Taqman-MGB probe real-time fluorescence quantitative PCR detection system, kit, method and application of Vibrio mimicus

Abstract

Taqman-MGB probe real-time fluorescence quantitative PCR detection system, kit, method and application of Vibrio mimics, the present invention uses three O antigen serotypes of Vibrio mimics wzy Using the gene as the target gene, Taqman primers and MGB probes specific for each serotype were designed and screened, and a real-time fluorescence PCR detection method was established. The detection system provided by the present invention can accurately, quickly and sensitively perform molecular biological detection on the three Vibrio mimics.

Description

Technical Field

[0001] The present invention belongs to the technical field of bacterial detection methods, and particularly relates to a Taqman-MGB probe real-time fluorescence quantitative PCR detection system, a kit, a method and an application of Vibrio mimics. Background Art

[0002] Vibrio mimics, named for its metabolic and genetic similarities to Vibrio cholerae, is widely distributed in aquatic environments and can cause gastroenteritis, diarrhea, and food poisoning in humans. It is a globally recognized pathogen that causes foodborne and waterborne diarrheal diseases.

[0003] Serological testing methods can effectively distinguish different pathogenic strains within a species / genus, and are of great significance for pathogen identification and epidemiological investigations. Currently, serological typing systems based on surface polysaccharide antigens have been established for most important pathogens, and these typing systems have been widely used in inspection and quarantine and disease prevention and control systems.

[0004] Bacterial surface polysaccharide antigens mainly include O polysaccharide (O antigen), common antigen (CA), extracellular polysaccharide antigen, spores, and capsular polysaccharide (K antigen). Based on the diversity of the above surface polysaccharide antigens, bacteria can be divided into different serotypes. The diversity of O antigens in different serotypes of the same bacterium is determined by the genetic diversity of genes encoding various enzymes that synthesize O antigens. These genes are often clustered at fixed sites on the genome and are called O antigen gene clusters. In previous studies, we found that the O antigen gene cluster of Vibrio mimics is located between the conserved genes gmhD and rjg on the genome, and the gene cluster information has been deciphered. This makes it possible to use molecular biological methods to target specific genes in the gene cluster to achieve molecular serological detection of Vibrio mimics.

[0005] The principle of TaqMan-MGB real-time fluorescence PCR (RT-PCR) is to mix a fluorescein-labeled Taqman probe with template DNA and perform a thermal cycle of high-temperature denaturation, low-temperature annealing, and thermophilic extension. Following the rules of the polymerase chain reaction, the Taqman probe, which is complementary to the template DNA, is cleaved, releasing the fluorescein into the reaction system and emitting fluorescence under specific light excitation. With increasing cycles, the amplified target gene fragment increases exponentially. By measuring the corresponding fluorescence signal intensity in real time and calculating the Ct value, the type and content of the sample can be characterized. The TaqMan-MGB probe is a new technology recently improved upon the TaqMan probe. It adds an MGB molecule to the 3' end of the probe, which increases the probe's annealing temperature (Tm), enabling it to discern a single-base difference. Perfect pairing results in a fluorescent signal; any single-base mismatch results in no signal.

[0006] Currently, several molecular biology-based detection technologies have been introduced, including recombinase polymerase amplification (Patent No. CN107227378A), real-time fluorescence PCR (Patent No. CN119570956A), droplet digital PCR (Patent No. CN110669857A), and biochips (Patent No. CN108841979A), for the specific detection of Vibrio mimics in food and aquatic products. These technologies generally offer high sensitivity and accuracy. However, none of these technologies can distinguish specific types of Vibrio mimics, particularly different serotypes. Summary of the Invention

[0007] A Taqman-MGB probe real-time fluorescence quantitative PCR detection system, kit, method and application of Vibrio mimics are disclosed. The LAMP system of the invention is used to detect Vibrio mimics and perform serological typing on the Vibrio mimics, which has the advantages of simple operation, rapidity and high efficiency.

[0008] In a first aspect, the present invention discloses a Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus, wherein the Taqman-MGB probe real-time fluorescence quantitative PCR detection system comprises a primer set and an MGB probe, wherein the primer set is specifically as follows:

[0009] Primer set 1:

[0010] Upstream primer P1: 5′- TGTTGGGACATGTGTCAGGATT -3′;

[0011] Downstream primer P2: 5'-TTTATTGAACCAACAAGCATCGA -3'; and / or

[0012] Primer set 2:

[0013] Upstream primer P3: 5′-ATCTTACTCTCGTTTACCGC -3′;

[0014] Downstream primer P4: 5'-AGTATCCATCGAAATCCAGC -3'; and / or

[0015] Primer set 3:

[0016] Upstream primer P5: 5′- TCCATTGCGTTTTATGTTATTGATG -3′;

[0017] Downstream primer P6: 5′- TCTGGACACTAATCTCTCAGGGAA -3′;

[0018] The 5' end of the MGB probe has a fluorescent marker FAM and the 3' end is connected to an MGB modification group. Each primer set corresponds to one MGB probe; primer set 1 is conjugated with probe T1, primer set 2 is conjugated with probe T2, and primer set 3 is conjugated with probe T3, as shown below:

[0019] Probe T1: 5′- CTTGATTTCTCATCTATAGCTGGA -3′;

[0020] Probe T2: 5′- ACAACTCTCGCCAGTGCAGGA -3′;

[0021] Probe T3: 5′-TTTGTTCCAGTCTTTTAAAGT-3′.

[0022] There are three types of genes in the O-antigen synthesis gene cluster of Vibrio mimicus: monosaccharide synthase genes, glycosyltransferase genes and oligosaccharide unit processing enzyme genes ( wzx and wzy Among them, the oligosaccharide unit processing enzyme gene has the most type specificity, followed by the glycosyltransferase gene, and the monosaccharide synthase gene has poor specificity. Therefore, after a lot of testing and screening, the genes of Vibrio mimicus G2358, G2962, and G3890 were finally selected. wzy The gene is used as a specific gene to design specific primers and probes.

[0023] In the present invention, Primer Express 3.0 software was used and TaqMan-MGB probes and primers were designed based on the specific gene sequences of each serotype. The GC% content of the primers and probes was ensured to be between 40-70% to avoid the formation of loop hairpin structures, self-dimers and cross-dimers. The specificity of the primers and probes was then verified by comparing their sequences with all sequences in GenBank using BLAST search. Secondly, the probes were designed to be 15-30 nt in length with a Tm of 68-70°C. At the 5' end of the probe, the presence of a G base that may cause fluorescence quenching was avoided. In addition, the length of the primers was designed to be approximately 25 nt with a Tm between 55-60°C, and the corresponding PCR product length was between 50-200 bp.

[0024] Preferably, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0025] In a second aspect, the present invention provides a real-time fluorescence PCR detection kit for Vibrio mimics, comprising the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect.

[0026] Preferably, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0027] In a third aspect, the present invention provides a method for identifying Vibrio mimics based on real-time fluorescence PCR technology, comprising the following steps:

[0028] (1) Extract genomic DNA from the sample to be tested as a template;

[0029] (2) using the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimics described in the first aspect, respectively, to perform a real-time fluorescence PCR amplification reaction on the template;

[0030] (3) After the amplification reaction is completed, the Ct value of the amplification reaction system is used to determine whether an amplification product is obtained in the amplification reaction system to determine whether the sample to be tested is Vibrio mimicus:

[0031] If the Ct value of the amplification reaction system is less than 26, it means that the sample to be tested contains the corresponding Vibrio mimicus;

[0032] If the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the corresponding Vibrio mimics.

[0033] In a fourth aspect, the present invention provides the use of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect in the identification of Vibrio mimics.

[0034] In a fifth aspect, the present invention provides the application of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect in food detection.

[0035] Preferably, the food is aquatic product.

[0036] The TaqMan fluorescent probe is an oligonucleotide probe with a fluorescent group at its 5' end, such as FAM, TET, VIC, or HEX, and a quencher at its 3' end, such as TAMRA or BHQ. During PCR amplification, a specific fluorescent probe is added simultaneously with a pair of primers. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. During PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the reporter and quencher fluorescent groups. This allows the fluorescence monitoring system to receive the fluorescent signal. This means that each time a DNA chain is amplified, a fluorescent molecule is formed, ensuring complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product.

[0037] This invention primarily provides a molecular biological method for detecting three serotypes of Vibrio mimicus. The primary challenge lies in the screening and identification of specific Taqman primers and MGB probes. Compared with existing technologies, this invention has at least the following advantages:

[0038] (1) The present invention discloses for the first time the technical means of detecting Vibrio mimics using Taqman-MGB probe technology, and applies TaqMan-MGB technology to the serological typing of Vibrio mimics for the first time, overcoming the technical problems of traditional detection methods being time-consuming and existing molecular biological detection methods being unable to distinguish serotypes. It provides an effective method for the detection, clinical detection and epidemiological monitoring of the bacteria in aquatic products.

[0039] (2) The detection method provided by the present invention has high detection sensitivity, and the detection sensitivity for genomic DNA can reach 1ng.

[0040] (3) The detection method provided by the present invention has a short detection time. Using this technical means, the detection can be completed within about 3 hours after obtaining the genomic DNA of the sample to be tested or the pure culture bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 This is a graph showing the RT-PCR test results for serotype strain G2358 itself;

[0042] Figure 2 This is a graph showing the RT-PCR test results for serotype strain G2962 itself;

[0043] Figure 3 This is a graph showing the RT-PCR test results for serotype strain G3890 itself;

[0044] Figure 4 This is a graph showing the reaction specificity test results for serotype strain G2358;

[0045] Figure 5 This is a graph showing the reaction specificity test results for serotype strain G2962;

[0046] Figure 6 This is a graph showing the reaction specificity test results for serotype strain G3890. DETAILED DESCRIPTION

[0047] To address the shortcomings of existing technologies, the inventors of the present invention, after intensive research, have developed a real-time fluorescence PCR detection technology that can identify three serotypes of Vibrio mimics, providing an effective technical means for the rapid detection of this pathogen. To this end, the present invention provides the following technical solutions:

[0048] In a first aspect, the present invention discloses a Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimicus, wherein the Taqman-MGB probe real-time fluorescence quantitative PCR detection system comprises a primer set and an MGB probe, wherein the primer set is specifically as follows:

[0049] Primer set 1:

[0050] Upstream primer P1: 5′- TGTTGGGACATGTGTCAGGATT -3′;

[0051] Downstream primer P2: 5'-TTTATTGAACCAACAAGCATCGA -3'; and / or

[0052] Primer set 2:

[0053] Upstream primer P3: 5′-ATCTTACTCTCGTTTACCGC -3′;

[0054] Downstream primer P4: 5'-AGTATCCATCGAAATCCAGC -3'; and / or

[0055] Primer set 3:

[0056] Upstream primer P5: 5′- TCCATTGCGTTTTATGTTATTGATG -3′;

[0057] Downstream primer P6: 5′- TCTGGACACTAATCTCTCAGGGAA -3′;

[0058] The 5' end of the MGB probe has a fluorescent marker FAM and the 3' end is connected to an MGB modification group. Each primer set corresponds to one MGB probe; primer set 1 is conjugated with probe T1, primer set 2 is conjugated with probe T2, and primer set 3 is conjugated with probe T3, as shown below:

[0059] Probe T1: 5′- CTTGATTTCTCATCTATAGCTGGA -3′;

[0060] Probe T2: 5′- ACAACTCTCGCCAGTGCAGGA -3′;

[0061] Probe T3: 5′-TTTGTTCCAGTCTTTTAAAGT-3′.

[0062] There are three types of genes in the O-antigen synthesis gene cluster of Vibrio mimicus: monosaccharide synthase genes, glycosyltransferase genes and oligosaccharide unit processing enzyme genes ( wzx and wzy Among them, the oligosaccharide unit processing enzyme gene has the most type specificity, followed by the glycosyltransferase gene, and the monosaccharide synthase gene has poor specificity. Therefore, the genes of Vibrio mimicus G2358, G2962, and G3890 were selected. wzy The gene is used as a specific gene to design specific primers and probes.

[0063] In the present invention, Primer Express 3.0 software was used and TaqMan-MGB probes and primers were designed based on the specific gene sequences of each serotype. The GC% content of the primers and probes was ensured to be between 40-70% to avoid the formation of loop hairpin structures, self-dimers and cross-dimers. The specificity of the primers and probes was then verified by comparing their sequences with all sequences in GenBank using BLAST search. Secondly, the probes were designed to be 15-30 nt in length with a Tm of 68-70°C. At the 5' end of the probe, the presence of a G base that may cause fluorescence quenching was avoided. In addition, the length of the primers was designed to be approximately 25 nt with a Tm between 55-60°C, and the corresponding PCR product length was between 50-200 bp.

[0064] As one of the preferred technical solutions, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0065] In a second aspect, the present invention provides a real-time fluorescence PCR detection kit for Vibrio mimics, comprising the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect.

[0066] As one of the preferred technical solutions, primer set 1 and probe T1 are used to identify whether it is Vibrio mimics G2358, primer set 2 and probe T2 are used to identify whether it is Vibrio mimics G2962, and primer set 3 and probe T3 are used to identify whether it is Vibrio mimics G3890.

[0067] In a third aspect, the present invention provides a method for identifying Vibrio mimics based on real-time fluorescence PCR technology, comprising the following steps:

[0068] (1) Extract genomic DNA from the sample to be tested as a template;

[0069] (2) using the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimics described in the first aspect, respectively, to perform a real-time fluorescence PCR amplification reaction on the template;

[0070] (3) After the amplification reaction is completed, the Ct value of the amplification reaction system is used to determine whether an amplification product is obtained in the amplification reaction system to determine whether the sample to be tested is Vibrio mimicus:

[0071] If the Ct value of the amplification reaction system is less than 26, it means that the sample to be tested contains the corresponding Vibrio mimicus;

[0072] If the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the corresponding Vibrio mimics.

[0073] In a fourth aspect, the present invention provides the use of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect in the identification of Vibrio mimics.

[0074] In a fifth aspect, the present invention provides the application of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics described in the first aspect in food detection.

[0075] As one of the preferred technical solutions, the food is aquatic product.

[0076] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0077] Example 1 Extraction of sample nucleic acid

[0078] 1. For the obtained pure cultured bacteria, use the following methods to process:

[0079] (1) Pick a single bacterial colony and place it in 10µL of deionized water, or 10µL of overnight cultured bacterial solution, and place it in a boiling water bath for 15 minutes.

[0080] (2) Place on ice for 1 minute, then centrifuge at 8000 rpm for 1 minute.

[0081] (3) Take 3 μL of supernatant as the template for the next LAMP reaction.

[0082] 2. For food samples, take 10g of solid or semi-solid food sample, or 5mL of liquid food sample, and process them in the following manner:

[0083] (1) Place the sample in 20 mL of LB medium (containing 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) and culture at 37°C and 180 rpm for 3 h.

[0084] (2) Take 1 mL of the culture in (1), centrifuge at 8000 rpm for 5 min, and discard the supernatant.

[0085] (3) Add 500µL of deionized water, resuspend and mix, centrifuge at 8000rpm for 5min, and discard the supernatant.

[0086] (4) Add 100 µL of deionized water and place in a boiling water bath for 15 min.

[0087] (5) Place on ice for 1 minute and centrifuge at 8000 rpm for 1 minute.

[0088] (6) Take 3 μL of supernatant as the template for the next real-time fluorescence PCR reaction.

[0089] The genomes of Vibrio mimics G2358, G2962, and G3890 were extracted respectively according to the above method to obtain genomic nucleic acid solutions of Vibrio mimics G2358, G2962, and G3890.

[0090] Example 2 Real-time fluorescence amplification (RT-PCR) detection

[0091] The nucleic acid solution extracted in Example 1 was used as a template for the reaction and added to each RT-PCR reaction system. The reaction was carried out in a real-time fluorescence quantitative gene amplification instrument (in this example, a 7500 real-time fluorescence quantitative PCR instrument from ABI, USA) under the following conditions:

[0092]

[0093] The details of the real-time fluorescence amplification (RT-PCR) reaction system are shown in Table 1.

[0094] The amplification reaction was carried out in a total volume of 25 μL, including 12.5 μL of real-time fluorescent PCR premix with hot start function (Premix Ex Taq TM , Takara), 0.3 μL each of 10 μM forward and reverse primers, 0.3 μL of 10 μM probe, 0.2 μL ROXII, 0.2 μL of the sample DNA to be tested, and 11.2 μL ddH O. RT-PCR was performed using a 7500 RT-PCR system (Applied Biosystems, Foster City, CA, USA), followed by detection and analysis using an instrument such as the ABI 7500.

[0095] In the test results, if the Ct value of the amplification reaction system is less than 26, it means that the sample to be tested contains the corresponding Vibrio mimics; if the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the corresponding Vibrio mimics.

[0096] Table 1

[0097]

[0098] The experimental results show that:

[0099] (1) High accuracy: In this embodiment, 0.2 μL of the genomic nucleic acid solutions of Vibrio mimics G2358, G2962, and G3890 extracted in Example 1 were added to systems 1, 2, and 3, respectively, to achieve accurate detection of the three serotypes of Vibrio mimics.

[0100] The specific reaction results (CT values) of real-time fluorescence PCR for Vibrio mimics G2358 are as follows. It can be seen that for Vibrio mimics G2358, the corresponding real-time fluorescence PCR detection result of system 1 is Ct=16.65; for Vibrio mimics G2962, the corresponding real-time fluorescence PCR detection result of system 2 is Ct=16.72; for Vibrio mimics G3890, the corresponding real-time fluorescence PCR detection result of system 3 is Ct=16.11. It can be seen that the CT value of the real-time fluorescence PCR detection of each system for the corresponding serotype is less than 26, which can be judged as a positive result. Figures 1 to 3 shown.

[0101] (2) Good specificity: In addition to being able to detect its own corresponding serotype (CT value is less than 26), each system can also perform specific detection when strains of other serotypes are added. The results show that when strains other than G2358 are added to reaction system 1, no amplification curve appears, which can be judged as a negative result; when strains other than G2962 are added to reaction system 2, no amplification curve appears, which can be judged as a negative result; when strains other than G3890 are added to reaction system 3, no amplification curve appears, which can be judged as a negative result; the specific results are as follows Figures 4 to 6 shown.

[0102] The specificity of the invention was also verified by testing other common pathogenic Vibrio species found in aquatic products, including Vibrio cholerae, Vibrio parahaemolyticus, Vibrio fluvii, Vibrio vulnificus, and Vibrio alginolyticus. The results showed that the invention's technology system produced no amplification curves for any of these Vibrio species, indicating negative results, demonstrating its high specificity.

[0103] Table 2 Real-time fluorescence PCR specific reaction results of Vibrio mimics (CT value)

[0104] .

[0105] (3) Sensitivity test:

[0106] ① Inoculate each Vibrio mimics strain into 5 mL of LB medium, culture overnight in a shaker at 37°C and 180 rpm, and collect 2 mL of bacteria.

[0107] ② Use the bacterial genomic DNA extraction kit (product number DP302) of Tiangen Biochemical Technology (Beijing) Co., Ltd. and follow its operating procedures to extract bacterial genomic DNA.

[0108] ③ Measure the concentration of the extracted genome using a NanoDrop OD instrument and adjust it to 500 ng / μL. Then, perform a series of dilutions. The amount of genomic DNA added to the reaction system was 100 ng, 10 ng, 1 ng, 100 pg, 10 pg, and 1 pg, respectively.

[0109] ④ Real-time fluorescence PCR reaction was carried out according to the above reaction steps. The results are shown in Table 3. It can be seen from the results that the detection sensitivity for genomic DNA is 1 ng.

[0110] Table 3 Real-time fluorescence PCR sensitivity test results of Vibrio mimicus (CT value)

[0111] .

[0112] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics, comprising a primer set and an MGB probe, characterized in that: The nucleotide sequence of the primer set is as follows: Upstream primer P3: 5′-ATCTTACTCTCGTTTACCGC -3′; Downstream primer P4: 5′- AGTATCCATCGAAATCCAGC -3′; The 5' end of the MGB probe is fluorescently labeled with FAM, and the 3' end is connected to an MGB modification group. Each primer set corresponds to one MGB probe. The nucleotide sequence of the MGB probe is as follows: Probe T2: 5′-ACAACTCTCGCCAGTGCAGGA-3′.

2. A real-time fluorescence PCR detection kit for Vibrio mimicus, characterized in that: The invention comprises the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimics according to claim 1.

3. A method for identifying Vibrio mimics based on real-time fluorescence PCR technology, wherein the method is for non-disease diagnosis purposes, characterized in that: The following steps are involved: (1) Extract genomic DNA from the sample to be tested as a template; (2) using the Taqman-MGB probe real-time fluorescence quantitative PCR detection system of Vibrio mimics according to claim 1, respectively, to perform a real-time fluorescence PCR amplification reaction on the template; (3) After the amplification reaction is completed, the Ct value of the amplification reaction system is used to determine whether an amplification product is obtained in the amplification reaction system to determine whether the sample to be tested is Vibrio mimicus: If the Ct value of the amplification reaction system is less than 26, it indicates that the sample to be tested contains the Vibrio mimicus; If the Ct value of the amplification reaction system is greater than 26, it means that the sample to be tested does not contain the Vibrio mimicus.

4. Use of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics according to claim 1 in the identification of Vibrio mimics, wherein the use is for purposes other than disease diagnosis.

5. Use of the Taqman-MGB probe real-time fluorescence quantitative PCR detection system for Vibrio mimics according to claim 1 in food detection to detect whether food contains the Vibrio mimics.

Images