Molecular markers of the FGF2 gene associated with reproductive traits in Muscovy ducks and their applications
By detecting the SNP site CM018622.1:g40203218C>A of the Muscovy duck FGF2 gene, a molecular marker for the FGF2 gene was provided, which solved the problem of difficulty in assessing the reproductive performance of Muscovy ducks in the existing technology, realized the accurate identification of the age at which Muscovy ducks begin laying eggs, and improved the scientific nature of breeding.
Patent Information
- Application Number
- CN202411988548.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2044-12-31
AI Technical Summary
Existing technologies make it difficult to accurately assess the reproductive performance of Muscovy ducks through incubation time, leading to uncertainties in the breeding process.
A molecular marker for the FGF2 gene, which is associated with the reproductive traits of Muscovy ducks, is provided. The age at first laying of Muscovy ducks is identified by detecting the SNP site of the FGF2 gene (CM018622.1:g40203218C>A). Genotyping is performed using primer sets, and it is found that the age at first laying of the CA and AA genotypes is significantly shorter than that of the CC genotype.
This has enabled accurate identification of Muscovy duck reproductive traits, providing scientific data for Muscovy duck breeding and improving the precision of breeding.
Smart Images

Figure CN120099180B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and in particular to the molecular marker of the FGF2 gene related to the reproductive traits of Muscovy ducks and its application. Background Technology
[0002] Muscovy ducks, also known as musk ducks or tufted ducks, originated in the tropical regions of Central and South America and are now widely distributed in Jiangsu, Zhejiang, Shanghai, Anhui, and Fujian provinces of China. In these production areas, hatching eggs are typically incubated between January and May each year. Based on the hatching order, ducklings can be subdivided into three categories: "first hatch," "second hatch," and "last hatch." Producers tend to select well-developed and rapidly growing individuals from the first and second hatches as breeding ducks. However, relying solely on hatching time as a basis for breeding is insufficient to accurately assess reproductive performance. Age at first laying is one of the key indicators for evaluating the reproductive performance of Muscovy ducks. Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation in the genome, caused by differences in a single nucleotide. As molecular markers, SNPs are widely used in genetic diversity analysis, population genetic structure studies, and molecular marker-assisted selection (MAS) due to their genetic stability and ease of detection.
[0003] In the reproductive system, the FGF2 gene and its receptor play crucial roles in the development, maturation, and ovulation of ovarian follicles. Studies have shown that FGF2 gene signaling regulates the proliferation and differentiation of ovarian granulosa cells, thereby influencing follicle development and age at ovulation. FGF2 also works synergistically with other growth factors in the ovary, such as VEGF (vascular endothelial growth factor), to improve nutrient supply and metabolism in ovarian tissue, potentially impacting the age at ovulation. One SNP site in the FGF2 gene is significantly associated with reproductive performance in Muscovy ducks. Therefore, there is an urgent need to provide a novel SNP molecular marker that integrates with reproductive performance indicators of Muscovy ducks. Summary of the Invention
[0004] The purpose of this invention is to provide a molecular marker for the FGF2 gene related to the reproductive traits of Muscovy ducks and its application, so as to solve the problems existing in the prior art. This molecular marker is significantly correlated with the age at which Muscovy ducks begin laying eggs, and can accurately identify the reproductive traits of Muscovy ducks, providing scientific data for the breeding of Muscovy ducks.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a molecular marker associated with the reproductive traits of Muscovy ducks. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The sequence shown in SEQ ID NO.1 has a C>A mutation at position 91, and is divided into three genotypes: CC, AA, and CA.
[0007] The present invention also provides the application of the aforementioned molecular marker in identifying Muscovy duck reproductive traits and / or in preparing products for identifying Muscovy duck reproductive traits.
[0008] The present invention also provides an application of the aforementioned molecular marker gene detection and typing product in identifying reproductive traits of Muscovy ducks.
[0009] Optionally, the genotyping detection product is a primer set, which includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0010] Optionally, the genotyping detection product is a kit, and the kit includes the primer set.
[0011] Preferably, the reproductive trait is the age at first spawning.
[0012] This invention also provides a method for identifying reproductive traits of Muscovy ducks, comprising the following steps:
[0013] Genomic DNA of the Muscovy duck to be tested was extracted and amplified using the primer set described above to obtain the amplification product;
[0014] The amplification products were sequenced to detect the genotype of the molecular marker;
[0015] Based on the genotyping results, the reproductive traits of the Muscovy ducks to be tested were determined.
[0016] Preferably, the molecular marker is significantly correlated with age at labor, and the age at labor for CA and AA genotypes is significantly shorter than that for CC genotype.
[0017] Preferably, the amplification system is as follows: 2 μL of Muscovy duck genomic DNA to be tested, 25 μL of 2×ES Taq MasterMix, 1 μL of upstream primer, and 1 μL of downstream primer.
[0018] Preferably, the amplification reaction program is as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 61.2°C for 30 s, extension at 72°C for 30 s, 33 cycles; final extension at 72°C for 2 min; storage at 4°C.
[0019] The present invention discloses the following technical effects:
[0020] This invention, through analysis of the FGF2 gene, discovered a molecular marker in its intron region that is significantly associated with the reproductive traits of Muscovy ducks. The nucleotide sequence of this marker is shown in SEQ ID NO.1, and a SNP site, CM018622.1:g40203218C>A, exists at nucleotide position 91 of the sequence shown in SEQ ID NO.1. Experimental results show that this SNP molecular marker is significantly correlated with the age at first laying of eggs in Muscovy ducks (P<0.05), and the age at first laying of the CA and AA genotypes is significantly shorter than that of the CC genotype (P<0.05). Therefore, this invention provides a novel SNP molecular marker for Muscovy ducks (MAS), which can accurately identify the reproductive traits of Muscovy ducks and provide scientific data for their breeding. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 This is a diagram showing SNP sites in the intron region of the FGF2 gene. Detailed Implementation
[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0028] Example 1
[0029] 1. Materials and Methods
[0030] 1.1 Animal Samples
[0031] Forty-four 65-week-old female Muscovy ducks (Renma Breeding Farm, Guangdong Wens Southern Poultry Breeding Co., Ltd.) were selected. Two mL of subcutaneous venous blood was collected and stored at -80℃ for DNA extraction. Family information and reproductive traits at age of first egg production were recorded for the selected population.
[0032] 1.2 Main Reagents
[0033] Blood DNA Extraction Kit (Brand: OMEGA; Catalog No.: D3392; Guangzhou Feiyang Biotechnology Co., Ltd.), 2×ES Taq Master Mix (Dye) (Brand: Kangwei Century; Catalog No.: CW0690M; Kangwei Century Biotechnology Co., Ltd.), DNA Marker (Brand: Tsingke; Catalog No.: MD101; Jiangsu Novizan Biotechnology Co., Ltd.), High Purity Low Electroosmotic Agarose (Brand: Qingke; Catalog No.: TSJ001; Beijing Qingke Biotechnology Co., Ltd.)
[0034] 1.3 Experimental Methods
[0035] 1.3.1 Primer Design
[0036] Primers were designed using the Mallard FGF2 gene sequence (ENSCMMG00000008411) published by Ensemble, and primer synthesis services were provided by Guangzhou Qingke Biotechnology Co., Ltd. Primer sequence information is shown in Table 1.
[0037] Table 1. Primer sequences for PCR amplification
[0038]
[0039] 1.3.2 Blood Sample DNA Extraction
[0040] Extract DNA from blood samples according to the instructions of the blood sample DNA extraction kit.
[0041] 1.3.3 PCR amplification of FGF2 gene intron sequences
[0042] Using the genomic DNA from blood samples of the aforementioned 484 half-sib Muscovy ducks (same paternal parent) as templates, the following reaction system was followed: 2 μL template DNA, 25 μL 2×ES Taq Master Mix (Dye), 1 μL upstream primer, and 1 μL downstream primer.
[0043] Reaction program: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 61.2℃ annealing for 30 s, 72℃ extension for 30 s, 33 cycles; 72℃ final extension for 2 min; storage at 4℃. PCR products were sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing.
[0044] 1.3.4 SNP identification and genotyping
[0045] Sequence peak analysis of PCR products using Sanger sequencing software was performed to identify potential SNP sites. Genotyping was then performed by comparing the sequencing data of each sample using the SeqMan tool in DNAstar 11 software.
[0046] 1.3.5 Association analysis between genotype and reproductive traits
[0047] Reproductive trait data of SNP loci and corresponding individuals with genotypes were analyzed using SPSS 26.0 software.
[0048] 2. Results
[0049] 2.1 PCR amplification and SNP screening of FGF2 gene intron sequences
[0050] Forty-four Muscovy ducks were selected, and PCR amplification was performed using blood DNA samples from each individual as templates. The PCR products (nucleotide sequences shown in SEQ ID NO.1) were subjected to Sanger sequencing. The sequencing peaks were compared and analyzed, and one SNP site was detected: CM018622.1:g40203218C>A, located at nucleotide 91 of SEQ ID NO.1 (underlined in SEQ ID NO.1). The sequencing results are as follows: Figure 1 As shown.
[0051] SEQ ID NO.1:
[0052] ACAATCAGTCAGTCATCGTCGGGGGCTGCAAAGTGCTTTCCACAGGCAGACTGCACTCAAATCCTGTCTCCAGCTGCCGAGGGTGGTGCA C CCCATTTCCAAAGCAGGGGAATTCAGCACCTTATTGGCACCTGAGCCAAGAGCCTGAGCTCTCCTAGGAGGATCCACAGAAACCTCCGCATC.
[0053] 2.2 Association analysis of SNP sites in FGF2 gene intron sequences with reproductive traits
[0054] Association analysis was performed on the above-mentioned SNP locus and reproductive traits (age at first birth).
[0055] As shown in Table 2, the results indicated that the CM018622.1:g40203218C>A locus was significantly correlated with age at labor (P<0.05). Significant differences were found in age at labor among the AA, CA, and CC genotypes (P<0.05), with the CA and AA genotypes showing significantly shorter ages at labor than the CC genotype (P<0.05).
[0056] Table 2. Association between SNP loci and reproductive status
[0057]
[0058] Note: Different superscript letters (ab) indicate significant differences (P<0.05).
[0059] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A molecular marker associated with reproductive traits in Muscovy ducks, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, and there is a C > A mutation at the 91st position of the nucleotide sequence shown as SEQ ID NO. 1, which is divided into three genotypes of CC, AA and CA.
2. The use of the molecular marker genotyping product of claim 1 in identifying the reproductive traits of Muscovy ducks, characterized by, The reproductive trait is the age at first laying.
3. Use according to claim 2, wherein the compound is ###0002### The genotyping detection product is a primer set, and the primer set comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO. 2 and a downstream primer shown as SEQ ID NO.
3.
4. The use according to claim 2, wherein the compound is ###0002### The genotyping detection product is a kit, and the kit comprises the primer set in claim 3.
5. A method for identifying reproductive traits in Call Ducks, characterized by, The method comprises the following steps: extracting the genome DNA of the to-be-tested muscovy duck, amplifying by using the primer set in claim 3 to obtain an amplification product; sequencing the amplification product to detect the genotype of the molecular marker in claim 1; judging the reproductive trait of the to-be-tested muscovy duck according to the genotyping result; The reproductive trait is the age at first laying.
6. The method of claim 5, wherein, The molecular marker is significantly related to the age at first laying, and the age at first laying of the CA genotype and the AA genotype is significantly smaller than that of the CC genotype.
7. The method of claim 5, wherein, The amplification system of the amplification is: 2 μL of the genome DNA of the to-be-tested muscovy duck, 25 μL of 2x ES Taq Master Mix, 1 μL of the upstream primer and 1 μL of the downstream primer.
8. The method of claim 5, wherein, The reaction procedure of the amplification is: 94 ℃ pre-denaturation for 2 min; 94 ℃ denaturation for 30 s, 61.2 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 33 cycles; 72 ℃ final extension for 2 min; and 4 ℃ preservation.
Citation Information
Patent Citations
Cairina moschata laying-related SNP (single nucleotide polymorphism) site and application thereof
CN105969887A
RALGAPA1 gene SNP molecular marker related to laying traits of Muscovy ducks and application of RALGAPA1 gene SNP molecular marker
CN114134238A