SNP (Single Nucleotide Polymorphism) molecular marker located on pig chromosome 14 and related to left nipple number character and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker located on a pig chromosome 14 and related to a left nipple number character and application. The site of the SNP marker is the 92941574th nucleotide site on a chromosome 14 of an international pig reference genome version 11.1, and the basic group of the site is G or A. By optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the number of left nipples of pigs can be increased, the lactation ability of sows can be improved, the weaning survival rate of piglets can be increased, excellent breeding pigs with the characters can be bred, the progress of genetic improvement of the pigs can be accelerated, and the economic benefit of breeding of the breeding pigs can be effectively improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and specifically relates to a SNP molecular marker located on chromosome 14 of pigs and associated with the trait of left nipple number and an application thereof. Background Art

[0002] Reproductive traits are important economic traits and are closely related to the benefits of farming. The survival of piglets from birth to weaning has always been a key concern of the pig farming industry, because the survival rate of weaned piglets affects both the benefits of the enterprise and the health of the animals, and is an indicator of great economic significance. In recent years, although the litter size of pigs has increased year by year, some piglets still die within 5 days after birth due to failure to consume colostrum or insufficient colostrum intake. The survival of piglets after birth still faces huge challenges.

[0003] The number of pig nipples is one of the important reproductive traits and an important indicator for measuring the lactation and feeding ability of sows. It directly affects the feeding rate and growth and development of piglets, and indirectly affects the weaning survival rate of piglets, and is closely related to the breeding benefits. In the process of breeding pigs, farms will screen piglets within 1-2 days after birth, and usually eliminate individuals with less than 14 nipples, and select piglets with more nipples for breeding. In recent years, the reproductive performance of pigs has been continuously improved, and the litter size has increased year by year. However, the selection of nipple number has not kept up with the pace of litter size, resulting in many sows unable to provide piglets with sufficient lactation needs, increased internal fighting behavior of piglets, and decreased survival rate. Therefore, it is becoming increasingly important to explore the molecular mechanism of nipple number inheritance and strengthen its selection.

[0004] At present, many candidate genes and QTLs related to teat number have been identified using the candidate gene method and QTL mapping. Candidate genes include VRTN, SPRY4, FGF1 and CPVL. However, since the selection of candidate genes is somewhat random, they may be major effect genes or genes that indirectly affect the trait in a state of close linkage disequilibrium with the actual QTL, which brings certain risks to livestock breeding. In addition, the selection of candidate genes also has population heterogeneity; and the genetic distance span of QTL obtained by QTL mapping is very large, often including hundreds of genes, which greatly limits the application of QTL mapping method in the genetic improvement of important economic traits of livestock. Nowadays, genome-wide association study (GWAS) has gradually shown unique advantages in the genetic improvement of complex traits, such as increasing milk production in dairy cows. Compared with the candidate gene method and QTL mapping, GWAS can locate and identify new genes more accurately, and can be directly applied to the genetic improvement of livestock animals, breaking the bottleneck of molecular marker identification of important economic traits of pigs. Summary of the invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP molecular marker located on pig chromosome 14 and associated with the left nipple number trait.

[0006] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular marker.

[0007] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers, wherein the kit comprises the above-mentioned primer pair.

[0008] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.

[0009] A fifth object of the present invention is to provide a method for genetic improvement of pigs.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A SNP molecular marker located on chromosome 14 of pigs and associated with the left nipple number trait, the SNP site of which corresponds to the G>A mutation at position 92941574 on chromosome 14 of the reference sequence of the international pig reference genome version 11.1, and the polymorphism of the base at this site affects the left nipple number trait of pigs, wherein the average left nipple number of pigs with AA genotype is higher than that of pigs with AG and GG genotypes;

[0012] The pigs are large white pigs and their synthetic strains;

[0013] The pig is preferably a Danish Large White pig and its synthetic strain;

[0014] The nucleotide sequence of the SNP molecular marker is preferably as shown in SEQ ID NO: 1, wherein M in the sequence is G or A, resulting in a difference in the number of left nipples of pigs;

[0015] The SNP site of the SNP molecular marker is the nucleotide mutation G63-A63 at position 63 of the sequence annotation of SEQ ID NO: 1, named as: g.63G>A (corresponding to the 92941574th G>A mutation on chromosome 14 of the reference sequence of the international pig reference genome version 11.1);

[0016] A primer pair for detecting the above-mentioned SNP molecular marker comprises primer P001-F and primer P002-R, and the nucleotide sequence thereof is as follows:

[0017] P001-F: 5'-TCTCACTTTGGGCTTTGT-3';

[0018] P002-R: 5'-CCAGTAAGGCAATGAAGAA-3';

[0019] A kit for detecting the above-mentioned SNP molecular marker, comprising the above-mentioned primer pair;

[0020] Application of the SNP molecular marker, primer pair or kit in identifying traits related to the number of left nipples in pigs, screening pig breeds with a high number of left nipples, a high piglet feeding rate or a high piglet weaning survival rate, or genetic breeding of traits related to the number of left nipples in pigs;

[0021] The genetic breeding is preferably molecular marker-assisted breeding;

[0022] Application of the SNP molecular marker in gene editing;

[0023] The pigs are large white pigs and their synthetic strains;

[0024] The pig is preferably a Danish Large White pig and its synthetic strain;

[0025] A method for detecting traits related to the number of left nipples of pigs, comprising the following steps:

[0026] Detecting the above-mentioned SNP molecular marker on chromosome 14 of pigs, and judging the left nipple number-related traits of pigs according to whether the single nucleotide at the SNP site of the SNP molecular marker is G or A; wherein the average left nipple number of AA genotype pigs is higher than the average left nipple number of AG and GG genotype pigs;

[0027] A method for screening a pig breed with a large number of left nipples, a high piglet feeding rate or a high piglet weaning survival rate using the above SNP molecular markers comprises the following steps:

[0028] The above-mentioned SNP molecular markers on chromosome 14 of pigs were detected, and individuals with genotypes of AG and GG were eliminated according to the SNP sites of the SNP molecular markers, and individuals with genotypes of AA were retained; wherein, the average number of left nipples of pigs with genotype AA was higher than that of pigs with genotypes AG and GG;

[0029] The detection method comprises the following steps:

[0030] (1) Extracting genomic DNA from the pig to be tested;

[0031] (2) using the above primer pair or the primer pair in the above kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product;

[0032] (3) sequencing the PCR amplification product to obtain sequencing results;

[0033] (4) determining the genotype of the SNP molecular marker based on the sequencing results;

[0034] The pigs are large white pigs and their synthetic strains;

[0035] The pig is preferably a Danish Large White pig and its synthetic strain;

[0036] A method for genetic improvement of pigs, comprising the following steps:

[0037] Determine the loci of the SNP molecular markers of the sows in the sow core group, and make corresponding selections based on the molecular markers: select sow individuals with AA genotype at locus 92941574 on chromosome 14 of the international pig reference genome version 11.1 in the sow core group, and eliminate sow individuals with AG or GG genotype at the locus, so as to increase the frequency of allele A at the locus generation by generation, thereby increasing the number of left nipples of offspring pigs;

[0038] The pigs are large white pigs and their synthetic strains;

[0039] The pig is preferably a Danish Large White pig and its synthetic strain;

[0040] Compared with the prior art, the present invention has the following advantages and effects:

[0041] (1) The present invention studies and determines that the molecular marker that affects the left nipple number-related traits of pigs is located on the nucleotide sequence on chromosome 14 of the pig, verifies its effect on the left nipple number trait, and ultimately establishes an efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of increasing the left nipple number of breeding pigs, thereby improving the lactation ability of offspring pigs, improving the weaning survival rate of piglets, increasing the economic profit of the enterprise, and increasing the core competitiveness.

[0042] (2) The present invention provides a primer pair and a kit for detecting the above-mentioned SNP molecular marker. Through the primer pair and the kit, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select the left nipple number trait and accelerate the breeding process.

[0043] (3) The present invention can increase the dominant allele frequency from generation to generation by optimizing the dominant allele of the above-mentioned SNP molecular marker, increase the number of left nipples of breeding pigs, select excellent breeding pigs with more left nipples, accelerate the progress of pig genetic improvement, and thus effectively improve the economic benefits of breeding pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a Manhattan plot of the single-site genome-wide association study (GWAS) of the left nipple number trait on chromosome 14 of Danish Large White pigs using GCTA software; where: the x-axis represents the chromosome number of the pig; the y-axis represents -log10 P value.

[0045] Figure 2 This is a Manhattan plot of multi-locus genome-wide association analysis of the left nipple number trait on chromosome 14 of Danish Large White pigs using the FASTmrMLM model in the mrMLM software; where: the x-axis represents the chromosome number of the pig; the primary y-axis represents -log 10 P value, and the secondary y-axis represents the LOD value.

[0046] Figure 3 This is an analysis chart of the phenotypic differences in the number of left nipples in pigs with different genotypes. DETAILED DESCRIPTION

[0047] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0048] Example 1 Test subjects, phenotype determination and DNA sample collection

[0049] (1) Experimental animals

[0050] The experimental pig group used in this experiment is a core group of Danish Large White sows from a company in Shaanxi. A total of 560 Danish Large White sows from the core group were selected for this experiment, and the herd pedigree was recorded in detail. The experimental pigs were free to eat and drink water, and the entire feeding method and feeding conditions were always consistent, which was a conventional method.

[0051] (2) Phenotypic determination

[0052] The number of left nipples of 560 Danish Large White sows was measured manually on site. The number of left nipples in the present invention refers to the total number of nipples on the left side.

[0053] (3) Collection of pig tissue samples

[0054] To extract DNA, ear samples from the above 560 Danish Large White sows were collected and stored in a -80°C refrigerator for subsequent whole genome resequencing.

[0055] Example 2 Whole-genome resequencing and whole-genome association analysis

[0056] (1) Whole genome resequencing

[0057] The whole genome resequencing data of 560 Danish Large White pigs were completed by Shenzhen BGI Co., Ltd. The specific methods and steps are as follows:

[0058] ① The ear samples of 560 Danish Large White sows in Example 1 were sent to Shenzhen BGI Co., Ltd. for DNA extraction;

[0059] ② Library construction: DNA of qualified quality is randomly interrupted and fragmented; then the sequencing library is obtained through steps such as DNA fragment end repair, 3' end addition of ployA, sequencing adapter configuration, and PCR amplification;

[0060] ③On-machine sequencing: Whole genome resequencing was performed on BGI’s DNB SEQ-T7 platform, with an average sequencing depth of 15.6×, and raw sequencing data in the FASTQ format were obtained.

[0061] (2) Whole genome resequencing data analysis

[0062] ① Use Fastp software (version 0.20.1) to perform quality control on the raw sequencing data obtained in step (1), including deleting low-quality sequences, etc., to obtain the sequencing data after quality control, and the file format is FASTQ;

[0063] ② Use the BWA-mem module in the BWA software (version 0.7.15) to align the quality-controlled sequencing data to the Sscrofa11.1 pig reference genome to obtain the aligned SAM file;

[0064] ③Use the Germline module of Clara Parabricks software (version 4.0.1) to sort the aligned SAM files, mark repeated sequences, re-correct base quality values, perform variant detection, and perform variant quality control to obtain the final variant result VCF file, which contains 678,204 SNP variant sites.

[0065] (3) Single-locus genome-wide association study (GWAS) analysis

[0066] The GCTA software developed by Professor Jian Yang and others from the School of Life Sciences of Westlake University was selected for single-site GWAS analysis. Specifically, a univariate mixed linear model was used to perform GWAS between variant sites and traits. The univariate mixed linear model is as follows:

[0067] y=a+bx+g+e

[0068] Among them, y is the phenotype, a is the average term, b is the additive effect of the candidate SNP to be tested for association (fixed effect), x is the SNP genotype indicator variable coded as 0, 1 or 2, g is the polygenic effect (random effect), that is, the cumulative effect of all SNPs (captured by the GRM calculated using all SNPs), and e is the residual. For ease of calculation, the genetic variance var(g) is estimated based on the null model, that is, y = a + g + e, and then fixed when testing the association between each SNP and the trait.

[0069] The specific single-site genome-wide association (GWAS) analysis method is as follows:

[0070] ① Use PLINK2.0 to convert the VCF file containing the final mutation results obtained in step (2) into PLINK format (.fam, .bim, .bed);

[0071] ② Use GCTA software to convert the PLINK format file into GRM format as the genotype file, and extract the number of left nipples in the original phenotype file as the phenotype file; use GCTA software, select the --pca parameter, input the GRM format genotype file to calculate PCA and take the first three principal components, extract the sex and batch corresponding to the individual in the original record and the calculated first three principal components of PCA as the covariance file;

[0072] ③ Prepare the genotype, phenotype, and covariance files in the format required by the GCTA software, input them into the software, and obtain the significant site results; among them, the genome-level significant threshold is 0.05 divided by the total number of SNP sites, that is, the genome-level significant threshold is 0.05 / 678204, which is 7.37E-08; the chromosome-level significant threshold is 1 divided by the total number of SNP sites, that is, the chromosome-level significant threshold is 1 / 678204, which is 1.47E-06.

[0073] The results of single-site GWAS analysis are as follows Figure 1 As shown in the figure, it can be seen that there is a SNP site on chromosome 14 of the Danish Large White pig that significantly affects the number of left nipples, corresponding to the 92941574th G>A mutation on chromosome 14 of the reference sequence of the international pig reference genome version 11.1 (nucleotide g.63G>A at position 63 in SEQ ID NO: 1, named: g.63G>A) (p value is 5.02E-07).

[0074] (4) Multi-locus GWAS analysis

[0075] The FASTmrMLM model from the mrMLM software package developed by Professor Yuan-Ming Zhang of Huazhong Agricultural University was selected for multi-site GWAS analysis. The specific method is as follows:

[0076] ① Use PLINK2.0 to convert the VCF file containing the final mutation results obtained in step (2) into PLINK format (.fam, .bim, .bed) as a genotype file;

[0077] ② Extract the number of left nipples in the original phenotype file as the phenotype file, extract the gender and batch corresponding to the individual in the original record, and the first three principal components of PCA calculated by GCTA software as the covariance file;

[0078] ③ Prepare the genotype, phenotype, and covariance files in the format required by the software, input them into the software, and obtain the significant site results, where the significant threshold is the LOD value equal to 3.

[0079] The results of multi-locus GWAS analysis are as follows Figure 2 As shown in the figure, it can be seen that there is a SNP site on chromosome 14 of the Danish Large White pig that significantly affects the number of left nipples, corresponding to the 92941574th G>A mutation on chromosome 14 of the reference sequence of the international pig reference genome version 11.1 (the 63rd nucleotide g.63G>A in SEQ ID NO: 1, named: g.63G>A) (LOD value is 3.5906).

[0080] (5) Association analysis between different genotypes and left nipple number phenotype

[0081] Further combined with the above single-site GWAS and multi-site GWAS analysis results, the same mutation sites that significantly affect the left nipple number trait in both the single-site GWAS and multi-site GWAS analysis results were retained. The results showed that there was a mutation site g.63G>A on chromosome 14 that significantly affected the left nipple number trait, and this mutation site was given special attention. According to the analysis in Table 1, the SNP site g.63G>A was extremely significantly correlated with the left nipple number trait (P<0.001), indicating that the molecular marker corresponding to this SNP site significantly affects the left nipple number trait of pigs. Through the auxiliary selection of this SNP site in pigs, the number of left nipples in the population can be increased, thereby improving the piglet feeding rate and piglet weaning survival rate.

[0082] In addition, according to Table 1, the average number of left nipples of AA type is higher than that of AG and GG types, indicating that homozygous GG is the most disadvantageous to the number of left nipples. Figure 3 It was further learned that the homozygous AA and AG genotypes are significantly different, and the AA and GG genotypes are extremely different, which further shows that homozygous GG is the most disadvantageous for the number of left nipples. The number of left nipples is an important trait for measuring the reproductive performance of sows. A low number of left nipples means poor reproductive performance of sows, low piglet feeding rate and piglet weaning survival rate. Therefore, the reproductive performance of sows with the GG genotype is the worst. In the breeding process, it is necessary to eliminate GG and AG type breeding pigs and retain AA type breeding pigs to increase the frequency of allele A at this site from generation to generation. At present, the frequency of the dominant allele in this group is only 3.39%, indicating that there is significant room for genetic improvement.

[0083] Table 1 Correlation analysis between the molecular marker SNP site g.63G>A and the number of left nipples

[0084]

[0085]

[0086] Note: The results of left nipple number are expressed as mean ± standard deviation (SD).

[0087] Example 3 Amplification and sequencing of target DNA sequences

[0088] (1) Primer design

[0089] The DNA sequence of SEQ ID NO: 1 on chromosome 14 of pig was downloaded from the Ensembl website (http: / / asia.ensembl.org / index.html). Primers were designed using primer design software Primer Premier 6.0, and the primers were synthesized by entrusting Sangon Biotech (Shanghai) Co., Ltd. The DNA sequence of the designed primers is shown below:

[0090] P001-F: 5'-TCTCACTTTGGGCTTTGT-3' (SEQ ID NO: 2);

[0091] P002-R: 5'-CCAGTAAGGCAATGAAGAA-3' (SEQ ID NO: 3);

[0092] (2) PCR amplification

[0093] 1 μL DNA template, 3.4 μL double distilled water, 5 μL 2×TagPCR StanMix with Loading Dye, and 0.3 μL primers P001-F and P002-R were added to the 10 μL reaction system. The PCR reaction conditions were: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 64.5°C annealing for 30 s, 72°C extension for 45 s, 35 cycles, and finally 72°C extension for 5 min.

[0094] (3) DNA sequence determination

[0095] DNA sequence identification: It was carried out at Shenzhen BGI Genomics Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are as follows: TCTCACTTTGGGCTTTGTTCTTTTGCTACTTCCTTCAGATGGTAGGTTAAGTTGTTTAT TTG M(G or A)TTTCTGTTTGTTTGTTTCTTGAGCTAGGTCTGCATAAATTCCATCTAAA ACTGCTCTTGCCCTGTTCTATAGTTTTTGGGATAGTTTTTTTTTTTTTTTTTTTTTGGTCTC AAGTTATTTTTTGGTTTCCTTCTTTAATTTCTTCATTGCCTTACTGG (SEQ ID NO: 1)

[0096] Note: The M marked in the sequence table is the mutation site, which is displayed with an underline (the mutated base in brackets is the allele mutation), and the bold at the beginning and end of the sequence is the position of the designed primer sequence.

[0097] Example 4 Analysis of the effect of the SNP site g.63G>A of molecular markers

[0098] According to Table 1 and Figure 3 It can be seen that for the number of left nipples, the effect of the dominant allele type (AA) of the SNP locus g.63G>A significantly increased the number of left nipples by 0.52 per head on average compared with the GG type phenotype. The more nipples a sow has, the higher the uniformity of the piglets, the piglet feeding rate, and the weaning survival rate will be. This will greatly reduce the economic losses in breeding and create wealth for the company. Among the individuals marked by this SNP, by selecting the dominant allele (A) of this SNP in Danish Large White pigs, it is possible to ultimately improve the economic benefits of commercial pigs, thereby increasing the profits of the company.

[0099] The present invention detects the 63rd base mutation site in the SEQ ID NO: 1 sequence, and preliminarily performs an application of association analysis between its genotype and the left nipple number trait of pigs, thereby providing a new molecular marker for molecular marker-assisted selection of pigs.

[0100] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A SNP molecular marker located on chromosome 14 of pigs and associated with the left nipple number trait, characterized in that Its SNP site corresponds to the G>A mutation at position 92941574 on chromosome 14 of the reference sequence of the international pig reference genome version 11.

1. The polymorphism of the base at this site affects the number of left nipples in pigs. Among them, the average number of left nipples in pigs with AA genotype is higher than that in pigs with AG and GG genotypes.

2. The SNP molecular marker according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, wherein M in the sequence is G or A.

3. A primer pair for detecting the SNP molecular marker according to claim 1, characterized in that The primer pair comprises primer P001-F and primer P002-R, and the nucleotide sequences thereof are as follows: P001-F: 5'-TCTCACTTTGGGCTTTGT-3', P002-R: 5'-CCAGTAAGGCAATGAAGAA-3'.

4. A kit for detecting the SNP molecular marker according to claim 1, characterized in that The kit comprises the primer pair described in claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3 or the kit according to claim 4 in identifying traits related to the number of left nipples in pigs, screening pig breeds with a high number of left nipples, a high piglet feeding rate or a high piglet weaning survival rate, or genetic breeding of traits related to the number of left nipples in pigs.

6. Use of the SNP molecular marker described in claim 1 or 2 in gene editing.

7. A method for detecting the number of left nipples of pigs, characterized in that The following steps are included: Detect the SNP molecular marker described in claim 1 on chromosome 14 of pigs, and judge the related traits of the number of left nipples of pigs according to whether the single nucleotide at the SNP site of the SNP molecular marker is G or A; wherein the average number of left nipples of AA genotype pigs is higher than that of AG and GG genotype pigs.

8. A method for screening pig breeds with more left nipples, higher piglet feeding rate or higher piglet weaning survival rate using a SNP molecular marker on chromosome 14 associated with the left nipple number trait, characterized in that The following steps are included: Detect the SNP molecular marker described in claim 1 on chromosome 14 of pigs, eliminate individuals with genotypes AG and GG according to the SNP site of the SNP molecular marker, and retain individuals with genotype AA; wherein the average number of left nipples of pigs with AA genotype is higher than the average number of left nipples of pigs with AG and GG genotypes.

9. The method according to claim 8, characterized in that: The detection method comprises the following steps: (1) Extracting genomic DNA from the pig to be tested; (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product; (3) sequencing the PCR amplification product to obtain sequencing results; (4) Determine the genotype of the SNP molecular marker based on the sequencing results.

10. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the loci of the SNP molecular markers described in claim 1 of the breeding pigs in the breeding pig core group, and make corresponding selections based on the molecular markers: select breeding pig individuals with the AA genotype at locus 92941574 on chromosome 14 of the international pig reference genome version 11.1 from the breeding pig core group, and eliminate breeding pig individuals with the AG or GG genotype at this locus, so as to increase the frequency of the allele A at this locus from generation to generation, thereby increasing the number of left nipples of offspring pigs.

Images