A primer set for detecting SNP sites related to sugar content in tomato fruit and its application
By detecting the SNP site at 55876054bp on chromosome 11 of tomato, and using the KASP method and a specific primer set, the problem of large data processing volume in the existing technology was solved, and efficient screening of high-sugar trait tomato materials was achieved, shortening the breeding cycle and reducing costs.
Patent Information
- Application Number
- CN202510341884.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2045-03-21
AI Technical Summary
The existing technology requires the integration of information from two SNP sites when screening tomato materials with high sugar traits, resulting in a large workload for data processing and a long breeding cycle.
Provided is a method for detecting the sugar content of tomato fruit. The method utilizes the SNP site at 55876054bp on tomato chromosome 11 to determine the genotype using the KASP method. Detection is performed using a specific primer set carrying a fluorescent tag, simplifying the screening of a single SNP site.
It achieves efficient and accurate screening of tomato materials with high sugar traits, shortens the breeding cycle, reduces costs, and improves parent purity.
Smart Images

Figure CN120099213B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biology, and particularly relates to a primer set for detecting a SNP site related to the sugar content of tomato fruit and an application thereof. Background Art
[0002] The flavor compounds in tomatoes primarily consist of sugars, organic acids, and volatile aromatic compounds. Research has shown that, within a certain threshold, higher levels of total sugars and titratable acid in tomatoes are associated with a higher overall flavor intensity. Fructose and glucose are the most abundant flavor-producing sugars in tomatoes, while some tomato varieties contain higher levels of sucrose. In addition, tomatoes also contain smaller amounts of mannose and melibiose.
[0003] The ratio of different sugar types in tomato fruit affects its sweetness, with tomatoes with a relatively high fructose content tasting sweeter. Sugars in tomatoes are regulated by multiple biochemical pathways, including glycolysis, gluconeogenesis, fructose and mannose metabolism, and starch and sucrose metabolism. These sugars originate from photosynthesis and are metabolized in the form of sucrose through various enzyme-catalyzed reactions during the growth and development of the tomato fruit, contributing to the tomato's sweetness. In addition to being important sweeteners in tomatoes, sugars also play a significant role in tomato flavor by acting as precursors of volatile flavor compounds. Under the catalysis of sucrose invertase, the sucrose in tomatoes is hydrolyzed into fructose and glucose. Further, under the catalysis of fructokinase, fructose is irreversibly converted into fructose-6-phosphate. Through a series of catalytic metabolisms, fructose-6-phosphate enters the shikimic acid pathway and is ultimately converted into phenylalanine. Fructose-6-phosphate can also generate branched-chain amino acids and phosphoenolpyruvate through the glycolysis pathway. Phosphoenolpyruvate can be further converted into flavor precursors such as linolenic acid, linoleic acid, and carotenoids. Therefore, developing more molecular markers closely linked to tomato sugar content can lay the foundation for a more systematic system of marker-assisted breeding for tomato sugar content.
[0004] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by variations in a single nucleotide within a chromosome genome, where at least one allele has a frequency of at least 1% in a population. These variations include single-base transitions, transversions, and insertions / deletions. Since their discovery, SNP markers have significantly advanced population genetics and molecular genetics due to their high density, large number, and ease of detection. They are particularly widely used in genetic map construction, gene cloning, quantitative trait loci analysis, and germplasm resource evaluation. High-throughput SNP marker detection methods include genome sequencing and microarrays. SNP detection methods have also been extensively studied due to their efficiency, stability, and high density.
[0005] Comprehensive identification, evaluation, improvement, and innovation of tomato germplasm resources are of great significance to tomato genetics and breeding research. SNPs, as a new generation of molecular markers, are characterized by high abundance and easily automated detection. Leveraging these sequence polymorphisms, it is now possible to develop markers for detecting sugar content in tomatoes. Screening for these markers is an effective way to improve breeding efficiency for sugar content, a key tomato quality trait, reduce breeding costs, and enhance the economic benefits of the tomato industry.
[0006] Prior art CN112442544B discloses a method, kit, and application for assisting in the screening of tomato materials with high-sugar traits. The invention provides SNP sites at 37559435bp on chromosome 6 of the tomato genome and at 3478110bp on chromosome 9 of the tomato genome, which can be used to screen tomato materials with high-sugar traits, as well as in high-sugar tomato breeding and assisted breeding. This reduces the consumption of manpower and material resources during the screening process of tomatoes with high-sugar traits, and greatly shortens the breeding cycle. However, the patent requires a comprehensive judgment based on the SNP conditions of the two sites, which results in a large workload for data processing when performing large-scale processing.
[0007] Therefore, there is an urgent need to develop a simpler method to screen tomato materials with high sugar traits. Summary of the Invention
[0008] In order to solve the above problems, the present invention provides a primer set for detecting SNP sites related to the sugar content of tomato fruit and its application.
[0009] In one aspect, the present invention provides a method for detecting the sugar content of tomato fruit, the method comprising the following steps:
[0010] S1: Extract genomic DNA;
[0011] S2: Identify the base at 55876054bp on chromosome 11 of tomato;
[0012] S3: Make a decision based on the result of S2.
[0013] Specifically, in step (3), the judgment criteria are as follows: if the genotype is GG, the tomato to be tested is judged to be low in sugar; if the genotype is AA, the tomato to be tested is judged to be high in sugar; if the genotype is GA, the tomato to be tested is judged to be high in sugar.
[0014] Specifically, in step (2), the identification methods include: KASP, first-generation sequencing, second-generation sequencing, Taqman probe method and HRM method.
[0015] More specifically, when the identification method is the KASP method, the primers used include SNP site competitive primers F1: GATAACCGGAACGCCGGGCACCGGG (SEQ ID NO. 5) and F2: GATAACCGGAACGCCGGGCACCGGA (SEQ ID NO. 6), a fluorescent tag sequence connected to the 5' end of the SNP site competitive primer and a universal primer.
[0016] Preferably, the fluorescent tag sequence connected to the 5' end of the SNP site competitive primer F1 is as shown in SEQ ID NO. 7: GAAGGTGACCAAGTTCATGCT.
[0017] Preferably, the fluorescent tag sequence connected to the 5' end of the SNP site competitive primer F2 is as shown in SEQ ID NO. 8: GAAGGTCGGAGTCAACGGATT.
[0018] Further preferably, the primer sequence is shown as SEQ ID NO.2-4.
[0019] SEQ ID NO.2: GAAGGTGACCAAGTTCATGCTGATAACCGGAACGCCGGGCACCGGG;
[0020] SEQ ID NO.3: GAAGGTCGGAGTCAACGGATTGATAACCGGAACGCCGGGCACCGGA;
[0021] SEQ ID NO. 4 (universal primer): CGTCGCCTCCGCCAGTGCAGACGACGTCG.
[0022] In certain specific embodiments of the present invention, in step (2), the KASP reaction amplification system includes: 3-7 μL of KASP PCR Mix, 1-3 μL of DNA, and 0.1-0.5 μL of each primer.
[0023] In certain specific embodiments of the present invention, in step (2), the KASP reaction amplification conditions are: pre-denaturation at 95°C for 5-10 min; denaturation at 95°C for 5-10 s, annealing and extension at 58°C for 20-30 s, for a total of 35-40 cycles; and finally, reading the genotyping data at 30°C for 20-30 s.
[0024] In certain specific embodiments of the present invention, in step (3), the judgment criteria are as follows: if only the fluorescent signal corresponding to the fluorescent sequence connected to SEQ ID NO. 2 is detected, the tomato to be tested exhibits low sugar content and its genotype is GG; if only the fluorescent signal corresponding to the fluorescent sequence connected to SEQ ID NO. 3 is detected, the tomato to be tested is determined to be high sugar content and its genotype is AA; if both fluorescent signals are detected at the same time, the tomato to be tested is determined to be high sugar content and its genotype is the heterozygous GA.
[0025] In another aspect, the present invention provides the use of a primer set having sequences as shown in SEQ ID NOs. 2-4 in detecting the sugar content of tomatoes.
[0026] Specifically, the primer set carries a fluorescent group, which includes but is not limited to: FAM, VIC and CY5.
[0027] In another aspect, the present invention provides use of the primer set described above in detecting the sugar content of tomatoes.
[0028] In yet another aspect, the present invention provides a kit comprising the above primer set.
[0029] Specifically, the kit also includes other reagents required for KASP.
[0030] More specifically, the reagents include but are not limited to: Taq DNA polymerase, free nucleotides (dNTPs), MgCl2 and buffer.
[0031] Compared with the prior art, the present invention has the following advantages:
[0032] The present invention relies on a single SNP site to predict the high-sugar trait of tomatoes. The KASP (competitive allele PCR) involved in the present invention detects SNP sites by carrying different fluorescent groups, and has the advantages of high accuracy, fast detection speed, and low cost.
[0033] The screening method provided by the present invention can greatly shorten the breeding period and is beneficial to improving the purity of parents. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 This is a graph showing the genotyping results of tomato sugar content and base 55876054 on chromosome 11.
[0035] Figure 2 This is a genotyping test diagram of SNP markers closely linked to the sugar content of tomato fruit in the population. DETAILED DESCRIPTION
[0036] The present invention will be further described in detail below with reference to specific examples. The following examples are not intended to limit the present invention but are merely intended to illustrate the present invention. The experimental methods used in the following examples are generally based on conventional conditions unless otherwise specified. The materials and reagents used in the following examples are all commercially available unless otherwise specified.
[0037] Example 1 Validation of SNP markers in natural populations
[0038] According to SEQ ID NO.1 (TTTTACCACTATTTTCTGTGAACACATTAATTACCATGGCGCACAATAGCAGTAGCAGGAGAAGACCTAACATACTGATAACCGGAACGCCGGGCACCGG[G / A]AAAACGACGACGTCGTCTGCACTGGCGGAGGCGACGCAGCTCCGGCATATCAACATCGGTGAACTGGTGAAAGAGAAGAAGTTGCACGACGGATGGGACG), paired-end sequencing was performed using second-generation sequencing technology and aligned to the tomato SL3.0 reference genome for BSA positioning analysis. The results were combined with the 20K liquid phase gene chip data for joint analysis. The results are shown in Figure 1. Figure 1 A SNP molecular marker closely linked to the sugar content of tomatoes was obtained at base 55876054 on chromosome 11 of tomato.
[0039] KASP-tagged primers were designed based on the upstream and downstream sequences of the SNP site (shown in SEQ ID NO. 1). The hop-F1 sequence is 5'-GATAACCGGAACGCCGGGCACCGGG-3' (SEQ ID NO. 5), with the FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO. 7) added to its 5' end. The hop-F2 sequence is 5'-GATAACCGGAACGCCGGGCACCGGA-3' (SEQ ID NO. 6), with the VIC fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO. 8) added to its 5' end. The common reverse primer, hop-R, is 5'-CGTCGCCTCCGCCAGTGCAGACGACGTCG -3' (SEQ ID NO. 4). The complete sequences used for KASP are shown in Table 1.
[0040] Table 1 KASP labeled primers
[0041]
[0042] 178 tomato samples with known sugar content were obtained from the Shanghai Academy of Agricultural Sciences and Shanghai Funong Seed Co., Ltd. Genomic DNA was extracted from the tomato samples to be tested. PCR amplification was performed using the primers listed in Table 1. The amplified target fragments were sequenced, and the sequencing peaks were examined to analyze the genotypes of the tomato samples to be tested.
[0043] The specific experimental steps are as follows:
[0044] (1) Extracting the tomato genomic DNA to be tested:
[0045] 1) Take 0.1g of young leaves of the selected variety, place them in a sampling tube, put them into liquid nitrogen and grind them.
[0046] 2) Add 700 μL of CTAB to the sample tube and vortex for 2-3 minutes.
[0047] 3) Incubate in a 65°C water bath for 60 min, shaking the tube 2-3 times during the water bath.
[0048] 4) Add 700 μL of chloroform / isoamyl alcohol (v / v) = 24:1 and shake manually for 5 minutes.
[0049] 5) Centrifuge at room temperature, 12,000 rpm, for 10 minutes.
[0050] 6) Pipette 400 μL of the supernatant, add 400 μL of isopropanol, shake well, and cool at -80°C for 10 min.
[0051] 7) Centrifuge the sample at 12000 rpm for 5 minutes at room temperature.
[0052] 8) Pour off the supernatant, add 500 μL of 75% alcohol, shake, and centrifuge at 12,000 rpm for 5 minutes.
[0053] 9) Pour out the alcohol, place it in a clean bench to dry, and add 30-50 μL of ultrapure water.
[0054] 10) Determine the concentration of the extracted DNA and dilute the extracted DNA 50-fold (DNA concentration 25-50 ng / μL).
[0055] (2) Using tomato genomic DNA as a template, KASP reaction detection was performed using SEQ ID NO. 2-4;
[0056] PCR system: A 10 μL system was used, consisting of 5 μL of KASP PCR Mix (BGH1001RV5F, Guangzhou Good Biotechnology Co., Ltd.), 2 μL of DNA, 0.1 μL of hop-F1, 0.1 μL of hop-F2, 0.3 μL of hop-R, and 2.5 μL of ddH2O.
[0057] PCR amplification was performed on a BIORAD real-time quantitative instrument. The PCR amplification program was as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 58°C annealing and extension for 20 s, for a total of 38 cycles; and finally, genotyping data were read at 30°C for 30 s. Results are available at Figure 2 , where G:G is the low-sugar homozygous genotype, A:A is the high-sugar homozygous genotype, G:A is the heterozygous type, and NTC is the no-template control. Figure 2 The results showed that the typing effect was good.
[0058] (3) Judgment criteria: When testing the sugar content of tomato fruit, if only the fluorescent signal corresponding to the fluorescent sequence connected to primer hop-F1 is detected, the tomato to be tested is low in sugar and its genotype is GG; if only the fluorescent signal corresponding to the fluorescent sequence connected to primer hop-F2 is detected, the tomato to be tested is judged to be high in sugar and its genotype is AA; if both fluorescence signals are detected at the same time, the tomato to be tested is judged to be heterozygous, and the genotype is heterozygous GA. The experimental results of 178 tomato materials are shown in Table 2.
[0059] Table 2 Genotypes and fruit sugar content of 178 tomato materials
[0060]
[0061] Population experiments confirmed that molecular markers were closely associated with tomato sugar content. Of the 178 populations tested, 69 had sugar contents less than 7, and 109 had sugar contents greater than or equal to 7. The base types at test site 55876054 for high-sugar accessions were either A:A or G:A; the base types at test site 55876054 for low-sugar accessions were G:G. The genotypes and fruit sugar contents of the 178 tomato accessions are shown in Table 1. Sixty-six accessions were detected with the G:G genotype at this site, all with sugar contents less than 7; 103 accessions were detected with the A:A genotype, and six accessions were detected with the G:A genotype at site 55876054, all with sugar contents greater than 7.
[0062] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.
Claims
1. A method for detecting the sugar content of tomato fruit, characterized in that: The following steps are involved: S1: Extract genomic DNA; S2: Identification of the base at 55876054 bp on chromosome 11 of the tomato SL3.0 reference genome; S3: Make a judgment based on the result of S2; It is characterized in that, in step (3), the judgment criteria are as follows: if the genotype is GG, the tomato to be tested is judged to be low in sugar; if the genotype is AA, the tomato to be tested is judged to be high in sugar; if the genotype is GA, the tomato to be tested is judged to be high in sugar.
2. The detection method according to claim 1, wherein In step (2), the identification methods include: KASP, first-generation sequencing, second-generation sequencing, Taqman probe method and HRM method.
3. The detection method according to claim 2, characterized in that When the identification method is the KASP method, the primers used include SNP site competitive primers F1: GATAACCGGAACGCCGGGCACCGGG and F2: GATAACCGGAACGCCGGGCACCGGA, a fluorescent tag sequence connected to the 5' end of the SNP site competitive primer and a universal primer.
4. The detection method according to claim 3, characterized in that The primer sequences are shown in SEQ ID NO. 2-4.
5. The detection method according to claim 4, characterized in that In step (2), the KASP reaction amplification system includes: KASP PCR Mix 3-7 μL, DNA 1-3 μL, and each primer 0.1-0.5 μL.
6. The detection method according to claim 4, characterized in that In step (2), the KASP reaction amplification conditions are as follows: pre-denaturation at 94-96°C for 5-10 min; denaturation at 94-96°C for 5-10 s, annealing and extension at 56-60°C for 20-30 s, for a total of 35-40 cycles; and finally, reading the genotyping data at 29-31°C for 20-30 s.
7. Application of the primer set with sequences as shown in SEQ ID NO. 2-4 in detecting sugar content of tomatoes.
Citation Information
Patent Citations
A method, reagent kit, and application for assisting in the screening of tomato materials with high sugar content.
CN112442544B