Biomarker for diagnosing ventricular repolarization extension caused by cold exposure, kit and application

Abstract

The invention discloses a biomarker for diagnosing ventricular repolarization prolongation caused by cold exposure, a kit and application. The biomarker comprises one or more of the following applications: A1) application in preparation of a product for diagnosing ventricular repolarization prolongation caused by cold exposure; a2) application in preparation of a product for screening ventricular repolarization extension caused by cold exposure; a3) in preparation of a product for treating ventricular repolarization prolongation caused by cold exposure; a4) in preparation of a product for evaluating ventricular repolarization extension caused by cold exposure; a5) application in preparation of a product for distinguishing ventricular repolarization prolongation caused by cold exposure and other heart diseases; the miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence of the miRNA marker is as shown in SEQ ID No. 1. The expression quantity of the hsa-miR-125b-5p marker provided by the invention in plasma of a cold exposure induced ventricular repolarization extension group is remarkably increased compared with that of a control group, and the hsa-miR-125b-5p marker has good diagnosis efficiency on the cold exposure induced ventricular repolarization extension, so that the hsa-miR-125b-5p is a potential biomarker for the cold exposure induced ventricular repolarization extension.

Description

Technical Field

[0001] The present invention relates to a biomarker for diagnosing prolonged ventricular repolarization caused by cold exposure, and also relates to a corresponding kit and application, belonging to the technical field of medical molecular diagnosis. Background Art

[0002] In recent years, global attention to polar scientific expeditions and resource development has been increasing. However, the polar environment is complex and changeable, which can easily trigger stress responses in workers and have adverse effects on their physical and mental health. Among them, the threat to health from cold environments is particularly prominent. Working in low-temperature environments for a long time may cause frostbite and damage to the functions of multiple systems, and even endanger life in severe cases. Related studies have shown that long-term exposure to cold environments will increase the burden on the heart, cause damage to the cardiovascular system, and may induce acute cardiovascular events. Therefore, it is crucial to identify individuals with cardiovascular risks among people working in cold environments.

[0003] As one of the organs with extremely vigorous metabolic activities in the human body, the heart is extremely sensitive to ischemia and hypoxia, and is easily damaged in a cold environment. Previous studies have found that exposure to a cold environment prolongs the repolarization process of the heart. Small disturbances during ventricular repolarization are considered to be potential factors for malignant arrhythmias, which may lead to sudden cardiac death. Although we have recognized this risk, the specific mechanism by which cold exposure affects cardiac electrical activity is still unclear. During cold exposure, molecular homeostasis regulation of myocardial tissue and cells may play a key role. It should be made clear that cold exposure is a risk factor for prolonged ventricular repolarization.

[0004] The ventricular repolarization process refers to the process in which ventricular myocytes restore their resting potential after contraction (depolarization). This process corresponds to the T wave on the electrocardiogram. The QT interval is the time from the beginning of the QRS complex (ventricular depolarization) to the end of the T wave (completion of repolarization), which reflects the total duration of ventricular depolarization and repolarization. The standard for prolonged ventricular repolarization is: the QTc interval after correcting the heart rate (usually calculated using the Bazett formula). The normal range is ≤440ms for men and ≤460ms for women. Exceeding the above values ​​is prolonged. If it is significantly prolonged (for example, >500ms), the risk of arrhythmia will increase significantly. Prolonged ventricular repolarization can easily cause malignant arrhythmias, such as torsades de pointes, ventricular fibrillation, etc., leading to syncope or even sudden death.

[0005] Small noncoding RNA (miRNA) is a class of small RNA molecules produced in nature. They are partially complementary to mRNA and reduce gene expression mainly by inhibiting translation, mRNA splicing and deadenylation. With the rapid development of high-throughput sequencing technology, the number of miRNAs discovered has shown a sharp growth trend. MiRNAs regulate gene expression through complex regulatory networks. They can serve as biomarkers for a variety of diseases and are closely related to cardiovascular diseases. In terms of finding sensitive diagnostic markers, miRNAs have shown great potential, especially for hidden changes such as ventricular repolarization caused by cold exposure. Summary of the invention

[0006] The primary technical problem to be solved by the present invention is to provide an application of a miRNA marker. The biomarker can be used to prepare products for diagnosing prolonged ventricular repolarization associated with cold exposure, for screening people at risk of such ECG changes, as a target for treating abnormal ventricular repolarization caused by cold exposure, for evaluating the heart condition of people exposed to cold, and for distinguishing prolonged ventricular repolarization caused by cold exposure from other heart diseases.

[0007] Another technical problem to be solved by the present invention is to provide a kit for detecting miRNA markers. The kit can be used to diagnose prolonged ventricular repolarization caused by cold exposure, to screen people at risk of such ECG changes, as a target for treating abnormal ventricular repolarization caused by cold exposure, to assess the heart condition of people exposed to cold, and to differentiate prolonged ventricular repolarization caused by cold exposure from other heart diseases.

[0008] Another technical problem to be solved by the present invention is to provide a primer for detecting the above-mentioned miRNA marker.

[0009] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0010] According to a first aspect of an embodiment of the present invention, there is provided an application of a substance for detecting miRNA markers, including one or more of the following applications:

[0011] A1) Use in the preparation of products for diagnosing prolonged ventricular repolarization caused by cold exposure;

[0012] A2) Application in the preparation of products for screening for prolonged ventricular repolarization caused by cold exposure;

[0013] A3) Use in the preparation of products for treating prolonged ventricular repolarization caused by cold exposure;

[0014] A4) Application in the preparation of products for evaluating the prolongation of ventricular repolarization induced by cold exposure;

[0015] A5) Use in the preparation of products to differentiate prolonged ventricular repolarization induced by cold exposure from other cardiac diseases;

[0016] The miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown in SEQ ID No.1.

[0017] The "product" recorded above is a product for diagnosing prolonged ventricular repolarization caused by cold exposure by detecting the expression level of hsa-miR-125b-5p through reverse transcription PCR, real-time fluorescence quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

[0018] Preferably, the substance is a reagent for detecting the expression level of hsa-miR-125b-5p, or a reagent for specifically identifying hsa-miR-125b-5p, or a reagent for detecting the content of hsa-miR-125b-5p.

[0019] Preferably, the substance used to detect hsa-miR-125b-5p is the following a), b) or c)

[0020] a) Primers for detecting or specifically recognizing hsa-miR-125b-5p;

[0021] b) a reagent set containing the reagent described in a);

[0022] c) A kit containing a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0024] According to a second aspect of an embodiment of the present invention, a kit for detecting miRNA markers is provided, the kit comprising one or more of the following applications:

[0025] A1) Use in the preparation of products for diagnosing prolonged ventricular repolarization caused by cold exposure;

[0026] A2) Application in the preparation of products for screening for prolonged ventricular repolarization caused by cold exposure;

[0027] A3) Use in the preparation of products for treating prolonged ventricular repolarization caused by cold exposure;

[0028] A4) Application in the preparation of products for evaluating the prolongation of ventricular repolarization induced by cold exposure;

[0029] A5) Use in the preparation of products to differentiate prolonged ventricular repolarization induced by cold exposure from other cardiac diseases;

[0030] The miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying hsa-miR-125b-5p, or a reagent for detecting the expression level of hsa-miR-125b-5p.

[0031] The kit provided by the present invention can be used to detect the expression of the hsa-miR-125b-5p characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject, and then the probability of prolonged ventricular repolarization in the subject exposed to a cold environment can be determined based on the information of up-regulation or down-regulation of these gene expressions, thereby realizing the diagnosis, screening and disease assessment of prolonged ventricular repolarization caused by cold exposure.

[0032] The kits provided by the present invention may include appropriate packaging and instructions for use in the methods disclosed herein.

[0033] The kit provided by the present invention is a nucleic acid detection kit, including reagents required for RNA extraction and real-time fluorescence quantitative PCR. The kit may further include appropriate buffer and polymerase. This kit also includes control primers and / or probes.

[0034] Preferably, the reagent for detecting or specifically identifying hsa-miR-125b-5p is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0035] According to a third aspect of an embodiment of the present invention, a primer for detecting a miRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0036] A1) Use in the preparation of products for diagnosing prolonged ventricular repolarization caused by cold exposure;

[0037] A2) Application in the preparation of products for screening for prolonged ventricular repolarization caused by cold exposure;

[0038] A3) Use in the preparation of products for treating prolonged ventricular repolarization caused by cold exposure;

[0039] A4) Application in the preparation of products for evaluating the prolongation of ventricular repolarization induced by cold exposure;

[0040] A5) Use in the preparation of products to differentiate prolonged ventricular repolarization induced by cold exposure from other cardiac diseases;

[0041] The primers are primers for detecting the expression level of hsa-miR-125b-5p or specifically identifying hsa-miR-125b-5p.

[0042] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0043] Compared with the prior art, the present invention has the following technical effects:

[0044] (1) The hsa-miR-125b-5p provided by the present invention can be used as a potential biomarker for prolonged ventricular repolarization caused by cold exposure. In the clinical trial analysis, it was shown that the expression level of hsa-miR-125b-5p in the plasma samples of the group with prolonged ventricular repolarization caused by cold exposure was significantly higher than that of the control group. The ROC curve of the efficacy of hsa-miR-125b-5p in diagnosing prolonged ventricular repolarization caused by cold exposure showed that hsa-miR-125b-5p had excellent sensitivity and specificity, indicating that it had good diagnostic efficacy. The relationship between the heart rate-corrected QT interval (QTc) of the subjects and the expression level of hsa-miR-125b-5p in plasma showed that the QTc duration was positively correlated with the expression of hsa-miR-125b-5p, proving that the level of hsa-miR-125b-5p in plasma can reflect the severity of prolonged ventricular repolarization caused by cold exposure. Hsa-miR-125b-5p can be used for the diagnosis, screening and disease assessment of prolonged ventricular repolarization induced by cold exposure.

[0045] (2) In the animal experiment, a cold-exposed C57 mouse model was constructed, and C57 mice raised at room temperature were set as the control group. It was found that the expression level of plasma mmu-miR-125b-5p in cold-exposed mice was significantly higher than that in the control group. Reducing the level of mmu-miR-125b-5p can significantly improve the prolonged ventricular repolarization caused by exposure to a cold environment, which provides a cellular and molecular biological basis for hsa-miR-125b-5p as a biomarker for prolonged ventricular repolarization caused by cold exposure.

[0046] (3) Clinical data were used to construct a validation set to further confirm the relationship between hsa-miR-125b-5p and prolonged ventricular repolarization caused by cold exposure. At the same time, by comparing the expression level of hsa-miR-125b-5p with that of other cardiovascular diseases causing prolonged ventricular repolarization, it was distinguished from the prolonged ventricular repolarization caused by other cardiovascular diseases, confirming its diagnostic specificity for prolonged ventricular repolarization caused by cold exposure. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The volcano plot of the difference in miRNA expression in plasma between the cold exposure-induced prolonged ventricular repolarization group and the control group obtained by sequencing;

[0048] Figure 2This is a comparison of the hsa-miR-125b-5p content in the plasma of the cold exposure-induced prolonged ventricular repolarization group and the control group determined by qRT-PCR;

[0049] Figure 3 ROC curve for hsa-miR-125b-5p in diagnosing prolonged ventricular repolarization caused by cold exposure;

[0050] Figure 4 This is the relationship between the subjects' QTc and the expression of plasma hsa-miR-125b-5p;

[0051] Figure 5 This is a qRT-PCR validation diagram of knocking down hsa-miR-125b-5p by transfection with hsa-miR-125b-5p inhibitor;

[0052] Figure 6 This is a comparison of QTc levels in the cold exposure-induced ventricular repolarization prolongation group, the control group, and the hsa-miR-125b-5p knockdown group of mice;

[0053] Figure 7 For validation purposes, the qRT-PCR method was used to determine the plasma hsa-miR-125b-5p content in the cold exposure-induced ventricular repolarization prolongation group, the control group, and the other cardiovascular disease-induced ventricular repolarization prolongation group;

[0054] Figure 8 ROC curve of hsa-miR-125b-5p in diagnosing prolonged ventricular repolarization induced by cold exposure in the validation set. DETAILED DESCRIPTION

[0055] The technical contents of the present invention are described in detail below in conjunction with the accompanying drawings and specific embodiments. These embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art. In addition, any method and material similar or equivalent to the recorded content can be applied to the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0056] The present invention first uses 60 subjects who have been working in cold areas for a long time to diagnose and exclude other heart diseases. After venous blood sampling, the Human miRNA Array chip of Arraystar is used to compare and analyze the differences in serum miRNA expression profiles between subjects with and without ventricular repolarization prolongation, and the results are analyzed using R software to screen miRNAs with significant differences in expression (Fold Chang ≥ 2.0, P value < 0.05), and then qRT-PCR (real-time fluorescence quantitative PCR) is used to determine the content of the top 10 miRNAs in the miRNA chip results in the patient's plasma, and the first one with significant increase is selected for subsequent experiments. Then, the inventors constructed an animal model to verify the relationship between the expression level of hsa-miR-125b-5p and the prolongation of ventricular repolarization caused by cold exposure at the animal level. Finally, the clinical data validation set further confirmed that hsa-miR-125b-5p can be used as a biomarker for prolongation of ventricular repolarization caused by cold exposure.

[0057] In order to accurately express the degree of cold, the meteorological field has developed a "cold degree scale". Specifically, the temperature ranges from below -40℃ to 9.9℃, and the temperature is divided into eight levels from low to high: level one is "extreme cold", below -40℃; level two is "very cold", -30℃ to -39.9℃; level three is "severe cold", -20℃ to -29.9℃; level four is "great cold", -10℃ to -19.9℃; level five is "minor cold", -5℃ to -9.9℃; level six is ​​"light cold", 0℃ to -4.9℃; level seven is "slightly cold", 0℃ to 4.9℃; level eight is "cool", 5℃ to 9.9℃. In the context of the present invention, "cold" specifically refers to environmental conditions with a temperature below -19.9℃, that is, the upper limit of the temperature is level four "great cold".

[0058] Example 1 Screening and correlation study of miRNA markers for prolonged ventricular repolarization induced by cold exposure

[0059] 1. Clinical samples:

[0060] Venous blood was collected from 60 subjects aged 20-40 years old who had lived in Mohe area of ​​Heilongjiang Province (52-53°N, 8 months of winter, average minimum temperature in winter -23°C, historical minimum temperature -53°C) for more than 1 year, worked in outdoor cold environment for a long time, and were excluded from other heart diseases.

[0061] 2. RNA extraction and qRT-PCR:

[0062] Human peripheral blood was collected using EDTA anticoagulation blood collection tubes, centrifuged at 2500g for 15 minutes, and the upper plasma was taken to a 2ml sterile tube. Total RNA was extracted using the RNA extraction and separation kit (DP419). According to the instructions, 1ml of TRIZOL reagent and 200μL of chloroform were added to the plasma, oscillated for 20s, and allowed to stand at room temperature for 10min. Centrifuged at 13000rpm and 4℃ for 15min. Carefully aspirate the supernatant, add 800μL of isopropanol, gently mix by inverting, and let stand at -20℃ for 1h. Centrifuge at 13000rpm and 4℃ for 15min, and discard the supernatant. Then add 1ml of 75% ethanol, gently wash the precipitate, centrifuge at 13000rpm and 4℃ for 5min, remove the supernatant, blow dry, and add an appropriate amount of nuclease-free H 2 O, dissolve at 65℃ for 10 min to detect the OD value and concentration of RNA, and store at -80℃ for future use.

[0063] Using a reverse transcription kit (RR037A), 500 ng of RNA was reverse transcribed into cDNA. Referring to the instructions, a 20 μL reaction system was constructed as shown in Table 1. The reaction procedure was: 37°C for 45 min, 85°C for 5 min, and maintained at 4°C.

[0064]

[0065] The miRNAs primer sequences were designed, and the cDNA obtained by reverse transcription was diluted 1:10 and reacted using a high-specificity qPCR kit (RR820A). According to the instructions, a reaction system of 20 μL was constructed as shown in Table 2. The reaction procedure was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 5 s, annealing at 60°C for 30 s, and extension at 95°C for 15 s, repeated for 40 cycles. The relative levels of miRNAs were quantified using GAPDH protein and expressed as relative ratios.

[0066]

[0067] 3. miRNA sequencing analysis:

[0068] Total RNA was extracted from blood samples of the cold exposure-induced prolonged ventricular repolarization group and the control group and sent to Guangzhou Epigenetics for miRNA sequencing to screen miRNAs with significant differences in expression (Fold chang ≥ 2.0, P value < 0.05). Figure 1 shown. Figure 1 The volcano diagram of the difference in miRNA expression in the plasma of the cold exposure-induced prolonged ventricular repolarization group and the control group obtained by sequencing. As shown in Table 3, qRT-PCR was used to measure the content of the top 10 miRNAs in the patient's plasma, and the first one with a significant increase was selected for subsequent experiments.

[0069] 4. QTc test:

[0070] An electrocardiograph (ECG-2250, Nikon) was used to perform 12-lead electrocardiograms in the same quiet position, with an amplitude of 20 mm / mV and a rate of 50 mm / s. Electrocardiographic parameters were measured manually by a professional cardiologist using a vernier caliper and a magnifying glass. The QT interval was defined as the duration from the start of the QRS complex to the end of the T wave, measured from the best available QRS complex in lead V3. QTc was calculated using the Bazett formula.

[0071] 5. Definition and classification of prolonged ventricular repolarization:

[0072] Since all the subjects were male, QTc>450ms was defined as prolonged ventricular repolarization. All subjects were divided into a cold exposure-induced prolonged ventricular repolarization group and a control group.

[0073] 6. Statistical analysis:

[0074] Student's t-test and analysis of variance were used for normal variables, and the Mann Whitney U test and Kruskal Wallis test were used for non-normal variables. Statistical analysis was performed using R software (v 4.3.2) and GraphPad Prism software (v 8.01). Biological replicates were shown as single data points superimposed on the bar graph. P < 0.05 was considered significant. Correlation analysis was used to explore the potential relationship between variables, and Spearman correlation coefficient was used to evaluate data effects. The receiver operating characteristic (ROC) curve was used to determine the diagnostic efficacy of the markers for endpoint events.

[0075] 7. Analysis results:

[0076] like Figure 2 As shown, the hsa-miR-125b-5p content in the plasma of the subjects in the cold exposure-induced ventricular repolarization prolongation group was determined by qRT-PCR. The results showed that the hsa-miR-125b-5p content in the plasma of the subjects in the cold exposure-induced ventricular repolarization prolongation group was significantly higher than that in the plasma of the subjects in the control group, indicating that hsa-miR-125b-5p is a potential biomarker for cold exposure-induced ventricular repolarization prolongation.

[0077] Figure 3 Shown is the ROC curve of hsa-miR-125b-5p in diagnosing prolonged ventricular repolarization induced by cold exposure, which indicates that hsa-miR-125b-5p shows excellent sensitivity and specificity, as well as good diagnostic efficacy.

[0078] Figure 4Shown is the relationship between QTc and hsa-miR-125b-5p expression in cold-exposed subjects; Figure 4 It can be seen that QTc is positively correlated with hsa-miR-125b-5p expression. Since the influence of other heart diseases and other factors was excluded, only the relationship between the increase of hsa-miR-125b-5p caused by cold exposure and the markers of ventricular repolarization prolongation was considered. Therefore, the level of hsa-miR-125b-5p in plasma can reflect the degree of ventricular repolarization prolongation in cold exposure.

[0079] Example 2: Animal modeling to verify the expression of hsa-miR-125b-5p and the relationship between the delay of ventricular repolarization induced by cold exposure The relationship between the length

[0080] Hsa-miR-125b-5p is a human-derived miR-125b-5p. Due to the high conservation of miR-125b-5p among species, it is also expressed in mice (mmu-miR-125b-5p). Therefore, mouse modeling was used to further confirm the connection between miR-125b-5p and myocardial damage caused by cold exposure.

[0081] 1. Animal modeling:

[0082] 8-week-old C57 mice were provided by Beijing Sibeifu Biotechnology Co., Ltd. and divided into two groups. One group was placed in a temperature-controlled box in a simulated cold environment (-20°C, 6 hours / day), and the other group was raised at normal room temperature (21°C) as a control group. Two weeks later, the mice were euthanized by an overdose of pentobarbital, and blood samples and hearts were taken for subsequent analysis.

[0083] 2. QTc test:

[0084] The mouse QTc test uses the ECG / EMG acquisition and analysis system of Yuyan Instrument Company for data acquisition, and uses the supporting analysis software (LabScribe basic software and ECG dedicated analysis module) for data analysis. Anesthetize the mouse with an induction anesthetic concentration of 5% isoflurane and a maintenance concentration of 1%-2%. Use a mask to inhale oxygen at a flow rate of 700ml / min. Monitor the rectal temperature using a thermal sensor and a heat lamp to maintain the rectal temperature of the mouse at 37-38°C. The mouse is fixed in a supine position on the detection platform and the electrodes are installed to record the signal for 5-10 minutes to avoid interference from sound and electric waves. Data analysis Analyze the stable part of the collected signal (at least 1 minute of signal) to obtain significant P wave, QRS wave or T wave recording waves.

[0085] 3. Knockdown method of miRNA:

[0086] The mmu-miR-125b-5p inhibitor was ordered from Shanghai GeneCare Gene Medical Technology Co., Ltd. According to the instructions, transfection was performed by tail vein injection, and the effect was tested 24 hours after injection.

[0087] 4. Experimental results:

[0088] Figure 5 It was shown that after transfection with the mmu-miR-125b-5p inhibitor, the expression level of mmu-miR-125b-5p in mouse plasma was significantly reduced, indicating that the transfection was successful and subsequent experiments were completed on this basis.

[0089] Figure 6 The QTc of the control group, cold exposure group and mmu-miR-125b-5p knockdown group of mice showed that cold environment exposure can cause increased expression of mmu-miR-125b-5p, while QTc decreased significantly after knocking down mmu-miR-125b-5p. This may be the cellular molecular biological basis for miR-125b-5p as a biomarker for prolonged ventricular repolarization caused by cold exposure.

[0090] Example 3 Using clinical sample data validation set to further confirm the expression of hsa-miR-125b-5p and cold Relationship between exposure-induced prolonged ventricular repolarization

[0091] 1. Clinical samples:

[0092] During the clinical sample data collection process, 10 subjects with prolonged ventricular repolarization caused by cold exposure and 10 control subjects (diagnostic criteria refer to the above) were selected to form a validation set to verify the relationship between the expression of hsa-miR-125b-5p and prolonged ventricular repolarization caused by cold exposure. In addition, 15 patients with coronary heart disease, valvular heart disease and cardiomyopathy who met the diagnostic criteria for prolonged ventricular repolarization were selected as the control group to further analyze and compare the expression of hsa-miR-125b-5p in different disease states, so as to more accurately evaluate its specificity and potential application value in prolonged ventricular repolarization caused by cold exposure.

[0093] 2. Verify the result:

[0094] like Figure 7As shown, the qRT-PCR method (as described above) was used to determine the hsa-miR-125b-5p content in the subjects' plasma. The results confirmed that the hsa-miR-125b-5p content in the cold exposure-induced prolonged ventricular repolarization group was significantly higher than that in the control group, while the hsa-miR-125b-5p content in the coronary heart disease, valvular heart disease and cardiomyopathy groups was not significantly different from that in the control group, further confirming that hsa-miR-125b-5p is an effective biomarker for cold exposure-induced prolonged ventricular repolarization. Figure 8 As shown in the figure, the results of the ROC curve further confirmed that hsa-miR-125b-5p has a good diagnostic efficacy for prolonged ventricular repolarization induced by cold exposure.

[0095] The above implementation results show that hsa-miR-125b-5p is significantly associated with prolonged ventricular repolarization caused by cold exposure. QTc is positively correlated with the expression of hsa-miR-125b-5p; the ROC curve shows that hsa-miR-125b-5p has a good ability to diagnose prolonged ventricular repolarization caused by cold exposure. The expression of mmu-miR-125b-5p is upregulated in the animal model of cold exposure; the knockdown of mmu-miR-125b-5p in animals significantly reduces QTc. At the same time, the above conclusions were further confirmed using the clinical data validation set.

[0096] In summary, hsa-miR-125b-5p is expected to become a new biomarker and therapeutic target for prolonged ventricular repolarization induced by cold exposure.

[0097] Example 4 Sequences, primers and kit compositions of the present invention

[0098] The nucleotide sequence of the cold exposure-induced prolonged ventricular repolarization marker hsa-miR-125b-5p provided by the present invention is shown in SEQ ID No. 1, which is derived from the miRBase database and has a sequence number of MIMAT0000423.

[0099] SEQ ID No.1: TCCCTGAGACCCTAACTTGTGA

[0100] The primer pair for specifically recognizing hsa-miR-125b-5p provided by the present invention comprises an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3:

[0101] SEQ ID No.2: TCCCTGAGACCCTAACTTGTGA

[0102] SEQ ID No.3: GTGCAGGGTCCGAGGT

[0103] The composition of the kit provided by the present invention is:

[0104] Prime Script Buffer (5x), Prime Script Prime Script Reverse Transcription Mix I, Random 6mers, Nuclease-free H 2 O, SYBR Premix Ex Taq II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10 uM), ROX control dye (50x).

Claims

1. An application of a substance for detecting miRNA markers, characterized in that Includes one or more of the following applications: A1) Use in the preparation of products for diagnosing prolonged ventricular repolarization caused by cold exposure; A2) Application in the preparation of products for screening for prolonged ventricular repolarization caused by cold exposure; A3) Use in the preparation of products for treating prolonged ventricular repolarization caused by cold exposure; A4) Application in the preparation of products for evaluating the prolongation of ventricular repolarization induced by cold exposure; A5) Use in the preparation of products to differentiate prolonged ventricular repolarization induced by cold exposure from other heart diseases; Among them, the miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The product is a product for diagnosing prolonged ventricular repolarization caused by cold exposure by detecting the expression level of hsa-miR-125b-5p through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use according to claim 1, characterized in that: The substance is a reagent for detecting the expression level of hsa-miR-125b-5p, or a reagent for specifically identifying hsa-miR-125b-5p, or a reagent for detecting the content of hsa-miR-125b-5p.

4. The use according to claim 1, characterized in that The substance used to detect hsa-miR-125b-5p is the following a), b) or c) a) Primers for detecting or specifically recognizing hsa-miR-125b-5p; b) a reagent set containing the reagent described in a); c) A kit containing a) or b).

5. The use according to claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

6. A kit for detecting miRNA markers, characterized in that Includes one or more of the following applications: A1) Use in the preparation of products for diagnosing prolonged ventricular repolarization caused by cold exposure; A2) Application in the preparation of products for screening for prolonged ventricular repolarization induced by cold exposure; A3) Use in the preparation of products for treating prolonged ventricular repolarization caused by cold exposure; A4) Application in the preparation of products for evaluating the prolongation of ventricular repolarization induced by cold exposure; A5) Use in the preparation of products to differentiate prolonged ventricular repolarization induced by cold exposure from other cardiac diseases; Among them, the miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying hsa-miR-125b-5p, or a reagent for detecting the expression level of hsa-miR-125b-5p.

7. The kit according to claim 6, characterized in that: The reagent for detecting or specifically identifying hsa-miR-125b-5p is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

8. A primer for detecting miRNA markers, characterized in that Includes one or more of the following applications: A1) Use in the preparation of products for diagnosing prolonged ventricular repolarization caused by cold exposure; A2) Application in the preparation of products for screening for prolonged ventricular repolarization induced by cold exposure; A3) Use in the preparation of products for treating prolonged ventricular repolarization caused by cold exposure; A4) Application in the preparation of products for evaluating the prolongation of ventricular repolarization induced by cold exposure; A5) Use in the preparation of products to differentiate prolonged ventricular repolarization induced by cold exposure from other cardiac diseases; Among them, the primer is a primer for detecting the expression level of hsa-miR-125b-5p or specifically identifying hsa-miR-125b-5p, the miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown in SEQ ID No.

1.

9. The primer according to claim 8, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

Images