Linked marker of haynaldia villosa stripe rust resistant gene and application thereof

Abstract

The invention discloses a linkage marker of a haynaldia villosa stripe rust resistance gene and application of the linkage marker. According to the invention, a new stripe rust resistance gene is positioned from artificially synthesized durum wheat-haynaldia villosa didiploid STH55-1 and is named as Yr2VS, two molecular markers InDel411 and InDel1393 which are closely linked with the Yr2VS are obtained, and the genetic distances are 3.4 cM and 2.2 cM respectively. The two molecular markers are co-dominant InDel markers, can accurately identify whether wheat germplasm resources and varieties carry the Yr2VS gene or not and predict whether the wheat germplasm resources and varieties have stripe rust resistance or not, and can be used for molecular marker-assisted selective breeding of the stripe rust resistant gene Yr2VS.

Description

Technical Field

[0001] The invention relates to a linkage marker of a wheat stripe rust resistance gene and its application, which can be applied to molecular marker-assisted breeding and belongs to the technical field of crop molecular breeding. Background Art

[0002] Wheat stripe rust (Yellow rust) is an airborne fungal disease caused by Puccinia striiformis f. sp. tritici (Pst), which seriously threatens food security. At present, 87 stripe rust resistance genes have been officially named (reference: Sharma D, Avni R, Gutierrez-Gonzalez J, et al. (2024) A single NLR gene confers resistance to leaf and stripe rust in wheat. Nat Commun 15: 9925.). Due to the frequent mutation of wheat stripe rust and the continuous emergence and spread of new highly toxic subspecies, most disease resistance genes have gradually or have lost their resistance, except for a few genes such as Yr5 and Yr15 that have good resistance to the main stripe rust subspecies prevalent in my country (reference: Liu Zhiyong, Zhang Huaizhi, Bai Bin, et al. Current status and strategy of wheat stripe rust resistance gene breeding in China [J]. Chinese Agricultural Science, 2024, 57 (01): 34-51). The narrow genetic basis of resistance and the lack of effective resistance genes have become bottlenecks restricting the breeding of a new round of new stripe rust resistant varieties.

[0003] Wild relatives of the wheat family are a rich gene pool for cultivated wheat. Since the related species have not been domesticated, they have long adapted to the relatively harsh growth environment in the wild and have retained many unique excellent genes for disease resistance and stress resistance. The annual H. villosa (2n=2x=14, VV) is a tertiary genetic resource of wheat. More than 300 strains have been identified, with a wide distribution area and high genetic diversity. It contains a large number of excellent genetic resources and is a good source of resistance for wheat stripe rust resistance breeding.

[0004] Creating alloamphiploids is one of the more effective methods to achieve gene transfer, and is also a good parent material for breeding wheat-haynaldia villosa addition lines, substitution lines, and translocation lines. Hybridizing haynaldia villosa with durum wheat creates durum wheat-haynaldia villosa amphiploids, and using amphiploids as a bridge to hybridize with common wheat to achieve gene transfer and breeding utilization (reference: Liu YQ, Liu JH, Huang ZP, et al. (2024) Phenotypic characterization and gene mapping of hybrid necrosis in Triticum durum-Haynaldia villosaamphiploids. Theor Appl Genet 137, 185.). Therefore, it is an urgent need to identify new disease-resistant germplasms from durum wheat-haynaldia villosa amphiploids, explore new stripe rust resistance genes, and apply them to wheat cultivars to enrich the disease-resistant gene pool of wheat to cope with the evolving wheat stripe rust species. Summary of the invention

[0005] The purpose of the present invention is to identify a new stripe rust resistance gene Yr2VS from Elysia villosa, and to provide a molecular marker closely linked to the gene.

[0006] To achieve the above object, the present invention adopts the following scheme:

[0007] The molecular markers closely linked to the stripe rust resistance gene Yr2VS in Elymus villosa are InDel411 and InDel1393, and the genetic distances between the molecular markers and the stripe rust resistance gene are 3.4 cM and 2.2 cM, respectively. The sequence of the molecular marker InDel411 is shown in SEQ ID NO.1, and the sequence of the molecular marker InDel1393 is shown in SEQ ID NO.2.

[0008] InDel411 molecular marker sequence: GGAACACATGGGATGCGACTACGTCACCTAC ATGGTTTAAGAAGCCACGCACCAACAGCATCCATGCATCGACCGACAGCACCAGGTAGGACCTCACGCGTAACTCACTGCCTGGCCGCGTACACAAAGTGAGGCTGCGGCTGGAGCTCCAACTTGAGGATTTCCCCTGTCCGGGAGGGCACTTAAAAGCTGCCACCCAG (SEQ ID NO: 1).

[0009] InDel1393 molecular marker sequence: TCAAACTGGTGGAGGCTATCAAAGAATCTGG AAACGTCAAGGTAGGCTAACTCACTCTCGGTGATTATTTTTTTCGATAAAGACTCTGGGTGACTAATATATGAGTATTAACCATAGTCTAAATTTTGTGAACACTTAATACTGTATATATATATAT AGTATTATGATTTGGTTTTCGTAATCTCATCAAATGGTCTTAAAATCGTATTGAATTTCTAGGTATTTATTGTCCAATGCTATTACTTAGTCCAAATCTATTTTGCAATTTCGGAGGGGTG(SEQ ID NO:2).

[0010] The primer pair of the molecular marker of the present invention, the primer pair sequence of the molecular marker InDel411 is shown as SEQ ID NO.3 and SEQ ID NO.4; the primer pair sequence of the molecular marker InDel1393 is shown as SEQ ID NO.5 and SEQ ID NO.6.

[0011] InDel411-F: 5'-GGAACACATGGGATGCGACTA-3' (SEQ ID NO: 3);

[0012] InDel411-R: 5'-CTGGGTGGCAGCTTTAAGTG-3' (SEQ ID NO: 4).

[0013] InDel1393-F: 5'-TCAAACTGGTGGAGGCTATCAAA-3' (SEQ ID NO: 5);

[0014] InDel1393-R: 5'-CACCCCTCCGAAATTGCAAAATA-3' (SEQ ID NO: 6).

[0015] The invention discloses an application of the molecular marker primer pair in molecular marker-assisted selection breeding for wheat resistance to stripe rust.

[0016] As a preferred embodiment of the present invention, the durum wheat-Triticum villosa amphidiploid plants or their derivative lines are taken as the objects, and the genomic DNA of the plants is amplified using the primer pair of the molecular marker using the PCR method. When a 200bp band pattern of the InDel411 molecular marker appears, or when a 279bp band pattern of the InDel1393 molecular marker appears, it indicates the presence of the wheat stripe rust resistance gene Yr2VS from Triticum villosa in the plant.

[0017] PCR reaction system 10μl:

[0018] Contains 1 μL DNA template (concentration 50-100 ng / μL), 5 μL 2× Taq Mix, 0.2 μL left and right primers, 3.6 μL ddH2O;

[0019] PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C (or 60°C) for 30 s, extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for 10 min; storage at 4°C for future use.

[0020] Detection of PCR amplification products: Take 2 μL of PCR amplification products and perform electrophoresis in 8% polyacrylamide gel at a constant voltage of 200 V for 50-60 min, stain with silver nitrate and perform labeling and typing.

[0021] The invention discloses an application of the molecular marker primer combination in identifying or predicting the stripe rust resistance of amphidiploid durum wheat-triticum villosa plants or their derived wheat lines.

[0022] As a preferred embodiment of the present invention, PCR amplification is performed using genomic DNA of a durum wheat-triticum villosa amphidiploid plant or its derived wheat strain as a template and the primer pair of InDel411 or the primer pair of the molecular marker InDel1393. When a 200 bp band of the InDel411 molecular marker appears, or when a 279 bp band of the InDel1393 molecular marker appears, it indicates that the plant is a stripe rust-resistant variety; otherwise, it is a susceptible variety.

[0023] The molecular marker primer pair is used in detecting or identifying a molecular marker tightly linked to a wheat stripe rust resistance gene. The molecular marker tightly linked to a wheat stripe rust resistance gene is InDel411 or InDel1393.

[0024] As a preferred embodiment of the present invention, PCR amplification is performed using genomic DNA of a durum wheat-Triticum villosa amphidiploid plant or its derived wheat strain as a template and the primer pair of InDel411 or the primer pair of the molecular marker InDel1393. When a 200 bp band of the InDel411 molecular marker appears, or when a 279 bp band of the InDel1393 molecular marker appears, it indicates that the plant genome contains the molecular marker InDel411 or InDel1393 that is tightly linked to the wheat stripe rust resistance gene.

[0025] Beneficial Effects

[0026] The present invention locates a stripe rust resistance gene Yr2VS from a synthetic durum wheat-villous wheat amphidiploid germplasm resource, and obtains two closely linked molecular markers InDel411 and InDel1393. These two molecular markers are co-dominant InDel markers, which can accurately identify the presence or absence of the Yr2VS gene in the durum wheat-villous wheat amphidiploid material and its derived heterochromatic system, and predict its stripe rust resistance, thereby effectively detecting the new wheat stripe rust resistance gene Yr2VS in wheat molecular marker-assisted breeding. At the same time, the present invention also lays a good foundation for cloning new wheat stripe rust resistance genes and their functional research. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 In Example 1 of the present invention, the stripe rust resistance of STH55-1 and STH61-1 at the seedling stage was identified, wherein ZY1286 and Nannong 0686 were used as susceptible controls.

[0028] Figure 2 BSE-seq analysis results in Example 2 of the present invention.

[0029] Figure 3 The genetic linkage map of the stripe rust resistance gene Yr2VS in Example 2 of the present invention and the corresponding physical map of E. villosa, with the genetic linkage map of the stripe rust resistance gene Yr2VS on the left and the physical map of E. villosa on the right.

[0030] Figure 4 In Example 3 of the present invention, the molecular markers InDel411 and InDel1393 are located in the F of STH55-1×STH61-1 2 Amplification results of stripe rust-resistant and -susceptible plants in a population, where M represents Marker; 1 represents the resistant parent STH55-1; 2 represents the susceptible parent STH61-1; 3 represents the susceptible material ZY1286; 4-25 represent some randomly selected F2 plants, of which 5, 6, 7, 8, 9, 11, 14, 15, 18, 19, 22, 23, 24, and 25 are resistant plants, and 4, 10, 12, 13, 16, 17, 20, and 21 are susceptible plants; arrows indicate molecular marker-specific bands. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is clearly and completely described below in conjunction with specific embodiments, and the experimental methods not mentioned are conventional experimental methods.

[0032] Example 1 Identification and genetic analysis of stripe rust resistance in amphidiploid wheat durum-Triticum villosa

[0033] 1. Experimental Materials

[0034] Plant material: The disease-resistant amphidiploid STH55-1 and the susceptible amphidiploid STH61-1 were crossed to construct the F 2 Positioning group, for F 2 The group and its derived F 2:3 The families were identified for resistance to stripe rust at the seedling stage. Durum wheat ZY1286 and common wheat Nannong 0686 (reference: Hou F, Jin YY, Hu J, et al. (2024) Transferring an Adult-Plant Stripe-Rust Resistance Gene Yr7VS from Chromosome7V of Dasypyrum villosum (L.) to Bread Wheat. Plants 13: 1875.) were used as susceptible controls. The above materials were all deposited in the Institute of Cytogenetics, Nanjing Agricultural University (reference: Liu YQ, Liu JH, Huang ZP, et al. (2024) Phenotypic characterization and gene mapping of hybrid necrosis in Triticum durum-Haynaldia villosa amphiploids. Theor Appl Genet 137, 185.).

[0035] Fungal material: Stripe rust fungus CYR32 was used for inoculation and identification of resistance in the seedling stage.

[0036] 2. Resistance identification

[0037] Under the conditions of a culture box with controlled temperature, humidity and light, when the second leaf of the inoculated material is fully expanded, the summer spores of stripe rust are inoculated by the shaking powder method (the ratio of summer spores to talcum powder is 1:30) or the smearing method. After 24 hours of dark moisture preservation at 10℃, they are placed in an incubator for normal growth. The temperature and light cycle is 18℃16h light / 12℃8h dark, and the relative humidity is 75-80%. About 15 days after inoculation, when the susceptible control is fully diseased, the reaction type is recorded according to the international general standard 0-9 level. After that, the investigation is conducted every 3 days, for a total of 3 times, and the highest reaction type is used for disease resistance evaluation. Among them, 0-6 levels are classified as disease-resistant types, and 7-9 levels are classified as susceptible types.

[0038] For all the F 2:3 25 seeds from each family were taken for seedling identification. 2:3 The results of the family identification will be F 2 The segregating population was divided into three types: homozygous disease-resistant, heterozygous disease-resistant and homozygous disease-susceptible. 2 The ratio of resistance and sensitivity of individual plants was analyzed by χ 2test.

[0039] 3. Genetic Analysis

[0040] The results are as follows Figure 1 As shown, STH55-1 showed high resistance to stripe rust CYR32 (IT=1), while STH61-1 showed high susceptibility to the disease (IT=9). 2 In the population, 143 plants were resistant and 43 plants were susceptible. The chi-square test showed that the genetic segregation ratio of resistant and susceptible plants was 3:1 (χ 2 =0.351, P=0.553). 2 Population-derived F 2:3 The family was tested for stripe rust at the seedling stage to determine the F 2 The results showed that among the 186 families identified, 51 families showed homozygous resistance, 92 families showed heterozygous resistance, and 43 families showed homozygous susceptibility. The chi-square test showed that the genetic segregation ratio of resistant and susceptible plants was 3:1 (χ 2 =0.710, P=0.701).

[0041] Therefore, from F 2 Separation of groups and F 2:3 The results of family resistance identification showed that the resistance of amphidiploid STH55-1 to stripe rust was controlled by a single dominant gene.

[0042] Example 2 Obtaining molecular markers linked to the stripe rust resistance gene of amphidiploid STH55-1

[0043] 1. BSE-seq Analysis

[0044] Bulked segregant analysis (BSA) was used to analyze the F 2 Thirty extremely susceptible and extremely resistant plants were selected from the segregating population, and equal amounts of DNA from each plant were mixed to construct disease-resistant and disease-susceptible mixed pools (reference: Dong CH, Zhang LC, Chen ZX, et al. (2020) Combining a New Exome Capture Panel With an Effective varBScore Algorithm Accelerates BSA-Based Gene Cloning in Wheat. Front Plant Sci 11: 1249.). The constructed mixed pools and parental DNA were sent to Shijiazhuang Boredi Biotechnology Co., Ltd. for exon capture sequencing.

[0045] 2. Molecular marker development and linkage map drawing

[0046] (1) Total DNA was extracted using the CTAB method.

[0047] (2) Primer design:

[0048] According to the SNP and InDel sites obtained by BSE-seq analysis and with reference to the genome sequence of Dasypyrum villosum (reference: Zhang X, Wang HY, Sun HJ, et al. (2023) A chromosome-scale genome assembly of Dasypyrum villosum provides insights into its application as a broad-spectrum disease resistance resource for wheat improvement. Mol Plant 16: 432-451.), 7 co-dominant molecular markers with polymorphism between parents were screened in the 0.80Mb-19.60Mb segment of chromosome 2V, namely InDel217, InDel411, InDel1393, InDel2186, InDel3037, SNP18 and InDel4160. All primers were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0049] (3) PCR reaction:

[0050] The reaction system for PCR amplification: contains 1 μL DNA template (concentration 50-100 ng / μ), 5 μL 2× Taq Mix, 0.2 μL left and right primers, 3.6 μL ddH2O;

[0051] PCR program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C (or 60°C) for 30 s, extension at 72°C for 30 s, for a total of 33 cycles; extension at 72°C for 10 min; storage at 4°C for future use.

[0052] (4) Detection of PCR amplification products:

[0053] Take 2 μL of PCR amplification product and perform electrophoresis in 8% polyacrylamide gel at a constant voltage of 200 V for 50-60 min, stain with silver nitrate and perform labeling and typing.

[0054] The above six linkage markers were used to identify 190 F genes of STH55-1×STH61-1. 2PCR amplification and genotyping were performed on individual plants in the population, and the typing results were imported into Join Map v4.0 software to calculate the genetic distance between the six linkage markers and Yr2VS and draw a genetic linkage map.

[0055] The results are as follows Figure 2 As shown, according to BSE-seq analysis, the stripe rust resistance gene Yr2VS was preliminarily located on chromosome 2V.

[0056] The results are as follows Figure 3 As shown, the stripe rust resistance gene Yr2VS was further located between the molecular markers InDel411 and InDel1393, with genetic distances of 3.4 cM and 2.2 cM, respectively. Yr2VS was located between 2,282,803 bp and 4,118,610 bp on chromosome 2V of E. villosa.

[0057] Primer sequence of molecular marker InDel411:

[0058] InDel411-F: 5'-GGAACACATGGGATGCGACTA-3', SEQ ID NO: 3;

[0059] InDel411-R: 5'-CTGGGTGGCAGCTTTAAGTG-3', SEQ ID NO: 4.

[0060] Primer sequence of molecular marker InDel1393:

[0061] InDel1393-F: 5'-TCAAACTGGTGGAGGCTATCAAA-3', SEQ ID NO: 5:

[0062] InDel1393-R: 5'-CACCCCTCCGAAATTGCAAAATA-3', SEQ ID NO: 6. Example 3 Application of Molecular Markers Linked to the Stripe Rust Resistance Gene of Amphidiploid STH55-1 in the Progeny of Hybrid Combinations with STH55-1 as Parent

[0063] In order to verify the selection effect of molecular markers InDel411 and InDel1393 in hybrid progeny, we selected the F1 loci of STH55-1×STH61-1 according to the stripe rust resistance identification results. 2 Disease-resistant plants and susceptible plants were randomly selected from the population, and PCR amplification was performed using InDel primers. The disease-resistant parent STH55-1 (containing stripe rust resistance gene), the susceptible parent STH61-1 (without stripe rust resistance gene) and durum wheat ZY1286 (without stripe rust resistance gene) were used as controls.

[0064] The specific steps are as follows:

[0065] PCR reaction:

[0066] The reaction system for PCR amplification: contains 1 μL DNA template (concentration 50-100 ng / μ), 5 μL 2× Taq Mix, 0.2 μL left and right primers, 3.6 μL ddH2O;

[0067] PCR program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 33 cycles; extension at 72°C for 10 min; storage at 4°C for future use.

[0068] Detection of PCR amplification products: 2 μL of PCR amplification products were electrophoresed in 8% polyacrylamide gel at a constant voltage of 200 V for 55 min, and then stained with silver nitrate and marked for typing.

[0069] Analysis and identification showed that if the molecular marker InDel411 could amplify a 200bp band, or the molecular marker InDel1393 could amplify a 279bp band, it indicated that the stripe rust resistance gene Yr2VS existed in the tested wheat germplasm; if it could not be amplified, the stripe rust resistance gene Yr2VS did not exist in the tested wheat germplasm.

[0070] The results are as follows Figure 4 As shown in Table 1, the prediction of the marker analysis results was completely consistent with the resistance identification test results, indicating that markers InDel411 and InDel1393 can be used as molecular markers for screening the stripe rust resistance gene Yr2VS, and can also be used for molecular marker-assisted selection breeding of the stripe rust resistance gene Yr2VS.

[0071] Table 1. Correspondence between marker analysis result prediction and resistance identification

[0072]

[0073]

[0074] “+” indicates that the target band was amplified, and “-” indicates that the target band was not amplified; “R” indicates disease resistance, and “S” indicates disease susceptibility.

[0075] The above embodiments are merely exemplary implementations used to illustrate the principles of the invention, but the invention is not limited thereto. Those skilled in the art may make various improvements and changes without departing from the essence of the invention, and these improvements and changes also fall within the protection scope of the invention.

Claims

1. A molecular marker tightly linked to a wheat stripe rust resistance gene, characterized in that: The molecular marker is InDel411 or InDel1393, the nucleotide sequence of InDel411 is shown in SEQ ID NO: 1, and the nucleotide sequence of InDel1393 is shown in SEQ ID NO:

2. The genetic distances of the molecular markers InDel411 and InDel1393 to the wheat stripe rust resistance gene are 3.4 cM and 2.2 cM respectively.

2. The molecular marker according to claim 1, characterized in that The primer pair sequences of InDel411 are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

3. The molecular marker according to claim 1, characterized in that The primer pair sequences of InDel1393 are shown in SEQ ID NO: 5 and SEQ ID NO:

6.

4. The molecular marker primer pair according to claim 1, characterized in that: The primer pair sequences of the molecular marker InDel411 are shown in SEQ ID NO: 3 and SEQ ID NO: 4; the primer pair sequences of the molecular marker InDel1393 are shown in SEQ ID NO: 5 and SEQ ID NO:

6.

5. Use of the molecular marker primer pair according to claim 4 in molecular marker-assisted selection breeding for resistance to wheat stripe rust.

6. The use according to claim 5, characterized in that Using the genomic DNA of a durum wheat-triticum villous amphidiploid plant or its derived wheat strain as a template, PCR amplification is performed using the primer pair of InDel411 or the primer pair of the molecular marker InDel1393 described in claim 4. When a 200 bp band of the InDel411 molecular marker appears, or when a 279 bp band of the InDel1393 molecular marker appears, it indicates the presence of a wheat stripe rust resistance gene in the plant.

7. Use of the molecular marker primer pair according to claim 4 in identifying or predicting the stripe rust resistance of amphidiploid plants of Triticum durum-Triticum villosa or their derived wheat lines.

8. The use according to claim 5, characterized in that Using the genomic DNA of a durum wheat-triticum villosa amphidiploid plant or its derived wheat strain as a template, PCR amplification is performed using the primer pair of InDel411 or the primer pair of the molecular marker InDel1393 described in claim 4. When a 200 bp band of the InDel411 molecular marker appears, or when a 279 bp band of the InDel1393 molecular marker appears, it indicates that the plant is a stripe rust resistant variety, otherwise, it is a susceptible variety.

9. Use of the primer pair of the molecular marker according to claim 4 in detecting or identifying a molecular marker tightly linked to a wheat stripe rust resistance gene, wherein the molecular marker tightly linked to a wheat stripe rust resistance gene is InDel411 or InDel1393.

10. The use according to claim 5, characterized in that Using the genomic DNA of a durum wheat-triticum villous amphidiploid plant or its derived wheat strain as a template, PCR amplification is performed using the primer pair of InDel411 or the primer pair of the molecular marker InDel1393 as claimed in claim 4. When a 200 bp band of the InDel411 molecular marker appears, or when a 279 bp band of the InDel1393 molecular marker appears, it indicates that the plant genome contains the molecular marker InDel411 or InDel1393 that is tightly linked to the wheat stripe rust resistance gene.

Images