair targets the 16SrRNA gene of Helicobacter pylori; S3: reacting the PCR amplification product with a CRISPR-Cas system, wherein the CRISPR-Cas system comprises a Cas protein, a crRNA targeting the 16SrRNA gene and a fluorescently labeled single-stranded DNA probe; S4: judging the presence of Helicobacter pylori by detecting the fluorescent signal.
[0009] Preferably, in step S1, the method for extracting genomic DNA adopts a genomic DNA extraction kit method, a magnetic bead method, an alkaline lysis method, a lysis solution method or a heating method.
[0010] Preferably, in step S2, the specific primer pair includes: a forward primer, whose sequence is shown in SEQ ID NO: 1: CTTGCTAGAGTGCTGATTA; a reverse primer, whose sequence is shown in SEQ ID NO: 2: TCCCACACTCTAGAATAGT; the final concentration of the forward primer is 0.2-1 μM, and the final concentration of the reverse primer is 0.2-1 μM.
[0011] Preferably, in step S2, the PCR amplification process is: an initial pre-denaturation stage is 95°C for 5 minutes to fully melt the genomic DNA template, followed by 38 cycles of amplification reaction, each cycle includes 95°C denaturation for 30 seconds, 55-60°C annealing for 30 seconds to allow specific primer pairs to specifically bind, and 72°C extension for 30 seconds to complete chain extension, and a thermostable DNA polymerase is used to ensure efficient amplification, and finally a final extension at 72°C for 5 minutes is performed to ensure the integrity of the amplified product.
[0012] Preferably, in step S3, the nucleotide sequence of the crRNA is as shown in SEQ ID NO: 3: UAAUUUCUACUAAGUGUAGAUAAAUGCAGUUCUAUGGUUAA; the crRNA targets a specific region of the Helicobacter pylori 16SrRNA gene.
[0013] Preferably, in step S3, the Cas protein uses Cas12a, Cas12b or Cas13a.
[0014] Preferably, in step S3, the fluorescently labeled single-stranded DNA probe sequence is Texas Red'-CCCCCC-BHQ2', wherein CCCCCC is a nucleotide portion, and the fluorescently labeled single-stranded DNA probe comprises a double label of fluorescein and a quencher; the fluorescein is carboxyfluorescein Texas Red, and the quencher is a dark quencher BHQ2.
[0015] Preferably, in step S3, the final concentrations of the components in the CRISPR-Cas reaction system are: Cas protein: 20-40 nM; crRNA: 20-40 nM; fluorescently labeled single-stranded DNA probe: 150-250 nM.
[0016] Preferably, in step S3, the CRISPR-Cas reaction system further contains NEB buffer, which includes components with the following mass concentrations: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , 100 μg / ml BSA, pH 7.9, and the solvent is water; the CRISPR-Cas reaction system is incubated at a temperature of 36 to 42°C.
[0017] The beneficial effects of the present invention are:
[0018] (1) The present invention significantly improves the detection sensitivity through cascade signal amplification of PCR and CRISPR-Cas system, and the detection limit reaches 1×10 -6 ng / μL, compared with traditional PCR (1×10 -4 -1×10 -3 ng / μL) and qPCR (1×10 -5 -1×10 -4 ng / μL) is reduced by 1-2 orders of magnitude, which can detect extremely low loads of Helicobacter pylori DNA and avoid the risk of missed detection.
[0019] (2) The present invention integrates PCR amplification and CRISPR detection into an integrated process, which only takes 2 hours from sample processing to result interpretation. Compared with traditional culture methods (taking 2 to 3 days) and conventional molecular testing (taking 4 to 6 hours), the detection cycle is greatly shortened, meeting the needs of clinical point-of-care testing (POCT).
[0020] (3) The present invention does not rely on qPCR instruments or sequencing platforms. The CRISPR reaction can be completed under constant temperature conditions. It is suitable for primary medical institutions and scenarios with limited resources, reducing detection costs and operating thresholds.
[0021] (4) The present invention effectively avoids cross-reaction with other intestinal flora (such as Escherichia coli and Salmonella) by designing specific primers and crRNA targeting the conservative region of the 16S rRNA gene. Experimental data show that the specificity is >99% and the repeatability RSD is <5%.
[0022] (5) The clinical application value of the present invention is significant. It can detect Helicobacter pylori infection at an early stage, guide timely intervention, and reduce the risk of gastric cancer. It can accurately evaluate the eradication effect through the change of DNA load before and after treatment to avoid overtreatment. Regular monitoring can quickly identify recurrent infection and realize dynamic management.
[0023] (6) The PCR-CRISPR combined system in the present invention can be adapted to a variety of pathogen detection scenarios and can be expanded to other bacteria and virus detection by replacing targeting primers and crRNA, and has broad application potential. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.
[0025] Figure 1 This is a flow chart of the method for PCR-CRISPR fluorescence detection of Helicobacter pylori targeting the 16SrRNA gene of the present invention.
[0026] Figure 2 Schematic diagram of the effect of different primer concentrations on PCR amplification efficiency.
[0027] Figure 3 This is a curve diagram showing the relationship between CRISPR-Cas reaction time and fluorescence signal intensity.
[0028] Figure 4 This is a graph showing the repeatability experimental results of the PCR-CRISPR detection system.
[0029] Figure 5 This is a graph showing the specificity experimental results of the PCR-CRISPR detection system.
[0030] Figure 6 This is a comparison chart of clinical test results and sequencing results of stool samples.
[0031] Figure 7 This is a comparison chart of the clinical test results and sequencing results of gastric mucosal samples.
[0032] Figure 8 This is a comparison chart of clinical test results and sequencing results of saliva samples. DETAILED DESCRIPTION
[0033] The present invention is further described below in conjunction with the accompanying drawings and examples, but it is not intended to limit the scope of the present invention, and is only illustrative. It should be noted that, in the absence of conflict, the embodiments in this application and the technical features in the embodiments can be combined with each other. It should be noted that, unless otherwise specified, all technical and scientific terms used in this application have the same meanings as those of ordinary skill in the art to which this application belongs. The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.
[0034] Example
[0035] A PCR-CRISPR fluorescence detection method for Helicobacter pylori targeting 16SrRNA gene, the method flow chart is as follows Figure 1 As shown, the following steps are included:
[0036] S1: Extract genomic DNA from gastric mucosal tissue, saliva or fecal samples; during the extraction process, the operating table is disinfected with ultraviolet light, nuclease-free consumables are used, and gloves and masks are worn throughout the process.
[0037] In step S1, the method for extracting genomic DNA adopts a genomic DNA extraction kit method.
[0038] Specifically, the steps for extracting saliva samples are as follows:
[0039] Avoid eating, drinking, smoking or chewing gum 30 minutes to 1 hour before collection to prevent food residues or beverage ingredients from contaminating the sample; rinse your mouth with clean water or saline to remove foreign matter in the mouth (such as toothpaste and mouthwash residues). Use a special saliva collector or sterile cotton swab to collect buccal mucosal exfoliated cells. Scrape vigorously 5 to 10 times to ensure sufficient cell volume. The collection volume must reach the scale line of the container (such as 3 to 5 ml of saliva). Too much foam or impurities will cause the DNA purity to decrease. Avoid touching the swab head with your hands during collection to prevent exogenous DNA from mixing in. If you use a container to spit saliva directly, you need to let it stand and remove the upper layer of foam before transferring it to reduce mucin interference; then use a DNA extraction kit to extract.
[0040] The steps for extracting gastric mucosal samples are as follows:
[0041] Strict aseptic operation is required when collecting gastric mucosal tissue to avoid contamination by exogenous microorganisms that may lead to DNA degradation. If DNA cannot be extracted in time after ex vivo, it should be fixed or frozen within 20 minutes to prevent endogenous nucleases (DNase) from degrading DNA. Use sterile instruments to gently scrape the mucosa, place it in a sterile EP tube, and then use a DNA extraction kit to extract it.
[0042] The steps for extracting a stool sample are as follows:
[0043] Use sterile tools to collect stool samples to avoid contamination by hands or environmental microorganisms; give priority to collecting the inner part of the middle section of stool to reduce interference from surface mucus and food residues; fresh stool must be frozen (-80°C is best) within 30 minutes after excretion if DNA extraction cannot be performed in time to avoid DNA degradation; collect 0.2-1g of stool and take 200-500μL of liquid samples, as excessive amounts may increase inhibitor residues, and then use a DNA extraction kit to extract.
[0044] S2: using genomic DNA extracted from gastric mucosal tissue, saliva or fecal samples as templates, and performing PCR amplification using specific primer pairs to obtain PCR amplification products, wherein the specific primer pairs target the 16SrRNA gene of Helicobacter pylori;
[0045] In step S2, the specific primer pair includes: a forward primer, the sequence of which is shown in SEQ ID NO:1: CTTGCTAGAGTGCTGATTA; a reverse primer, the sequence of which is shown in SEQ ID NO:2: TCCCACACTCTAGAATAGT; the final concentration of the forward primer is 0.2-1 μM, and the final concentration of the reverse primer is 0.2-1 μM. The PCR amplification process is: the initial pre-denaturation stage is 95°C for 5 minutes to fully melt the genomic DNA template, followed by 38 cycles of amplification reaction, each cycle includes 95°C denaturation for 30 seconds, 55-60°C annealing for 30 seconds to allow the specific primer pair to specifically bind, 72°C extension for 30 seconds to complete chain extension, and a thermostable DNA polymerase is used to ensure efficient amplification, and finally a final extension at 72°C for 5 minutes is performed to ensure the integrity of the amplified product.
[0046] S3: reacting the PCR amplification product with a CRISPR-Cas system, wherein the CRISPR-Cas system comprises a Cas protein, a crRNA targeting the 16SrRNA gene, and a fluorescently labeled single-stranded DNA probe;
[0047] In step S3, the nucleotide sequence of the crRNA is as shown in SEQ ID NO:3: UAAUUUCUACUAAGUGUAGAUAAAUGCAGUUCUAUGGUUAA; the crRNA targets the specific region of the 16SrRNA gene of Helicobacter pylori. The Cas protein uses Cas12a. The sequence of the fluorescently labeled single-stranded DNA probe is Texas Red'-CCCCCC-BHQ2', wherein CCCCCC is a nucleotide portion, and the fluorescently labeled single-stranded DNA probe comprises a double label of fluorescein and a quencher; the fluorescein is carboxyfluorescein Texas Red, and the quencher is a dark quencher BHQ2. The final concentrations of the components in the CRISPR-Cas reaction system are: Cas protein: 20-40nM; crRNA: 20-40nM; fluorescently labeled single-stranded DNA probe: 150-250nM. The CRISPR-Cas reaction system also contains NEB buffer, which includes the following components in mass concentrations: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 , 100 μg / ml BSA, pH 7.9, and the solvent is water; the CRISPR-Cas reaction system is incubated at 37° C. for 15 minutes to trigger the nuclease activity of the Cas protein.
[0048] S4: Use a fluorescent quantitative PCR instrument (ABI 7500) or a portable fluorescence detector to detect the presence of Helicobacter pylori by detecting the fluorescent signal.
[0049] 1. Detection parameters: Excitation / emission wavelength: Texas Red probe is set to excitation 585nm / emission 610nm;
[0050] 2. Signal acquisition frequency: collect fluorescence intensity once every 30 seconds to 1 minute (real-time monitoring mode) or once after the incubation is completed (end point detection mode).
[0051] 3. Threshold setting and result interpretation:
[0052] Negative control baseline: The average fluorescence intensity of three repeated experiments of negative control samples (such as sterile water or saliva of healthy people) without Helicobacter pylori DNA was taken as the baseline value (F 0 );
[0053] Positive judgment criteria:
[0054] Real-time monitoring: Fluorescence intensity exceeds baseline value + 3 times standard deviation (F 0 +3σ) was judged as positive (Ct value ≤ 35);
[0055] End point detection: Fluorescence intensity increase (ΔF = Fsample-F 0 )≥2 times the maximum value of the negative control was judged as positive.
[0056] 4. Result output and verification
[0057] Positive result: If the sample fluorescence signal reaches the threshold, combined with the Ct value, the presence of Helicobacter pylori is confirmed;
[0058] Negative result: The fluorescence signal does not reach the threshold and the negative control is normal, which is judged as non-infected;
[0059] Invalid result: If the positive control (known H. pylori DNA) does not trigger a signal or the negative control is abnormal, the experiment needs to be repeated.
[0060] Experimental example
[0061] Based on the extracted experimental samples, the following experiments were conducted:
[0062] 1. PCR primer optimization experiment:
[0063] Experimental steps:
[0064] 1. Primer concentration gradient setting:
[0065] A PCR system was prepared with a forward primer (SEQ ID NO: 1) and a reverse primer (SEQ ID NO: 2) at final concentrations of 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, and 1 μM.
[0066] 2. PCR amplification:
[0067] PCR amplification was performed: the initial pre-denaturation stage was 95°C for 5 minutes to fully melt the genomic DNA template, followed by 38 cycles of amplification reaction, each cycle including 95°C denaturation for 30 seconds, 55-60°C annealing for 30 seconds to allow specific primer pairs to specifically bind, and 72°C extension for 30 seconds to complete chain extension. A thermostable DNA polymerase was used to ensure efficient amplification, and finally a final extension at 72°C for 5 minutes was performed to ensure the integrity of the amplified product.
[0068] 3. Product testing:
[0069] The amplified products were detected by 1% agarose gel electrophoresis, and the CRISPR reaction was performed with a fluorescently labeled probe, and the fluorescence intensity (RFU) was recorded.
[0070] Conclusion: Figure 2 It can be seen that the products were amplified with primer concentrations of 0.2 to 1 μM, and the concentrations of the amplified products were detected. The primer concentrations of 0.2 to 1 μM can activate the CRISPR-Cas system.
[0071] 2. CRISPR reaction detection limit experiment:
[0072] Experimental steps:
[0073] 1. Preparation of standard products:
[0074] The genomic DNA of Helicobacter pylori standard strain (ATCC 43504) was diluted to 1×10 -3 ng / μL, 1×10 -4 ng / μL, 1×10 -5 ng / μL, 1×10 -6 ng / μL, 1×10 -7 ng / μL.
[0075] 2. Testing process:
[0076] PCR amplification and CRISPR reaction were performed with 3 replicates in each group, and the fluorescence value (RFU) was recorded at 120 min of reaction.
[0077] 3. Data processing:
[0078] The detection limit was determined using 3 times the background fluorescence value (negative control) as the threshold value. The detection data are shown in Table 1.
[0079] Table 1 Test data of CRISPR-Cas reaction time and fluorescence concentration
[0080]
[0081] in conclusion: Figure 3 is a curve diagram showing the relationship between CRISPR-Cas reaction time and fluorescence signal intensity. Figure 3 It can be seen that statistical analysis, 1×10 -6 ng / μL samples were statistically different from the blank control, P < 0.05; 1×10 -7 There was no statistical difference between the samples with a concentration of 1×10 ng / μL and the blank control, P>0.05. The PCR primers and crRNA designed in the present invention have good sensitivity and can detect 1×10 -6 ng / μL of samples were tested.
[0082] 3. CRISPR reaction stability experiment:
[0083] Experimental steps:
[0084] 1. Reaction conditions setting:
[0085] The reaction system was fixed and incubated at 37°C for 120 min.
[0086] 2. Repeatability test:
[0087] The experiment was repeated three times under the same conditions, and the fluorescence values (RFU) were recorded. The detection data are shown in Table 2.
[0088] Table 2 Repeatability experimental data of PCR-CRISPR detection system
[0089]
[0090] in conclusion: Figure 4 This is a diagram of the reproducible experimental results of the PCR-CRISPR detection system. Figure 4 It can be seen that the PCR-CRISPR system for detecting Helicobacter pylori designed in the present invention has good stability.
[0091] 4. Specificity experiment:
[0092] Experimental steps:
[0093] 1. Sample preparation:
[0094] The samples of control group: sterile water, saliva of healthy people, Escherichia coli (ATCC 25922), Streptococcus anginosus (ATCC 29292), Staphylococcus aureus (ATCC 25923) and Acinetobacter baumannii (ATCC 19606), and experimental sample: Helicobacter pylori (ATCC 43504) were collected.
[0095] 2. Testing process:
[0096] The detection was carried out according to the steps in the example, and the fluorescence value (RFU) within the reaction time of 120 min was recorded. The results are shown in Table 3.
[0097] Table 3 Comparison of detection reaction time and fluorescence value of different samples
[0098]
[0099] in conclusion: Figure 5 The specificity experimental results of the PCR-CRISPR detection system are shown in Figure 1. Sterile water, healthy human saliva, Escherichia coli, Streptococcus anginosus, Staphylococcus aureus, and Acinetobacter baumannii are used as control groups to test the specificity of the PCR-CRISPR detection system for Helicobacter pylori designed by the present invention. Figure 5 It can be seen that only the Helicobacter pylori sample produced a significant fluorescent signal (>3 times the background value) with a specificity of >99%. The PCR-CRISPR system designed in the present invention for detecting Helicobacter pylori has good specificity.
[0100] 5. Clinical stool sample testing experiment:
[0101] Sample collection:
[0102] Stool samples: Stool samples were collected from 5 patients with Helicobacter pylori infection confirmed by gastroscopy (No. 1 to 3 were positive, and No. 4 to 5 were negative).
[0103] Then, the detection is performed according to the detection steps in the embodiment.
[0104] in conclusion: Figure 6 This is a comparison chart of the clinical test results and sequencing results of stool samples. Figure 6 It can be seen that the PCR-CRISPR system can detect Helicobacter pylori in clinical stool samples. The fluorescence values of samples 1 to 3 are >10RFU, and those of samples 4 to 5 are <1RFU. Patients 1, 2, and 3 are positive, and those of patients 4 and 5 are negative, which is consistent with the sequencing results.
[0105] 6. Clinical gastric mucosal sample testing experiment:
[0106] Sample collection:
[0107] Gastric mucosal samples: 5 endoscopic biopsy samples were collected (No. 3 to 4 were positive, and No. 1 to 2 and No. 5 were negative).
[0108] Then, the detection is performed according to the detection steps in the embodiment.
[0109] in conclusion: Figure 7 This is a comparison chart of the clinical test results and sequencing results of gastric mucosal samples. Figure 7It can be seen that the PCR-CRISPR system can detect Helicobacter pylori in clinical gastric mucosal samples. The fluorescence values of samples 3 to 4 are >5RFU, and the other samples are <1RFU. Patients 3 and 4 are positive, and patients 1, 2, and 5 are negative, which is consistent with the sequencing results.
[0110] 7. Clinical saliva testing experiment:
[0111] Sample collection:
[0112] Saliva samples: 5 saliva samples were collected (No. 1-3, 4-5 were positive, and No. 2 was negative).
[0113] Then, the detection is performed according to the detection steps in the embodiment.
[0114] in conclusion: Figure 8 This is a comparison chart of clinical test results and sequencing results of saliva samples. Figure 8 It can be seen that the PCR-CRISPR system can detect Helicobacter pylori in clinical gastric mucosal samples. The fluorescence values of samples 1 to 3 and 5 are >10RFU, and those of sample 2 are <1RFU. Patients 1, 3, 4, and 5 are positive, and those of patient 2 are negative, which is consistent with the sequencing results.
[0115] In summary, the present invention successfully constructed an efficient and accurate Helicobacter pylori fluorescence detection system by integrating PCR amplification and CRISPR-Cas system detection technology, and its beneficial effects are significantly reflected in the following aspects:
[0116] 1. Breakthrough sensitivity: crRNA targeting the 16S rRNA gene is combined with highly specific primers and CRISPR-Cas cascade signal amplification to achieve 1×10 -6 The ultra-low detection limit of ng / μL is more than 100 times more sensitive than traditional PCR technology and can effectively identify early low-load infections.
[0117] 2. Rapid full-process testing: The entire process from sample processing (gastric mucosa, saliva, feces) to result interpretation takes only 2 hours, which is significantly shorter than the culture method (2 to 3 days) and conventional molecular testing (4 to 6 hours), meeting clinical instant testing needs.
[0118] 3. Excellent stability and specificity: Experimental data confirm that the primers and crRNA designed for the 16S rRNA gene of Helicobacter pylori have no cross-reaction to common intestinal flora such as Escherichia coli and Salmonella, and the repeatability error (RSD) is less than 5%, ensuring the reliability of the test results.
[0119] 4. Precise clinical management: It can detect asymptomatic infections and guide early intervention to reduce the risk of gastric cancer. It can evaluate the eradication effect of antibiotics through the dynamic changes of DNA load before and after treatment. Regular testing after treatment can quickly identify recurrent infections and optimize long-term management strategies.
[0120] The present invention deeply integrates the efficient amplification capability of PCR with the highly specific recognition advantage of CRISPR, solving the core pain points of traditional technologies such as insufficient sensitivity, poor timeliness and high equipment dependence, and provides an efficient and economical solution for the full-process precise prevention and control of Helicobacter pylori infection, which has significant clinical transformation value.
[0121] The above description is only a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as a preferred embodiment as above, it is not intended to limit the present invention. Any technician familiar with the profession can make some changes or modifications to equivalent embodiments of equivalent changes using the technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still falls within the scope of the technical solution of the present invention.
Claims
1. A PCR-CRISPR fluorescence detection method for Helicobacter pylori targeting 16S rRNA gene, characterized in that: The following steps are involved: S1: Extract genomic DNA from gastric mucosal tissue, saliva or stool samples; S2: using the genomic DNA as a template, performing PCR amplification using a specific primer pair to obtain a PCR amplification product, wherein the specific primer pair targets the 16S rRNA gene of Helicobacter pylori; S3: reacting the PCR amplification product with a CRISPR-Cas system, wherein the CRISPR-Cas system comprises a Cas protein, a crRNA targeting the 16S rRNA gene, and a fluorescently labeled single-stranded DNA probe; S4: Determine the presence of Helicobacter pylori by detecting the fluorescence signal.
2. The Helicobacter pylori PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene according to claim 1, characterized in that: In step S1, the method for extracting genomic DNA adopts a genomic DNA extraction kit method, a magnetic bead method, an alkaline lysis method, a lysis solution method or a heating method.
3. The Helicobacter pylori PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene according to claim 1, characterized in that: In step S2, the specific primer pair includes: Forward primer, the sequence is shown in SEQ ID NO: 1: CTTGCTAGAGTGCTGATTA; Reverse primer, the sequence is shown in SEQ ID NO: 2: TCCCACACTCTAGAATAGT; The final concentration of the forward primer is 0.2-1 μM, and the final concentration of the reverse primer is 0.2-1 μM.
4. The Helicobacter pylori PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene according to claim 3, characterized in that: In step S2, the PCR amplification process is as follows: the initial pre-denaturation stage is 95°C for 5 minutes to fully melt the genomic DNA template, followed by 38 cycles of amplification reaction, each cycle includes 95°C denaturation for 30 seconds, 55-60°C annealing for 30 seconds to allow specific primer pairs to specifically bind, 72°C extension for 30 seconds to complete chain extension, and a thermostable DNA polymerase is used to ensure efficient amplification, and finally a 72°C final extension is performed for 5 minutes to ensure the integrity of the amplified product.
5. The Helicobacter pylori PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene according to claim 1, characterized in that: In step S3, the nucleotide sequence of the crRNA is shown in SEQ ID NO: 3: UAAUUUCUACUAAGUGUAGAUAAAUGCAGUUCUAUGGUUAA; the crRNA targets a specific region of the Helicobacter pylori 16S rRNA gene.
6. The method for Helicobacter pylori PCR-CRISPR fluorescence detection targeting 16S rRNA gene according to claim 5, characterized in that: In step S3, the Cas protein uses Cas12a, Cas12b or Cas13a.
7. The PCR-CRISPR fluorescence detection method for Helicobacter pylori targeting 16S rRNA gene according to claim 6, characterized in that: In step S3, the sequence of the fluorescently labeled single-stranded DNA probe is Texas Red'-CCCCCC-BHQ2', wherein CCCCCC is a nucleotide portion, and the fluorescently labeled single-stranded DNA probe comprises a double label of fluorescein and a quencher; the fluorescein is carboxyfluorescein Texas Red, and the quencher is a dark quencher BHQ2.
8. The Helicobacter pylori PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene according to claim 7, characterized in that: In step S3, the final concentration of each component in the CRISPR-Cas reaction system is: Cas protein: 20-40nM; crRNA: 20-40nM; Fluorescently labeled single-stranded DNA probe: 150-250nM.
9. The Helicobacter pylori PCR-CRISPR fluorescence detection method targeting the 16S rRNA gene according to claim 8, characterized in that: In step S3, the CRISPR-Cas reaction system also contains NEB buffer, which includes components with the following mass concentrations: 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100μg / ml BSA, pH 7.9, and solvent is water; the CRISPR-Cas reaction system is incubated at a temperature of 36-42°C.