NR037661 for psoriasis diagnosis and application thereof

Abstract

The invention relates to NR037661 for psoriasis diagnosis and application of the NR037661, the nucleotide sequence of the NR037661 is shown as SEQ ID NO.1, the expression level of the NR037661 in skin lesion tissues of psoriasis is remarkably higher than that of normal skin, the AUC value of the NR037661 is 0.697 (95% CI: 0.584-0.810), and the relative expression value of the NR037661 in the skin tissues can be used as an effective parameter for psoriasis diagnosis, so that the NR037661 can be used as a psoriasis diagnosis marker and a treatment target, and can be applied to diagnosis of psoriasis. The compound can be applied to preparation of products for diagnosing psoriasis and preparation of drugs for preventing or treating psoriasis. The invention also provides the NR037661shRNA, and the NR037661shRNA can provide a basis for the development of drugs for inhibiting the expression of the NR037661.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to NR037661 for diagnosing psoriasis and an application thereof. Background Art

[0002] Psoriasis is a chronic, recurrent inflammatory skin disease that is immune-mediated and characterized by chronic inflammation and abnormal differentiation of epidermal keratinocytes, resulting in red plaques covered with silvery-white scales. Transcriptome analysis has found that approximately 3,500 protein-coding genes are differentially expressed in psoriasis lesions and normal human skin. However, sequencing of the human genome shows that there are only 20,000-25,000 protein-coding genes, accounting for less than 2% of the total genome sequence, and a considerable portion of the genes are transcribed into non-coding RNA.

[0003] lncRNA is a class of sequences with a length of more than 200 nucleotides and is one of the non-coding RNAs with the highest transcription level. Although the functions of many lncRNAs have not yet been determined, more and more functional studies have shown that they have important biological roles, such as transcriptional regulation, post-transcriptional regulation, chromatin remodeling, and cell cycle regulation.

[0004] At present, the diagnosis of psoriasis mainly uses ELISA, IHC, RP-HPLC and other methods to detect psoriasis-related target proteins, miRNAs, etc. in blood or skin. For example, patent CN112646876A discloses miRNAs for psoriasis diagnosis, and miRNAs are selected from at least one of miRNAhsa-let-7d-3p, hsamiR-134-5p, hsa-miR-485-5p, hsa-miR-941 and hsa-miR-1228-5p. CN106324259A discloses endogenous regulatory peptide prokineticin2 (PK2 for short) as a psoriasis biomarker. The research on digging out markers that can be used as psoriasis diagnosis from lncRNA is still immature.

[0005] Therefore, further exploration of psoriasis diagnostic markers is of great value for the early diagnosis, prevention and treatment of psoriasis patients. Summary of the invention

[0006] The purpose of the present invention is to provide a NR037661 biomarker for the diagnosis of psoriasis and its application.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] One of the technical solutions of the present invention is to provide the use of NR037661 as a biomarker in the preparation of a product for diagnosing psoriasis, wherein the nucleotide sequence of the NR037661 is shown in SEQ ID NO.1.

[0009] In some specific embodiments, the product is a product comprising quantitative detection of NR037661 at the gene level and quantitative detection of NR037661.

[0010] In some specific embodiments, the product is selected from any one or more of a reagent, a kit, a test paper, a chip, and a device.

[0011] In some specific embodiments, the product comprises amplification primers of NR037661, and the nucleotide sequences of the amplification primers are shown in SEQ ID NOs. 2 to 3.

[0012] In some specific embodiments, the sample tested by the product is skin tissue.

[0013] The second technical solution of the present invention is to provide a product for diagnosing psoriasis, which comprises an amplification primer that can specifically bind to NR037661, the nucleotide sequence of NR037661 is shown in SEQ ID NO.1, and the nucleotide sequence of the amplification primer is shown in SEQ ID NO.2-3.

[0014] The third technical solution of the present invention is to provide the use of NR037661 as a target in the preparation of drugs for preventing or treating psoriasis.

[0015] In some specific embodiments, the drug is a drug that reduces the expression level of NR037661.

[0016] In some embodiments, the drug comprises NR037661 shRNA.

[0017] In some specific embodiments, the NR037661 shRNA is selected from any one of the following a1) to a2):

[0018] a1) NR037661shRNA-1, the nucleotide sequence of the sense strand is shown in SEQ ID NO.6, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.7;

[0019] a2) NR037661shRNA-2, the nucleotide sequence of the positive strand is shown in SEQ ID NO.8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.9.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] (1) The expression level of NR037661 disclosed in the present invention in psoriasis lesion tissue is significantly higher than that in normal skin, with an AUC value of 0.697 (95% CI: 0.584-0.810). The relative expression value of NR037661 in skin tissue can be used as an effective parameter for the diagnosis of psoriasis. Therefore, NR037661 can be used as a diagnostic marker and treatment target for psoriasis. At the same time, products for detecting the expression level of NR037661 can also be used as psoriasis diagnostic products.

[0022] (2) To further explore the role and mechanism of long non-coding RNA in abnormal differentiation of keratinocytes and psoriasis, the present invention constructed a Ca 2+ An in vitro differentiation model of induced keratinocytes was developed, and NR037661 shRNA was provided, which could effectively inhibit the expression of NR037661, providing a basis for the development of drugs for the prevention or treatment of psoriasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The figure is a comparison of the expression levels of NR037661 in psoriasis lesion tissue and normal skin tissue in the examples of the present invention.

[0024] Figure 2 : This is the ROC curve of NR037661 used as a diagnostic marker for psoriasis in the examples of the present invention.

[0025] Figure 3 In the embodiment of the present invention, Ca 2+ Comparison of NR037661 expression levels in induced keratinocyte differentiation model and untreated cells.

[0026] Figure 4 It is the relative expression level of NR037661 in the cytoplasm and nucleus of keratinocytes in the examples of the present invention.

[0027] Figure 5 In the embodiment of the present invention, Ca 2+ Interference efficiency of NR037661 shRNA in the induced keratinocyte differentiation model.

[0028] Figure 6 In the embodiment of the present invention, NR037661 is interfered with Ca 2+ Effects of induced keratinocyte differentiation models.

[0029] Figure 7 This is the effect of interfering with NR037661 on keratinocyte apoptosis in the examples of the present invention. DETAILED DESCRIPTION

[0030] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.

[0031] In the following examples, unless otherwise specified, raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.

[0032] Example 1: NR037661 in psoriasis skin lesions, Ca 2+ Expression in an induced keratinocyte differentiation model

[0033] 1. Source of materials:

[0034] (1-1) A total of 42 psoriasis lesion tissues and 42 normal skin tissues were collected from the Department of Dermatology, Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine to explore the expression difference of NR037661 in the two groups of skin tissue samples.

[0035] The donors of skin lesion tissues underwent skin tissue pathological examination in the hospital to confirm psoriasis vulgaris, and other skin diseases such as systemic lupus erythematosus, atopic dermatitis, eczema, and neurodermatitis were excluded. No topical glucocorticoids, retinoic acid drugs, vitamin D3 derivatives, and calcineurin inhibitors were used on the affected skin in the past two weeks. The donors of normal skin tissues were excluded from skin diseases such as psoriasis, systemic lupus erythematosus, atopic dermatitis, eczema, and neurodermatitis. The collection of all experimental tissue samples was authorized by the Ethics Committee of Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine and agreed by the specimen donors.

[0036] (1-2)Ca 2+ Induced keratinocyte differentiation model: keratinocytes were extracted from fresh healthy normal skin tissue and cultured with 1.8 mM Ca 2+ Primary keratinocytes were stimulated to construct a keratinocyte differentiation model to simulate the keratinocyte differentiation in psoriasis skin tissue, in order to explore the expression changes of NR-037661 in keratinocyte differentiation, and further explore the role of NR-037661 in psoriasis.

[0037] The specific steps are as follows:

[0038] Epidermal stem cells, transiently amplified cells, and terminally differentiated cells were isolated from skin tissue samples of healthy pediatric donors by type IV collagen adhesion assay:

[0039] (1-2-1) Fat residues in skin tissue samples were removed, dispase (Roche, 2 U / mL) and phosphate buffered saline (PBS) were added, and the samples were treated at 37°C for 3 hours to separate the epidermis and dermis of the skin biopsy samples to obtain epidermal sheets.

[0040] (1-2-2) The epidermal sheet was treated with trypsin for 10 minutes to obtain a single cell suspension.

[0041] (1-2-3) Collect 10 6 cells as the total cell population, and 10 6 10 cells were inoculated on a type IV collagen-coated plate (BD Biosciences) in 4 mL EpiLife medium (catalog No. MEPI500CA, Gibco BRL, Grand Island, NY, USA) and incubated at room temperature for 7 min. A type of cell (RA cell) containing epidermal stem cells preferentially adhered to the type IV collagen-coated plate. After removing the supernatant (containing transiently amplified cells and terminally differentiated cells), the RA cells were washed three times with PBS to remove loosely attached cells. At this time, the cells adhered to the type IV collagen-coated plate were epidermal stem cells;

[0042] (1-2-4) Transfer the supernatant containing transiently expanded cells and terminally differentiated cells in (1-2-3) to a new type IV collagen-coated plate and incubate at room temperature for 14 days to allow the transiently expanded cell population to grow and remove the terminally differentiated cells that cannot proliferate.

[0043] (1-2-5) Transfer epidermal stem cells and transiently expanded cells into EpiLife medium and incubate at 37°C with 5% CO 2 The cells were cultured in a humidified incubator for 3-5 days. 5 mL of human keratinocyte growth factor supplement (catalog No. S0015, GIBCO) was added to 500 mL of EpiLife medium in proportion to obtain primary keratinocytes. CaCl was added to the EpiLife medium at a final concentration of 1.8 mM. 2+ , thereby inducing the differentiation of primary keratinocytes, and the keratinocyte differentiation model was completed. The keratinocytes used in the examples had all undergone less than 6 passages.

[0044] 2. Total RNA extraction from tissues and cells

[0045] (2-1) Preparation before the experiment: Prepare RNase-free grinding tubes, 1.5 mL EP tubes, 1000 μL Tips, 200 μL Tips, and 10 μL Tips.

[0046] Wear disposable masks and gloves, prepare the exogenous RNase remover dilution solution (1:100, v:v) with enzyme-free water in advance, soak the stainless steel beads, scissors and tweezers for half an hour and then dry them, wipe the laboratory table and pipette with 95% ethanol, and cool the low-temperature high-speed centrifuge to 4°C in advance.

[0047] (2-2) Take out the skin specimen from liquid nitrogen and put it into a grinding tube. Cut it into pieces as much as possible. Add 1 mL of Trizol lysis buffer and 2 stainless steel beads into the grinding tube and place it on ice.

[0048] (2-3) After cutting all the samples, place the grinding tube containing the tissue and stainless steel beads into the adapter of the tissue grinder, place them symmetrically, set the grinding frequency to 70 Hz, and the grinding time to 15 s. After 15 s, take out the sample and place it on ice to cool for a while. At the same time, observe whether it is fully ground. Grind it about 4-6 times until the liquid in the tube is clear and there is no large piece of tissue visible to the naked eye.

[0049] (2-4) Remove the stainless steel beads with tweezers and place the grinding tube containing the tissue or cells in Trizol lysis buffer in a low-temperature high-speed centrifuge. Centrifuge at 4°C and 12,000 g for 1 min to precipitate the debris. Transfer the supernatant to a new 1.5 mL enzyme-free EP tube.

[0050] (2-5) Add enzyme-free chloroform to the EP tube containing the tissue or cells of Trizol lysis buffer. Add 200 μL of chloroform to every 1 mL of Trizol lysis buffer. Shake up and down vigorously for 15 seconds. Let stand at room temperature for 10 minutes until the liquid separates into two layers. Place in a low-temperature high-speed centrifuge and centrifuge at 4°C and 12,000 g for 15 minutes.

[0051] (2-6) After centrifugation, take out the EP tube. You can see that the liquid in the tube is divided into three layers. The upper layer is colorless and transparent, which is RNA, the middle layer is white mist, which is protein, and the lower layer is red liquid, which is organic phase. Carefully aspirate the upper layer (about 400-500 μL) and transfer it to a new 1.5 mL enzyme-free EP tube and mark it.

[0052] (2-7) Add 500 μL of enzyme-free isopropanol to the EP tube in (2-6), mix by inversion, let stand at room temperature for 10 min, and centrifuge at 4°C and 12,000 g for 20 min.

[0053] (2-8) After centrifugation, discard the supernatant and add 1 mL of 75% ethanol (absolute ethanol: enzyme-free water = 3:1, v:v) to each tube for washing; and centrifuge at 4°C and 7500 g for 5 min.

[0054] (2-9) Carefully discard the supernatant. The precipitate in the EP tube is RNA. Invert the EP tube onto clean filter paper and let it dry until the white precipitate becomes transparent. Depending on the size of the RNA precipitate, add 10-30 μL of enzyme-free water to dissolve the RNA.

[0055] (2-10) Use Nanodrop2000 spectrophotometer to detect RNA concentration and OD 260 / 280 , and then conduct subsequent experiments, and finally store the RNA samples at -80℃.

[0056] 3. Reverse transcription to synthesize cDNA

[0057] This experiment uses the EvoM-MLV Mix Kit with gDNA Clean for qPCR (AG11728) kit from Hunan Aikerui Company and uses an Eppendorf PCR instrument for reaction. Wear a mask and disposable gloves before the experiment, prepare various specifications of enzyme-free Tip heads and corresponding pipettes, EP tubes, PCR tubes and enzyme-free water in advance, and wipe the experimental table and pipette with 95% ethanol.

[0058] The specific steps are as follows:

[0059] (3-1) Removal of genomic DNA: Reaction conditions: 42°C, 2 min; 4°C, hold;

[0060] (3-2) Reverse transcription reaction: Reaction conditions: 37°C, 15 min; 85°C, 5 s; 4°C, hold;

[0061] 4. Real-time PCR reaction

[0062] This experiment used the TB Green Premix Ex Taq II kit (Takara, Japan). GAPDH was used as the internal reference gene for calibration, and 2 -ΔΔCt The relative expression level of the target gene was determined by the method.

[0063] The target gene is NR037661, and its nucleotide sequence is shown in SEQ ID NO.1.

[0064] NR037661 (SEQ ID NO. 1):

[0065]

[0066] The primers involved are:

[0067] The amplification primers for NR037661 are shown in SEQ ID NOs. 2 to 3, and the amplification primers for GAPDH are shown in SEQ ID NOs. 6 to 7.

[0068] NR037661-F(SEQ ID NO.2):GGTGGACGGGCAGAATGTTATCG

[0069] NR037661-R(SEQ ID NO.3):TGGAGCAGGACTGGAGGCAAC

[0070] GAPDH-F(SEQ ID NO.4):GCATTGCCCTCAACGACCAC

[0071] GAPDH-R(SEQ ID NO.5):CCACCACCCTGTTGCTGTAG

[0072] The results showed that the expression level of NR037661 in psoriasis lesions was significantly higher than that in normal skin ( Figure 1 ), indicating that the increased expression of NR037661 leads to excessive differentiation of keratinocytes, resulting in parakeratosis and thickening of the stratum corneum, which in turn leads to psoriasis.

[0073] The relative expression value of NR037661 in skin tissue can serve as an effective parameter for the diagnosis of psoriasis, with an AUC value of 0.697 (95% CI: 0.584-0.810) ( Figure 2 ).

[0074] Compared with the untreated 2+ Compared with the treated control group (the horizontal axis is the "0" column), Ca 2+ The expression level of NR037661 in the induced keratinocyte differentiation model was significantly increased. Figure 3 , the prepared Ca 2+ The induced keratinocyte differentiation model can be used to study the effects of NR037661 on psoriasis.

[0075] Example 2: Localization study of NR037661 in keratinocytes

[0076] Merck nuclear isolation kit was used to separate the nucleus and cytoplasm of primary keratinocytes, and the expression of NR037661 in the cytoplasm, nucleus and total cells was detected by qRT-PCR.

[0077] The results showed that NR037661 was mainly distributed in the cell nucleus ( Figure 4 ).

[0078] Example 3: Verification of the interference effect of NR037661

[0079] NR037661 shRNA was produced by Shanghai Hanheng Company and used GenMute TM siRNA&DNA Transfection Reagent (Signagen) was transfected into primary keratinocytes and 1.8 mM Ca was added. 2+ Primary keratinocytes were stimulated and collected 48 hours after transfection. The expression level of NR037661 in keratinocytes transfected with NR037661 shRNA and its corresponding control was detected by qRT-PCR.

[0080] The results showed that compared with the control group, NR037661shRNA could significantly reduce the expression of NR037661 in keratinocytes ( Figure 5 ), indicating that NR037661shRNA can be used to allow cells that have been over-differentiated by NR037661 to differentiate normally, thereby alleviating or avoiding the occurrence of psoriasis.

[0081] NR037661 shRNA includes:

[0082] a1) NR037661shRNA-1, the nucleotide sequence of the sense strand is shown in SEQ ID NO.6, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.7;

[0083] a2) NR037661shRNA-2, the nucleotide sequence of the positive strand is shown in SEQ ID NO.8, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.9.

[0084] NR037661shRNA-1 positive strand (SEQ ID NO.6):

[0085] TCGAGGATTCTCTTGTGCTGATTTAACTCGAGTTAAATCAGCACAAGAGA ATCTTTTTTA

[0086] NR037661shRNA-1 antisense strand (SEQ ID NO.7):

[0087] AGCTTAAAAAAGATTCTCTTGTGCTGATTTAACTCGAGTTAAATCAGCAC AAGAGAATCC

[0088] NR037661shRNA-2 positive strand (SEQ ID NO.8):

[0089] TCGAGGGTGGACGGGCAGAATGTTATCTCGAGATAACATTCTGCCCGTCC ACCTTTTTTA

[0090] NR037661shRNA-2 antisense strand (SEQ ID NO.9):

[0091] AGCTTAAAAAAGGTGGACGGGCAGAATGTTATCTCGAGATAACATTCTG CCCGTCCACCC

[0092] Embodiment 4:

[0093] The same method as in Example 3 was used to transfect NR037661 shRNA into primary keratinocytes, and 1.8 mM Ca 2+ Primary keratinocytes were stimulated and the cells were collected 72 hours after transfection. The changes of involuvirin protein in the cells were detected by western blot.

[0094] The results showed that compared with the control group, NR037661shRNA could significantly reduce the Ca 2+ Induced expression of involuvirin in keratinocytes ( Figure 6 ), indicating that inhibiting the expression of NR037661 can reduce the excessive differentiation of keratinocytes, thereby alleviating or avoiding the occurrence of psoriasis.

[0095] Embodiment 5:

[0096] The same method as in Example 3 was used to transfect NR037661 shRNA into primary keratinocytes. 48 hours after transfection, the cells were collected and apoptosis was detected using FITC Annexin V and PI detection kit (BD, 556547).

[0097] The results showed that NR037661shRNA had no significant effect on the apoptosis of primary keratinocytes ( Figure 7 ).

[0098] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. The use of NR037661 as a biomarker in the preparation of a product for diagnosing psoriasis, characterized in that: The nucleotide sequence of NR037661 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The product includes a product for quantitatively detecting NR037661 at the gene level and a product for quantitatively detecting NR037661.

3. The use according to claim 1, characterized in that: The product is selected from any one or more of reagents, kits, test strips, chips and equipment.

4. The use according to claim 1, characterized in that: The product comprises amplification primers of NR037661, and the nucleotide sequences of the amplification primers are shown in SEQ ID NOs. 2-3.

5. The use according to claim 1, characterized in that: The sample tested by the product is skin tissue.

6. A product for diagnosing psoriasis, characterized in that: The product comprises an amplification primer capable of specifically binding to NR037661, the nucleotide sequence of the NR037661 is shown as SEQ ID NO.1, and the nucleotide sequence of the amplification primer is shown as SEQ ID NO.2-3.

7. Use of NR037661 as a target in the preparation of drugs for preventing or treating psoriasis.

8. The use according to claim 7, characterized in that: The drug is a drug that reduces the expression level of NR037661.

9. The use according to claim 7, characterized in that: The drug includes NR037661 shRNA.

10. The use according to claim 9, wherein the NR037661 shRNA is selected from any one of the following a1) to a2): a1) NR037661shRNA-1, the nucleotide sequence of the sense strand is shown in SEQ ID NO.6, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.7; a2) NR037661shRNA-2, the nucleotide sequence of the positive strand is shown in SEQ ID NO.9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO.8.

Images