FGF2 gene molecular marker related to Muscovy duck breeding traits and application of FGF2 gene molecular marker
By analyzing the SNP molecular markers in the intronic region of the FGF2 gene, the problem of difficulty in accurately evaluating the breeding performance of the duck in the prior art is solved, and the accurate identification of the breeding traits of the duck is achieved, providing a scientific basis for breeding of the duck.
Patent Information
- Application Number
- CN202411988548.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2044-12-31
AI Technical Summary
The prior art is difficult to accurately evaluate the breeding performance of the Mustard duck, and its breeding traits cannot be accurately identified based on the hatching time alone.
By analyzing the intronic region of the FGF2 gene, a SNP molecular marker significantly related to the reproductive traits of the Muslim duck, specifically CM018622.1:g40203218C>A, provided a new molecular marker for identifying the reproductive traits of the Muslim duck.
This SNP molecular marker is significantly related to the birth age of the duck, and can accurately identify the breeding traits of the duck and provide scientific data for the breeding of the duck.
Smart Images

Figure CN120099180A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of biological detection, and in particular to a FGF2 gene molecular marker related to the reproductive traits of Muscovy ducks and an application thereof. Background Art
[0002] Muscovy ducks, also known as musk ducks or knob-headed ducks, originated from tropical areas of Central and South America and are now widely distributed in Jiangsu, Zhejiang, Shanghai, Anhui and Fujian in China. In these production areas, hatching eggs are usually carried out from January to May each year. According to the time sequence of ducklings hatching, they can be divided into three categories: "first batch", "second batch" and "last batch". Producers tend to select healthy and fast-growing individuals in the first batch and second batch as breeding ducks. However, it is difficult to accurately evaluate the pros and cons of their reproductive performance based solely on the hatching time as the basis for seed retention. The age of first laying is one of the key indicators for identifying the reproductive performance of Muscovy ducks. Single nucleotide polymorphism (SNP) is the most common form of genetic variation in the genome, which is caused by the difference of a single nucleotide. As molecular markers, SNPs are widely used in genetic diversity analysis, population genetic structure research and molecular mark-assist selection (MAS) because of their genetic stability and easy detection.
[0003] In the reproductive system, the FGF2 gene and its receptor play an important role in the development, maturation and ovulation of ovarian follicles. Studies have shown that FGF2 gene signaling has a regulatory effect on the proliferation and differentiation of ovarian granulosa cells, thereby affecting the development of follicles and the age of onset of laying. FGF2 also works together with other growth factors in the ovary, such as VEGF (vascular endothelial growth factor), to improve the nutrient supply and metabolism of ovarian tissue, which may affect the age of onset of laying. A SNP site of the FGF2 gene is significantly correlated with the reproductive performance of Muscovy ducks. Therefore, it is urgent to provide a new SNP molecular marker in combination with the reproductive performance indicators of Muscovy ducks. Summary of the invention
[0004] The purpose of the present invention is to provide a FGF2 gene molecular marker related to the reproductive traits of Muscovy ducks and its application, so as to solve the problems existing in the above-mentioned prior art. The molecular marker is significantly correlated with the age of first laying of Muscovy ducks, can accurately identify the reproductive traits of Muscovy ducks, and provide scientific data for the breeding of Muscovy ducks.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides a molecular marker related to the reproductive traits of Muscovy ducks. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. There is a C>A mutation at the 91st position of the sequence shown in SEQ ID NO.1, which is divided into three genotypes: CC, AA and CA.
[0007] The present invention also provides an application of the molecular marker in identifying the reproductive traits of Muscovy ducks and / or preparing a product for identifying the reproductive traits of Muscovy ducks.
[0008] The present invention also provides an application of the gene detection typing product of the molecular marker in identifying the reproductive traits of Muscovy ducks.
[0009] Optionally, the genotyping detection product is a primer set, which includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0010] Optionally, the genotyping detection product is a kit, and the kit includes the primer set.
[0011] Preferably, the reproductive trait is age at first laying.
[0012] The present invention also provides a method for identifying the reproductive traits of Muscovy ducks, comprising the following steps:
[0013] Extracting the genomic DNA of the Muscovy duck to be tested, and amplifying it using the primer set to obtain an amplified product;
[0014] Sequencing the amplified product to detect the genotype of the molecular marker;
[0015] According to the genotyping results, the reproductive traits of the tested Muscovy duck are determined.
[0016] Preferably, the molecular marker is significantly correlated with the age at first laying, and the age at first laying of CA genotype and AA genotype is significantly lower than that of CC genotype.
[0017] Preferably, the amplification system is: 2 μL of the genomic DNA of the Muscovy duck to be tested, 25 μL of 2×ES Taq MasterMix, 1 μL of the upstream primer, and 1 μL of the downstream primer.
[0018] Preferably, the amplification reaction procedure is: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 61.2°C for 30 s, extension at 72°C for 30 s, 33 cycles; final extension at 72°C for 2 min; and storage at 4°C.
[0019] The present invention discloses the following technical effects:
[0020] The present invention analyzes the FGF2 gene and finds that there is a molecular marker significantly correlated with the reproductive traits of Muscovy ducks in the intron region of the gene, and its nucleotide sequence is shown in SEQ ID NO.1, and there is a SNP site at the 91st nucleotide of the nucleotide sequence shown in SEQ ID NO.1, which is CM018622.1:g40203218C>A. The experimental results show that the SNP molecular marker is significantly correlated with the age of first laying of Muscovy ducks (P<0.05), and the age of first laying of CA genotype and AA genotype is significantly smaller than that of CC genotype (P<0.05). It can be seen that the present invention provides a new SNP molecular marker for MAS, which can accurately identify the reproductive traits of Muscovy ducks and provide scientific data for the breeding of Muscovy ducks. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0022] Figure 1 This is the SNP site information diagram for the intron region of the FGF2 gene. DETAILED DESCRIPTION
[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0024] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.
[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0028] Example 1
[0029] 1. Materials and Methods
[0030] 1.1 Animal samples
[0031] 484 female white Muscovy ducks aged 65 weeks were selected (Renma Breeding Duck Farm, Guangdong Wenshi Southern Poultry Breeding Co., Ltd.). 2 mL of subcutaneous venous blood was collected and stored at -80°C for DNA extraction. The family information of the selected group and the reproductive traits at the age of first laying were recorded.
[0032] 1.2 Main Reagents
[0033] Blood sample DNA extraction kit (brand: OMEGA; item number: D3392; Guangzhou Feiyang Bioengineering Co., Ltd.), 2×ES Taq Master Mix (Dye) (brand: Kangwei Century; item number: CW0690M; Kangwei Century Biotechnology Co., Ltd.), DNA marker (brand: Tsingke; item number: MD101; Jiangsu Novezan Biotechnology Co., Ltd.), high-purity low-electrosmotic agarose (brand: Qingke; item number: TSJ001; Beijing Qingke Biotechnology Co., Ltd.).
[0034] 1.3 Experimental methods
[0035] 1.3.1 Primer design
[0036] According to the sequence of the Mallard FGF2 gene published by Ensemble (ENSCMMG00000008411), primers were designed using the Primer-BLAST tool of NCBI (National Center for Biotechnology Information Search database), and primer synthesis services were provided by Guangzhou Qingke Biotechnology Co., Ltd. The relevant information of the primer sequences is shown in Table 1.
[0037] Table 1 PCR amplification primer sequences
[0038]
[0039] 1.3.2 Blood DNA extraction
[0040] Extract blood sample DNA according to the operating manual of the blood sample DNA extraction kit.
[0041] 1.3.3 PCR amplification of FGF2 gene intron sequences
[0042] The blood genomic DNA of the above 484 half-sibling Muscovy ducks (same father) was used as a template, and the following reaction system was followed: 2 μL template DNA, 25 μL 2×ES Taq Master Mix (Dye), 1 μL upstream primer, and 1 μL downstream primer.
[0043] Reaction procedure: 94°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 61.2°C annealing for 30 s, 72°C extension for 30 s, 33 cycles; 72°C final extension for 2 min; 4°C storage. PCR products were submitted to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing.
[0044] 1.3.4 SNPs identification and genotyping
[0045] Snapgene software was used to analyze the Sanger sequencing results of PCR products to determine potential SNP sites. The sequencing data of each sample was compared using the SeqMan tool of DNAstar 11 software for genotyping.
[0046] 1.3.5 Association analysis between genotype and reproductive traits
[0047] The association analysis between SNPs sites and reproductive trait data of individuals corresponding to genotypes was performed using SPSS26.0 software.
[0048] 2. Results
[0049] 2.1 PCR amplification and SNP screening of FGF2 gene intron sequences
[0050] 484 white Muscovy ducks were selected, and PCR amplification was performed using the blood sample DNA of each individual as a template. The obtained PCR product (nucleotide sequence is shown in SEQ ID NO.1) was subjected to Sanger sequencing. The peak graph after sequencing was compared and analyzed. A total of 1 SNP site was detected, which was CM018622.1:g40203218C>A, located at the 91st nucleotide of SEQ ID NO.1 (underlined in SEQ ID NO.1). The sequencing results are shown in Figure 1 shown.
[0051] SEQ ID NO.1:
[0052] ACAATCAGTCAGTCATCGTCGGGGGCTGCAAAGTGCTTTCCACAGGCAGACTGCACTCAAATCCTGTCTCCAGCTGCCGAGGGTGGTGCA C CCCATTTCCAAAGCAGGGGAATTCAGCACCTTATTGGCACCTGAGCCAAGAGCCTGAGCTCTCCTAGGAGGATCCACAGAAACCTCCGCATC.
[0053] 2.2 Association analysis between SNP sites in the intron sequence of FGF2 gene and reproductive traits
[0054] An association analysis was performed between the above-mentioned SNP locus and reproductive traits (age to first lay).
[0055] As shown in Table 2, the results showed that the CM018622.1:g40203218C>A locus was significantly correlated with the age of first laying (P<0.05). Among them, the age of first laying of AA, CA and CC genotypes was significantly different (P<0.05), and the age of first laying of CA and AA genotypes was significantly lower than that of CC genotype (P<0.05).
[0056] Table 2 Association between SNP loci and reproductive status
[0057]
[0058] Note: Superscript different letters (ab) indicate significant difference (P<0.05).
[0059] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A molecular marker related to the reproductive traits of Muscovy ducks, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a C>A mutation at the 91st position of the nucleotide sequence shown in SEQ ID NO.1, which is divided into three genotypes: CC, AA, and CA.
2. Use of the molecular marker as claimed in claim 1 in identifying the reproductive traits of Muscovy ducks and / or preparing products for identifying the reproductive traits of Muscovy ducks.
3. Use of the molecular marker gene detection typing product according to claim 1 in identifying the reproductive traits of Muscovy ducks.
4. The use according to claim 3, characterized in that The genotyping detection product is a primer set, which includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.
3.
5. The use according to claim 3, characterized in that The genotyping detection product is a kit, and the kit comprises the primer set described in claim 4.
6. The use according to any one of claims 2 to 5, characterized in that: The reproductive trait is age at first laying.
7. A method for identifying the reproductive traits of Muscovy ducks, characterized in that: The following steps are involved: Extracting the genomic DNA of the Muscovy duck to be tested, and amplifying it using the primer set described in claim 4 to obtain an amplified product; Sequencing the amplified product to detect the genotype of the molecular marker according to claim 1; According to the genotyping results, the reproductive traits of the tested Muscovy duck are determined.
8. The method according to claim 7, characterized in that The molecular markers were significantly correlated with the age at first spawning, and the age at first spawning of CA genotype and AA genotype was significantly lower than that of CC genotype.
9. The method according to claim 7, characterized in that The amplification system is as follows: 2 μL of the genomic DNA of the Muscovy duck to be tested, 25 μL of 2×ES Taq Master Mix, 1 μL of the upstream primer, and 1 μL of the downstream primer.
10. The method according to claim 7, characterized in that The amplification reaction procedure is: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 61.2°C for 30 s, extension at 72°C for 30 s, 33 cycles; final extension at 72°C for 2 min; and storage at 4°C.
Citation Information
Patent Citations
Cairina moschata laying-related SNP (single nucleotide polymorphism) site and application thereof
CN105969887A
Molecular marker related to breeding traits of muscovy ducks and application
CN113430285A
RALGAPA1 gene SNP molecular marker related to laying traits of Muscovy ducks and application of RALGAPA1 gene SNP molecular marker
CN114134238A
Molecular marker related to breeding traits of Muscovy ducks and application of molecular marker
CN115992248A
Trait selection in avians
US20200100480A1