Molecular marker located in AhPS gene and related to peanut hundred fruit weight character and application of molecular marker
Through the 20bp InDel molecular marker found in the peanut AhPS gene, the selection efficiency and accuracy problems caused by the limited molecular marker and large positioning interval of peanut fruit are solved, and the accurate identification and efficient selection of peanut fruit traits are achieved.
Patent Information
- Application Number
- CN202510395518.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-06-06
AI Technical Summary
In the prior art, the molecular markers of peanuts weighing 100 fruits are limited, and due to the large positioning interval, separation is prone to occur between the target gene and the marker, resulting in limited efficiency and accuracy of the target trait selection.
A InDel molecular marker located in the AhPS gene is provided with a size of 20 bp and located on the Peanut A05 chromosome for identification of peanut traits. This marker is located in the 5'UTR region of the AhPS gene, and corresponds to small fruits when a specific base sequence exists and large fruits when missing.
Through the use of this molecular marker, the peanut traits can be accurately and reliably identified, with stable results, quick operation, and low detection cost, avoiding the risk of environmentally affected by the selection efficiency and accuracy of target traits.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant molecular biology, and in particular to a PcS Molecular markers within genes associated with peanut fruit weight and their applications. Background Art
[0002] peanut( Arachis hypogea L. ) is an important economic and oil crop in the world. 100-fruit weight is one of the key components of peanut yield per plant, and improving peanut fruit weight has always been an important direction of peanut genetic improvement research.
[0003] The variation of 100-fruit weight in Chinese peanut resources ranges from 60 grams to 250 grams, and a small amount of large-fruit materials can reach 300 grams, which has great potential for genetic improvement. However, 100-fruit weight is a complex quantitative trait that is easily affected by the environment. The selection of peanut pod weight during breeding is mainly based on phenotypic observation, and its selection efficiency is often not high and the cycle is long.
[0004] Using molecular markers for assisted selection breeding of target traits can greatly improve the efficiency of genetic improvement. However, the number of peanut 100-fruit weight molecular markers developed based on QTL positioning is limited, and due to the large positioning interval, the target gene and marker are easily separated, resulting in limited efficiency and accuracy in target trait selection. Summary of the invention
[0005] The purpose of the present invention is to provide a PcS Molecular markers within genes associated with peanut fruit weight and their applications.
[0006] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a PcS The molecular marker related to the peanut fruit weight trait in the gene is an InDel marker (size 20 bp) located on the peanut chromosome A05 as shown in SEQ ID NO:5 PcS Gene 485-504bp (peanut PcS The 5'UTR region of the gene), when the 484-504bp bases are AGATGGAGGAATATTATGCA, it corresponds to a small peanut fruit with a smaller 100-fruit weight, and when the 485-504bp bases are missing, it corresponds to a large peanut fruit with a higher 100-fruit weight.
[0007] The peanut PcS The reference sequence number of the gene in NCBI is LOC112802510.
[0008] In a second aspect, the present invention provides primers for amplifying the molecular markers.
[0009] Furthermore, the primers include an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3.
[0010] In a third aspect, the present invention provides a reagent or a kit containing the primer.
[0011] In a fourth aspect, the present invention provides any of the following applications of the molecular marker, the primer, the reagent or the kit: (1) Used to identify the weight of peanut fruit; (2) Used for identification, improvement or molecular marker-assisted breeding of peanut germplasm resources; (3) Used for early prediction of peanut fruit weight; (4) Used to screen peanuts with high fruit weight.
[0012] In a fifth aspect, the present invention provides a method for identifying peanut fruit weight, comprising the following steps: (1) Extracting genomic DNA from peanuts to be tested; (2) using genomic DNA as a template and performing PCR amplification using the primers shown in SEQ ID NO: 2-3; (3) Analyze the PCR amplification products.
[0013] Furthermore, step (3) includes: the peanuts corresponding to the amplification product having a 139 bp specific band have a higher 100-fruit weight than the peanuts corresponding to the amplification product having a 159 bp specific band (the gene shown in SEQ ID NO:4 corresponds to large-fruit peanuts, and the gene shown in SEQ ID NO:5 corresponds to small-fruit peanuts).
[0014] In a sixth aspect, the present invention provides PcS The application of genes in regulating peanut fruit weight traits; Said PcS The genes are: i) the nucleotide sequence shown in SEQ ID NO:5; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 5 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:5 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function; The regulation is positive regulation.
[0015] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention uses DNA molecular marker technology to identify the peanut fruit weight trait, and the result is accurate and reliable, and is not affected by external environmental factors. The InDel molecular marker provided by the present invention has the characteristics of stable detection results, fast operation, good stability, and low detection cost.
[0016] The molecular marker of the present invention is designed based on the large fruit allele variation of the stable major effect QTL gene controlling the hundred-fruit weight of peanut. The marker is co-segregated with the key gene controlling the target trait, avoiding the risk of recombination separation of general linkage markers and the target trait. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 The comparison is for the agronomic traits (main stem height, number of branches, number of pods per plant) and pod yield-related traits (pod weight, pod length, pod width, pod yield per plant) of the near-isogenic lines NIL_BP and NIL_SP in the preferred embodiment of the present invention. Indicates that there are statistically significant differences between near-isogenic lines (using T-test, p value ≤ 0.01).
[0018] Figure 2 The target interval and candidate genes within the interval are determined based on the genotype and phenotype of the recombinant exchanged individual family in a preferred embodiment of the present invention. The different letters (a and b) on the bar graph represent statistically significant differences in the pod size-related phenotypes between the families (using Tukey's multiple comparison test, p value ≤ 0.01), Figure 2 The expression levels of the three candidate genes shown at the bottom are respectively at different developmental stages (PR1, PR3 and PR5) of the three pods of the near-isogenic lines.
[0019] Figure 3 In the preferred embodiment of the present invention, the target gene of peanut is detected by using Arabidopsis homologous gene mutants. PcS Backfill experiment, backfill results show PcS The gene can partially complement the mutant's shortened pod phenotype.
[0020] Figure 4 In a preferred embodiment of the present invention, the developed molecular marker InDel_PS is used to amplify a 139 bp band at NIL_BP of the large fruit allele variation site, and a 159 bp band at NIL_SP of the near isogenic line of the small fruit allele variation site.
[0021] Figure 5This is the effect of the molecular marker InDel_PS on the pod weight phenotype after genotype selection of 99 peanut core germplasm resources in the preferred embodiment of the present invention. Indicates that there are statistically significant differences between near-isogenic lines (using T-test, p value ≤ 0.01).
[0022] Figure 6 This is the effect of the molecular marker InDel_PS on pod yield after genotype selection of 22 peanut lines in a preferred embodiment of the present invention. Indicates that there are statistically significant differences between near-isogenic lines (using T-test, p value ≤ 0.05).
[0023] Figure 7 This is a comparison of transgenic materials with target gene mutations obtained using gene editing vectors and their pod size-related phenotypes in the preferred embodiment of the present invention. Different letters in the bar graph indicate statistically significant differences between the materials (Tukey's Multiple Comparison Test, p ≤0.05). DETAILED DESCRIPTION
[0024] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0025] Example 1 Location of peanut large fruit high yield alleles and development of co-segregating molecular markers This example locates the peanut large-fruit high-yield allele and develops co-segregating molecular markers for molecular marker-assisted selection of large-fruit high-yield peanut materials.
[0026] By using the heterozygous residues in the high-generation recombinant inbred line population (Xuzhou 68-4 and Yuanza 9102), the target locus near-isogenic lines (NIL_BP and NIL_SP) were obtained. The target locus large fruit allele variation came from Xuzhou 68-4 (BP), and the small fruit allele variation came from Yuanza 9102 (SP). There were no significant differences in the main stem height, branch number, and number of full fruits per plant between the near-isogenic lines, but there were significant differences of about 20% in pod size and fruit weight. Two field experiments showed that the pod yield per plant between the near-isogenic lines also varied by 7.8%-8.6% ( Figure 1 ), the results showed that this site could control peanut pod size and affect pod yield.
[0027] Fine mapping was carried out using the F2 segregating population constructed from near-isogenic lines, and a major QTL interval controlling peanut 100-fruit weight was located within a 116.6 Kb interval on chromosome A05 ( Figure 2 ), there are three candidate genes in this interval, and their expression levels are not significantly different between the parents of the near-isogenic lines. At the same time, Xuzhou 68-4 and Yuanza 9102 were resequenced, and 9 SNPs and 1 InDel mutation were found in the target segment, of which 3 SNPs occurred in Arahy.L1PMVE In the gene coding region, a non-synonymous mutation occurred, and a 20-bp InDel occurred in Arahy.L1PMVE In the 5'UTR region, another SNP occurred in the gene Arahy.MDT0NR The remaining 5 SNPs occurred in the intergenic region, and no SNP variation was found in the gene Arahy.7T3N35. Arahy.L1PMVE The target gene is named PcS .
[0028] cloned from the genomic DNA of Xuzhou 68-4 PcS The large fruit allele sequence (LOC112802510) was used to perform BLASP sequence comparison in the NCBI database, and two Arabidopsis genes ( AT3G48060 and AT3G48050 ) is its homologous gene ( Figure 3 ). The Arabidopsis thaliana double mutant with both genes mutated was obtained, and the average pod length was found to be 30.3% lower than that of the wild type (WT). Arahy.L1PMVE The large fruit allele (OE-BP) can increase the pod length by 8.7%-26.6% compared with the double mutant materials. PcS The gene has the function of regulating fruit size.
[0029] against PcS The gene contained a co-segregated 20 bp insertion-deletion sequence variation AGATGGAGGAATATTATGCA (SEQ ID NO: 1). A pair of primers InDel_PS were designed to distinguish the large and small fruit functional alleles of the gene (Table 1).
[0030] Table 1 Primer InDel_PS information
[0031] The PCR amplification method is as follows: extracting genomic DNA from peanuts to be tested; using the genomic DNA as a template, performing PCR amplification using primers InDel_PS-F and InDel_PS-R (SEQ ID NO: 2-3); and analyzing the PCR amplification product.
[0032] The PCR amplification reaction system is:
[0033] The PCR amplification reaction procedure is:
[0034] In the near-isogenic line NIL_BP with the large fruit allele, a 139 bp band was amplified, while in the near-isogenic line NIL_SP with the small fruit allele, a 159 bp band was amplified ( Figure 4 ). The marker was used to identify the genotypes of 99 peanut core germplasm resources. The genotyping results showed that the germplasm with amplified 139bp band (large fruit allele) increased the average 100-fruit weight by 25.72% (41.87 g), 29.37% (43.22), 33.93% (47.55 g), 27.90% (37.65 g), and 23.47% (36.44 g) under five environments, compared with the germplasm with amplified 159bp band (small fruit allele) ( Figure 5 ). This marker was used to genotype 22 peanut lines, of which 16 materials carried the 139bp genotype, and the remaining 6 lines carried the 159bp genotype. Field yield measurement results showed that the average yield of peanut pods per mu of the 16 139bp genotype peanut lines was 10.92% higher than that of the 6 159bp genotype peanut lines (32.89 kg, Figure 6 ).
[0035] Example 2 Peanuts PcS Functional verification of genes Fine-mapped the target interval on chromosome A05 (116.6 Kb). PcS Gene( Arahy.L1PMVE ) and its adjacent J domain-containing protein gene ( Arahy.7T3N35 ) are only ~13Kb apart, the amino acid sequences of the two genes are 79.8% identical, and both have conserved domains BAH, TFS2N, and GW. It is speculated that there may be redundancy in the functions of the two genes and they are closely linked genetically.
[0036] To verify PcS Gene function, we target PcS Gene( Arahy.L1PMVE) and the adjacent J domain-containing protein gene ( Arahy.7T3N35 ) and the homologous copies of these two genes on chromosome B05 Arahy.IRQL5F ( PcS B subgenome copy) and Arahy.6CM8KD ( Arahy.7T3N35 We designed four sgRNAs (T1-T4) on the CRISPR-Cas9 vector to mutate these four genes ( Figure 7 ). The nucleotide sequences of each sgRNA targeting site are as follows (5′-3′): T1: GTTGGACGAATGGCTCCAGG T2: CAGCTCATGCAACCAGACAA T3: AGCGTGATGATTGTCTTAGC T4: TTAGATCTGAGAGCATGTTG sgRNAs T1 and T2 target PcS and Arahy.IRQL5F Genes targeted by sgRNAs T3 and T4 Arahy.7T3N35 and Arahy.6CM8KD A total of four different types of gene mutation transgenic lines (L10, L8, L6, L7) were obtained from the transgenic offspring, of which L10 only caused Arahy.7T3N35 and its copy gene ( Arahy.6CM8KD ) frameshift mutation, L7 caused Arahy.7T3N35 and its copy gene ( Arahy.6CM8KD ) frameshift mutation and PcS amino acid mutations, L8 and L6 caused frameshift mutations in four genes. Compared with the transgenic material without gene mutation (Null), the pod length, width and 100-fruit weight of L10 did not change significantly, while the pod length, width and 100-fruit weight of L8, L6 and L7 were significantly lower than those of Null, indicating that Arahy.7T3N35 and its copy gene ( Arahy.6CM8KD ) alone did not affect pod size. In addition, the three genes ( PcS + Arahy.7T3N35+Arahy.6CM8KD ) The pod length, width and 100-fruit weight of mutant material L7 were 18.46%, 7.021% and 49.62% lower than those of two-gene mutant material L10, while those of four-gene mutant material L8 were 52.38%, 34.89% and 78.19% lower than those of L10. The above results show that PcS Gene( Arahy.L1PMVE ) and the adjacent J domain-containing protein gene ( Arahy.7T3N35 ) Functional redundancy positively regulates pod size. PcS The two copies of the gene in the AB subgenome have a dosage effect in regulating the function of peanut pods.
[0037] In summary, combined with Example 1 PcS Fine mapping of genes, and PcS In the experiment of complementing Arabidopsis homologous gene mutants, in Example 2, PcS Analysis of gene mutation phenotypes PcS The gene has the function of regulating peanut pod size.
[0038] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.
Claims
1. Located PcS The molecular markers in the gene related to the peanut fruit weight trait are characterized by: It is an InDel marker located on peanut chromosome A05 as shown in SEQ ID NO:5 PcS At the 484th-504th bp of the gene, when the 484th-504th bp bases are AGATGGAGGAATATTATGCA, it corresponds to a small peanut fruit with a smaller 100-fruit weight. When the 484th-504th bp bases are missing, it corresponds to a large peanut fruit with a higher 100-fruit weight.
2. A primer for amplifying the molecular marker according to claim 1, characterized in that: It includes an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:
3.
3. A reagent or kit containing the primer according to claim 2.
4. Any of the following uses of the molecular marker according to claim 1, the primer according to claim 2, or the reagent or kit according to claim 3: (1) Used to identify the weight of peanut fruit; (2) Used for identification, improvement or molecular marker-assisted breeding of peanut germplasm resources; (3) Used for early prediction of peanut fruit weight; (4) Used to screen peanuts with high fruit weight.
5. A method for identifying peanut fruit weight, characterized in that: The steps include: (1) Extracting genomic DNA from peanuts to be tested; (2) using genomic DNA as a template, and performing PCR amplification using the primers shown in SEQ ID NO: 2-3; (3) Analyze the PCR amplification products.
6. The method according to claim 5, characterized in that Step (3) includes: peanuts corresponding to the amplification product having a 139 bp specific band have a higher hundred-fruit weight than peanuts corresponding to the amplification product having a 159 bp specific band.
7. PcS The application of genes in regulating peanut fruit weight traits; Said PcS The genes are: i) the nucleotide sequence shown in SEQ ID NO:5; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 5 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:5 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function; The regulation is positive regulation.