Specific SNP (Single Nucleotide Polymorphism) molecular marker for identifying genetic sex of cobia and application of specific SNP molecular marker

Abstract

The invention provides a specific single nucleotide polymorphism (SNP) molecular marker for sex identification of cobia and application of the specific single nucleotide polymorphism (SNP) molecular marker. Based on whole genome high-throughput sequencing data of male and female cobia, after deep comparative analysis, the specific molecular marker related to the sex of cobia is screened for the first time, and the primer pair designed for the marker can be used independently or used in a combined mode and is high in flexibility. The method has relatively high judgment accuracy, so that the sex of cobia can be quickly and accurately identified, and the method has a very good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological identification, and in particular relates to a specific SNP molecular marker for genetic sex identification of cobia, and also relates to the application of the specific SNP molecular marker in genetic sex identification of cobia. Background Art

[0002] Cobia (Rachycentron canadum), also known as sea cobia, belongs to the order Perciformes, family Rachycentridae, and genus Rachycentron. In the order Perciformes, biological research related to this species is particularly important due to its unique classification status of "single family, single genus, single species". Cobia not only has a high feed conversion rate and extremely fast growth rate, but also has delicious meat and rich nutrition. Therefore, it has become the preferred species for large-scale deep-sea cage farming and is also an extremely important species of marine farmed fish in my country. In recent years, under the background of my country's promotion of the "Blue Granary" strategy, the cobia aquaculture industry has shown great development potential.

[0003] However, as a fish with different sexes, cobia has no significant difference in appearance between male and female individuals, and it is difficult to distinguish sex based on appearance alone. If its sex needs to be determined, it needs to be determined through anatomical means combined with morphological identification, which is time-consuming and laborious, and poses a challenge to sex identification during artificial breeding. Therefore, developing a fast and accurate sex identification method for cobia has important application value in promoting the development of its aquaculture industry. Summary of the invention

[0004] The first purpose of the present invention is to provide a specific SNP molecular marker for genetic sex identification of cobia, so as to solve the problem of low efficiency in sex identification of cobia in the prior art.

[0005] The second object of the present invention is to provide an application of a specific SNP molecular marker for genetic sex identification of cobia.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] A specific SNP molecular marker for genetic sex identification of cobia, wherein the specific SNP molecular marker is at least one of the following nucleotide sequence SNP sites:

[0008] The nucleotide sequence of the first site is shown in SEQ ID NO.1, and the SNP site is located at the 120th base at the 5' end of the sequence;

[0009] The nucleotide sequence of the second site is shown in SEQ ID NO.2, and the SNP site is located at the 232nd base at the 5' end of the sequence;

[0010] The nucleotide sequence of the third site is shown in SEQ ID NO.3, and the SNP site is located at the 117th base at the 5' end of the sequence;

[0011] The nucleotide sequence of the fourth site is shown in SEQ ID NO. 4, and the SNP site is located at the 190th base at the 5' end of the sequence.

[0012] Furthermore, the primer sequence for amplifying the first site is:

[0013] Upstream primer: 5′-TCAGTCAATCTTCAGTGCCTGT-3′;

[0014] Downstream primer: 5′-CTGGAGTGTGAGCTTCAGTTCA-3′.

[0015] Furthermore, the primer sequence for amplifying the second site is:

[0016] Upstream primer: 5′-TGGTACGGTGGTTACACAGAGG-3′;

[0017] Downstream primer: 5′-CCAACCCAGGAAACTGAGCCA-3′.

[0018] Furthermore, the primer sequence for amplifying the third site is:

[0019] Upstream primer: 5′-TCCTCAAGTCCAGAGACATCAC-3′;

[0020] Downstream primer: 5′-CACACTTAAAGCAGGAAGGC-3′.

[0021] Furthermore, the primer sequence for amplifying the fourth site is:

[0022] Upstream primer: 5′-TTCACTTCGGAGCTGGACAGAA-3′;

[0023] Downstream primer: 5′-TCTGAGGTCATGGGTCCAAGTC-3′.

[0024] An application of the above-mentioned specific SNP molecular marker in genetic sex identification of sergeant fish.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) The specific molecular markers related to the sex of cobia of the present invention and the primer pairs designed for the markers are used for the sex identification of cobia, which can realize the rapid and accurate identification of the sex of cobia.

[0027] (2) The sex identification method of the present invention has no specific requirements for the steps of DNA extraction, PCR amplification, gel electrophoresis detection, sequencing, etc. The experimental operation is simple, the detection cost is low, the damage to the fish body is small, and the results are efficient and accurate. The samples used for identification are not limited by the environment and the degree of individual gonadal development. It has strong practicality and wide promotion and application value.

[0028] (3) The primers of the present invention can be used for: identification or auxiliary identification of the genetic sex of cobia; auxiliary breeding of cobia; and preparation of products related to the above uses; and research on the mechanism of fish sex determination. The present invention can effectively reduce the breeding cost of cobia, and has important significance and application value for promoting the sustainable and healthy development of cobia aquaculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 These are the sequencing peak graphs of the first to fourth sites of the SNP molecular markers of male and female cobia: the genotypes of the first to fourth sites of female fish are G / G, C / C, C / C and G / G, respectively, and the genotypes of the first to fourth sites of male fish are A / G, C / T, C / T and G / T, respectively. DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with specific embodiments so that those skilled in the art can better understand and implement the technical solutions of the present invention.

[0031] The present invention is based on the whole genome high-throughput sequencing data of male and female sergeant cobia. After in-depth comparison and analysis, specific molecular markers related to the sex of sergeant cobia are screened out for the first time. The primer pairs designed for the above markers can achieve a detection accuracy of more than 90% whether used alone or in combination, and can realize rapid and accurate identification of the sex of sergeant cobia.

[0032] A specific SNP molecular marker for genetic sex identification of cobia, wherein the specific SNP molecular marker is at least one of the following nucleotide sequence SNP sites:

[0033] The nucleotide sequence of the first site is shown in SEQ ID NO.1, and the SNP site is located at the 120th base at the 5' end of the sequence;

[0034] TTTTGTTGTCTAGATCGTTTGGCTAAACTATAGGCTTGTTTACAGGCTCAGCGCAGCTTCTTAGTGATGGTTTTGTCAGTGGGTCTTCCTGAAAAACTAAAACATGATCCTGGAGTGGACTACTAT CAACTTCAGTCAATCTTCAGTGCCTGTAATCAAAAGTCGAAATCGTTCTGAATCTTATTCGGATGCTTGAGAGCAGCAAGTTGCAAAGACAGCATTGAGTCTTTCCTCTGTAAGTTGTAATCCCAC ACTTCACAAACAGCTGCTTATTTTCACATCCAGGCAAATGTTAGCTCTCTTTTTTGCCCTGTTTTTGGTCTCCGTTAAGTTCACCGGTGCTGTTTAGTGCCAAAAAGGTTACATGCAGTCAAATTT AGAGCTTCTTTACTGAAATTTTATATAAATTGTTCTCTAAGAGAGTCAAGAGTGAACACGAACAACCCATTAACAAAGTTGAGGGGAGCTAAGCAATGAACTGAAGCTCACACTCCAGGGATA(SEQ ID NO.1)

[0035] The nucleotide sequence of the second site is shown in SEQ ID NO.2, and the SNP site is located at the 232nd base at the 5' end of the sequence;

[0036] TTCATCAATCAGACCGTTATGGTACGGTGGTTACACAGAGGACACAGTGAGTAAAAGCCTATGAAAGCCTGCGTGCAAAACTTATACATTTTACAGTATGAACTGATTGCTACATTCTTGTTAAGGAGTCAAATACGCGCAACCATGCAACATTAGTAAAGGACACATTCTTTTCAGCGATTTGTCCAACCACATTTTCAGAGTGTGTCAAAACTCATAAGTCCTTTCTGATCAAAGGATTCCTGCTTCACGTGTCTTCTCTTCAGGAGACTCCGGTGAGGCTGCAGCAGTAATAATTGACCATCCAGACATTCTGCAGCGATTGCAGCCCAGTGGGTGCTGTTCCTCCCAACCCAGGAAACTGAGCCACAACAGTGAAATAAGTGAAATTAATAAATCTTTCTATTAAAATGACAGAGATGGCGATTTTCTTAGCTTTCATTTGTTCACACCAAGAATTTGAATTTTAGGCTGAGAGTGTATTTTCTTTCAACTAGGACA(SEQ ID NO.2)

[0037] The nucleotide sequence at the third site is shown in SEQ ID NO.3, and the SNP site is located at the 117th base from the 5' end of the sequence;

[0038] TTTATAAAGAAGAAACATTTCAATGACGCTTGAACATTGTTCCACCTGA

[0039] AGCAAAGATCTTAGTCCAGTGGAGTAATTGGTGAGTAGGAAGGGTTTCATC

[0040] TCCATTACTCAACAACTGCAGCAGTGTTAACATCTCCTCAAGTCCAGAGAC

[0041] ATCACTCATCATATTTGTCCTCAAAAAACCATTAGTGCTGTACAAGTCGGAG

[0042] ATTTACAGAGGCTCTGAAAAACATATTGTCTGAGTTGGAGCATATGGCGAAT

[0043] GCAGCCTGTCTGCAGCCCACACACTGGCCGCCGCTCTGTGGGCGTGTGGCT

[0044] GCCCAGGGGTCACTGGTTTCACATAGAACATATACAATTTCACATTGGGGGA

[0045] AAATATGGTAATAGGAGAAGAAAAACTGGACTTTCAATTGGAAATTCAAAA

[0046] GGACCCCTATAAAAAAAAAATAAATGGATATCAGATAGAAAAAAGTAAAATAAATAAATCCCACACTTAAAGCAGGAAGGCTATCACCATTG(SEQ ID NO.3)

[0047] The nucleotide sequence of the fourth site is shown in SEQ ID NO. 4, and the SNP site is located at the 190th base at the 5' end of the sequence;

[0048] AAAATAAATGTAATCTAAATTTAAGTTAACTTTAATCATCCTTTCACCTGCTGCCTTTATTTCACTTCGGAGCTGGACAGAAGATTTGAAATGTACAAAATCAAATGAGGAAATGTGCAATTTAACTTTTCAAATGGTGAATTTAGTTCATTATTAACCACAGTGAAAGAAAATGGGATGTGTCTGTTTTTAAGTTAATATTTAAAAGGCAGAAAAGTGTGTTACTCCACTCTCTATTTTGTCTGCCGCGG TGTTTTACATACCTTGCCCCGTGACCTGTCTACTGATAAGCGGAGACATCTTTATAGGTTAAATACAATCTACTGAGTTAAAAGGCCAATGTCCCGTTTTAAAAACAGTGCATTTTCATTGGCGGGGAACAATGAATATTTGATGTCCATGAGAATTGATGCAGGATATGAAGAGCCCCGGGGCTCCAGGGTCAGACTCTATTAGAAAAATCTGAGGTCATGGGTCCAAGTCATTTAACATGCAGCC (SEQ ID NO.4)

[0049] The primer sequence for amplifying the first site is:

[0050] Upstream primer (SEQ. 1): 5′-TCAGTCAATCTTCAGTGCCTGT-3′;

[0051] Downstream primer (SEQ. 2): 5'-CTGGAGTGTGAGCTTCAGTTCA-3'.

[0052] The primer sequence for amplifying the second site is:

[0053] Upstream primer (SEQ. 3): 5′-TGGTACGGTGGTTACACAGAGG-3′;

[0054] Downstream primer (SEQ. 4): 5'-CCAACCCAGGAAACTGAGCCA-3'.

[0055] The primer sequence for amplifying the third site is:

[0056] Upstream primer (SEQ. 5): 5′-TCCTCAAGTCCAGAGACATCAC-3′;

[0057] Downstream primer (SEQ. 6): 5'-CACACTTAAAGCAGGAAGGC-3'.

[0058] The primer sequence for amplifying the fourth site is:

[0059] Upstream primer (SEQ. 7): 5′-TTCACTTCGGAGCTGGACAGAA-3′;

[0060] Downstream primer (SEQ. 8): 5'-TCTGAGGTCATGGGTCCAAGTC-3'.

[0061] Example 1

[0062] A method for genetic sex identification of cobia comprises the following steps:

[0063] (1) Collection of adult cobia samples

[0064] The cobia breeding population was taken from Zhanjiang City, Guangdong Province. 29 adult cobias with a breeding time of more than 2 years were dissected and the gonadal tissue was removed to visually determine the gender. The gonadal tissue was then fixed in 4% paraformaldehyde and used for tissue sectioning and HE staining to verify the visual identification results. After identification, 18 were female and 11 were male.

[0065] The tail fin of each cobia was cut and stored in anhydrous ethanol at -20°C.

[0066] (2) DNA extraction from cobia

[0067] 30 mg of the cobia tail fin tissue samples preserved in step (1) were cut out respectively, and the samples were labeled with numbers, and genomic DNA was extracted using the conventional phenol-chloroform method.

[0068] (3) DNA testing

[0069] The genomic DNA sample obtained in step (2) was detected by 1% agarose gel electrophoresis, and the concentration and purity of the DNA were detected by ultra-micro nucleic acid protein analyzer.

[0070] (4) PCR amplification

[0071] Specific primers are used to perform PCR amplification on the genomic DNA that has passed the test in step (3). The PCR primers are shown in Table 1.

[0072] Table 1 PCR primer sequences

[0073]

[0074] The configuration of the PCR reaction system is as follows: the total volume of each labeled PCR reaction is 20 μL: it contains 10 μL of Taq Mix, 1 μL of each of the upstream and downstream primers (10 μmol / L) shown in Table 1, 30-50 ng of the cobia DNA extracted in step (2), and 8 μL of sterile water.

[0075] The PCR amplification program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and final extension at 72°C for 5 min.

[0076] The amplified product obtained after PCR is a sex-specific site with a SNP molecular marker, that is, a gene with a nucleotide sequence as shown in SEQ ID NO.1-4, which is G>C at the 120th, 232nd, 117th and 190th bases, respectively.

[0077] (5) Electrophoresis detection

[0078] Prepare 1% agarose gel, mix 1 μL 6× Loading buffer and 5 μL amplification product obtained in step (4), and then spot into the gel well, connect the electrophoresis tank and the electrophoresis instrument, and perform electrophoresis for 20 minutes at a voltage of 130 V. After the electrophoresis is completed, observe the DNA bands. If the DNA bands are bright and there is no obvious dragging phenomenon, it proves that the DNA purity is good.

[0079] (6) PCR product sequencing

[0080] The PCR amplification products with good detection results in step (5) are directly sequenced to analyze the genotype of the SNP site therein.

[0081] Experimental Results

[0082] The sequence information of the sequencing results is shown in SEQ ID No. 1-4. Figure 1 As shown, when the cobia is female, the four SNP markers are homozygous genotypes (G / G, C / C, C / C and G / G, respectively); when the cobia is male, the four SNP markers are heterozygous genotypes (A / G, C / T, C / T and G / T, respectively).

[0083] Example 2

[0084] A method for genetic sex identification of cobia comprises the following steps:

[0085] (1) Obtaining samples of juvenile cobia;

[0086] (2) 48 cobia fry were collected from a cultured population in Sanya, Hainan. According to the sample collection method in Example 1, gonadal tissue samples were collected from each fish, and their sex was identified by tissue sections. Among the 48 fry, 20 were female and 28 were male.

[0087] (3) Using the Marine Animal Tissue Genomic DNA Extraction Kit (DP324) from Tiangen Biochemical Technology (Beijing) Co., Ltd., DNA from the tail fin tissues of 48 cobia were extracted according to the experimental steps in the instructions. The PCR primers for each SNP site in Example 1 were used to perform PCR reaction and product sequencing on the cobia DNA extracted above.

[0088] Experimental Results

[0089] By comparing the sequencing results with the identification results of tissue sections, the results showed that the accuracy of sex identification of the four primer pairs in this population was 95.8%.

[0090] Example 3

[0091] A method for genetic sex identification of cobia comprises the following steps:

[0092] 52 juvenile cobia (16 females and 36 males) were collected from a breeding population in Fangchenggang, Guangxi. DNA extraction, PCR amplification and sequencing were carried out using the same technical scheme as in Example 2. By comparing the sequencing results with the identification results of tissue sections, the accuracy of sex identification of the four primer pairs in this population was 94.2%.

[0093] The results of sex identification of the breeding population in Examples 1-3 are shown in Table 2 below

[0094] Table 2. Comparison of sex identification results of three breeding groups

[0095]

[0096]

[0097] The above implementation examples have been described in detail the different implementation processes of the present invention, but the implementation methods of the present invention are not limited thereto. Ordinary technicians in the relevant technical field can achieve the purpose of the present invention based on the contents disclosed in the present invention. Any improvements and modifications based on the concept of the present invention fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A specific SNP molecular marker for genetic sex identification of cobia, characterized in that: The specific SNP molecular marker is at least one of the following nucleotide sequence SNP sites: The nucleotide sequence of the first site is shown in SEQ ID NO.1, and the SNP site is located at the 120th base at the 5' end of the sequence; The nucleotide sequence of the second site is shown in SEQ ID NO.2, and the SNP site is located at the 232nd base at the 5' end of the sequence; The nucleotide sequence of the third site is shown in SEQ ID NO.3, and the SNP site is located at the 117th base at the 5' end of the sequence; The nucleotide sequence of the fourth site is shown in SEQ ID NO. 4, and the SNP site is located at the 190th base at the 5' end of the sequence.

2. The specific SNP molecular marker for genetic sex identification of cobia according to claim 1, characterized in that: The primer sequence for amplifying the first site is: Upstream primer: 5′-TCAGTCAATCTTCAGTGCCTGT-3′; Downstream primer: 5′-CTGGAGTGTGAGCTTCAGTTCA-3′.

3. The specific SNP molecular marker for genetic sex identification of cobia according to claim 1, characterized in that: The primer sequence for amplifying the second site is: Upstream primer: 5′-TGGTACGGTGGTTACACAGAGG-3′; Downstream primer: 5′-CCAACCCAGGAAACTGAGCCA-3′.

4. The specific SNP molecular marker for genetic sex identification of cobia according to claim 1, characterized in that: The primer sequence for amplifying the third site is: Upstream primer: 5′-TCCTCAAGTCCAGAGACATCAC-3′; Downstream primer: 5′-CACACTTAAAGCAGGAAGGC-3′.

5. The specific SNP molecular marker for genetic sex identification of cobia according to claim 1, characterized in that: The primer sequence for amplifying the fourth site is: Upstream primer: 5′-TTCACTTCGGAGCTGGACAGAA-3′; Downstream primer: 5′-TCTGAGGTCATGGGTCCAAGTC-3′.

6. Use of the specific SNP molecular marker according to any one of claims 1 to 5 in genetic sex identification of cobia.

Images