Molecular marker for detecting melon pulp color character and application

By developing single nucleotide polymorphism label CmSNP21 and corresponding KASP-SNP labeling primers, the problem of low detection efficiency of melon pulp color traits in the prior art is solved, and efficient and accurate detection is achieved, which is suitable for the needs of medium and high throughput in commercial breeding.

CN120099219APending Publication Date: 2025-06-06TIANJIN DERUITE SEED IND CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510484746.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

In the prior art, the efficiency of detecting the color traits of melon pulp is low and is not suitable for the medium and high-throughput detection requirements of commercial breeding.

Method used

A single nucleotide polymorphism label CmSNP21 was developed to detect melon pulp color by designing KASP-SNP labeling primers suitable for commercial kit detection procedures.

Benefits of technology

It has achieved efficient and accurate detection of color and traits of melon pulp, which is suitable for the needs of medium and high-throughput detection in commercial breeding, and the consistency between genotype and phenotype can reach 95.6%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099219A_ABST
    Figure CN120099219A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker for detecting muskmelon pulp color traits and application, the molecular marker is a single nucleotide polymorphism marker, and the molecular marker is shown as SEQ ID NO.1; wherein the 89th basic group combination type shown in the SEQ ID NO.1 nucleotide sequence is related to the melon pulp color character. The molecular marker is a KASP-SNP marker and can be used for a high-throughput molecular detection technology system, and compared with a second-generation molecular marker, the molecular marker has the advantages that the detection mode is simpler, more convenient and more accurate, and the detection efficiency is higher.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the field of genome sequence and plant biotechnology, and in particular to a molecular marker for detecting melon flesh color traits and an application thereof. Background Art

[0002] Muskmelon (Cucumis melo L.) is an important cash crop of the Cucurbitaceae family, and one of the world's top ten fruits. According to statistics, my country is the world's largest producer and consumer of melons, with a planting area and output accounting for about 50% of the world's total. It is also the world's largest melon producer under facility cultivation. As a high-profit cash crop that is most suitable for facility cultivation, melon plays an important role in increasing agricultural efficiency. Cultivating high-quality and innovative melon varieties has far-reaching significance for the development of the melon industry. Flesh color is one of the important traits of melons. It is an important goal of melon breeding to achieve efficient transfer of flesh color genes and select materials with different flesh colors.

[0003] Marker-assisted selection (MAS) is a new breeding model that combines modern molecular biology with traditional genetic breeding. It can use molecular markers to select target plants at the DNA level at any stage of plant development, thereby making up for many drawbacks in traditional breeding and becoming an effective way to improve the efficiency of target trait breeding. Among them, molecular marker-assisted selection using high-throughput molecular marker detection technology is an effective way to improve the efficiency of flesh color trait breeding and detection.

[0004] Single-nucleotide polymorphism (SNP) refers to DNA sequence polymorphism at the genome level caused by variations at the level of a single nucleotide in the genomic nucleotide sequence, mainly including the deletion, insertion, conversion and transversion of a single base. SNP markers are the third-generation molecular markers developed on this basis. This type of marker has the characteristics of low mutation frequency, high genetic stability, abundant sites, wide distribution, rapid detection and large-scale screening. Compared with the second-generation molecular markers, SNP markers do not need to be typed according to the size of DNA fragments, and can get rid of the traditional gel electrophoresis, which is a relatively cumbersome, low-throughput and expensive detection method, and is more suitable for high-throughput molecular marker detection technology.

[0005] The prior art found that melon flesh color is controlled by two major genes: the green flesh gene gf, and the white flesh gene wf. The orange flesh gene is Gf, which is dominant to the green flesh gene gf and has a dominant epistatic effect on the white flesh gene wf. The prior art has developed the InDel-Or1 marker for detecting melon flesh color using the intron sequence of the CmOr gene; or, by constructing the F 2 Separate the population, establish the BSA (Bulked Segregation Analysis) mixed pool method to screen out the markers SSR2021 and SSR2103 that are closely linked to gf, and the markers SSR2956 and SSR2980 that are closely linked to wf. Although the above markers can be used for molecular marker-assisted selection, the detection efficiency is relatively low and is not suitable for high-throughput detection needs in commercial breeding. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a molecular marker and application for detecting melon pulp color traits, so as to solve the problem that the prior art has relatively low detection efficiency and is not suitable for high-throughput detection requirements in commercial breeding.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] A molecular marker for detecting the color trait of melon flesh, the molecular marker is a single nucleotide polymorphism marker, and the molecular marker is shown in SEQ ID NO.1; wherein the base combination type at position 89 shown in the nucleotide sequence of SEQ ID NO.1 is related to the color trait of melon flesh.

[0009] The sequence of SEQ ID NO.1 is as follows:

[0010] 5'-GATACTTGGCATGTGCTCGCTGTTCAAACACAGGAGCTCTTGTGCTGATTG AGCCAGTATCGACTTTAAATGGTGAACATCAGCCTCT[G / A]TCGCTACCTAAGACTGAAAGATGCCAAAATTGTTCGGGTTCAGGAAAG-3'.

[0011] Note: [] The SNP polymorphism site of CmSNP21 marker is shown in brackets, but the sequences of this region may be different in different melon materials. Any SNP variation occurring in this region may become the basis for developing linkage markers. Therefore, any variation in this region should be considered as protected content.

[0012] Preferably, the base combination at position 89 is G / G, and the melon flesh color trait is orange; the base combination at position 89 is A / A, and the melon flesh color trait is non-orange; the base combination at position 89 is G / A, and the melon flesh color trait is orange and incompletely dominant.

[0013] The present invention provides an application of a molecular marker, and the application of the molecular marker in melon molecular marker-assisted breeding, melon flesh trait-assisted identification and assisted breeding, melon flesh trait-assisted identification, and melon flesh trait screening.

[0014] The present invention provides a primer combination, which is used to detect the above-mentioned molecular marker; the primer combination comprises:

[0015] The upstream primer CmSNP21F1 having a nucleotide sequence as shown in SEQ ID NO.2;

[0016] The sequence of SEQ ID NO.2 is as follows:

[0017] 5'-GAAGGTCGGAGTCAACGGATTAATGGTGAACATCAGCCT CTG-3'.

[0018] The upstream primer CmSNP21F2 having a nucleotide sequence as shown in SEQ ID NO.3;

[0019] The sequence of SEQ ID NO.3 is as follows:

[0020] 5'-GAAGGTGACCAAGTTCATGCTTTAAATGGTGAACATCAGCCTCTA-3'.

[0021] The downstream primer CmSNP21R having a nucleotide sequence as shown in SEQ ID NO.4;

[0022] The sequence of SEQ ID NO.4 is as follows:

[0023] 5'-AACAATTTTGGCATCTTTCAGTCT-3'.

[0024] The present invention provides a kit for detecting the above-mentioned molecular markers, comprising: the above-mentioned primer combination.

[0025] The present invention provides a method for identifying the color trait of melon flesh, and the molecular markers are detected on the melon to be detected, so as to determine the color trait of the melon flesh to be detected.

[0026] Preferably, the above primer combination or the above kit is used to perform PCR amplification on the genomic DNA of the melon to be tested, and the amplified product is subjected to genotyping detection of SNP sites to further determine the flesh color trait of the melon sample to be tested.

[0027] Preferably, the specific steps are as follows:

[0028] Step 1: Extracting genomic DNA from the melon sample to be tested;

[0029] Step 2: using the genomic DNA of the melon sample to be tested obtained in step 1 as a template, and performing a PCR amplification reaction on it using the primer combination described in claim 4 to obtain a PCR product;

[0030] Step 3: Perform genotyping detection of the SNP loci on the PCR product obtained in step 2, and then determine the flesh color trait of the melon sample to be tested.

[0031] In step 2, the reaction system for 5 μL PCR amplification includes: 0.5 μL of genomic DNA with a sample concentration of 50 ng / μL, 0.07 μL of primer mixture, 2×KASP Mix 2.5 μL, ddH 2 O 1.93 μL; wherein, in the primer mixture, the concentration of the upstream primer CmSNP21F1 is 25 μmol / L, the concentration of the upstream primer CmSNP21F2 is 25 μmol / L, and the concentration of the downstream primer CmSNP21R is 50 μmol / L.

[0032] In step 2, the amplification conditions were: pre-denaturation at 94°C for 10 min, 1 cycle; denaturation at 94°C for 15 s, 61°C for 1 min-0.6°C / cycle, 29 cycles; denaturation at 94°C for 15 s, annealing at 55°C for 60 s, 44 cycles.

[0033] In step 3, if the result is Homozygous Allele 1 / Allele 1, the genotype of the SNP site is G / G, and the sample is an orange flesh material; if the result is HomozygousAllele 2 / Allele 2, the genotype of the SNP site is A / A, and the sample is a non-orange flesh material; if the result is Heterozygous Allele 1 / Allele 2, the genotype of the SNP site is G / A, and the sample is a material that expresses orange flesh and is incompletely dominant in orange.

[0034] The present invention also provides a melon assisted breeding method, the method comprising:

[0035] By using the above method, the above molecular markers in the melon to be tested are detected so as to determine the color trait of the melon flesh to be tested.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] 1. The present invention has developed a KASP-SNP marker co-segregating with the melon flesh color gene CmOr: CmSNP21. The marker was developed from the G 852 The SNP site mutated to A had a consistency of 95.6% with the phenotypic result, and the consistency of the homozygous genotype with the phenotype was 100%, indicating that the marker can be used in the molecular marker-assisted selection of the orange flesh gene CmOr in melon.

[0038] 2. The present invention provides an application method of the KASP-SNP marker for molecular marker-assisted selection of melon flesh color traits.

[0039] 3. The molecular marker of the present invention is a KASP-SNP marker, which can be used in a high-throughput molecular detection technology system. Compared with the second-generation molecular marker, the detection method is simpler, more accurate and more efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the location map of the CmSNP21 marker SNP mutation site in the CmOr gene cDNA sequence.

[0041] Figure 2 This is the typing diagram of CmSNP21 marker in 46 melon test samples; the red data points in the figure represent the material set of HomozygousAllele 1 / Allele 1, i.e., G / G genotype, the blue data points represent the material set of HomozygousAllele2 / Allele 2, i.e., A / A genotype, and the green data points represent the material set of HeterozygousAllele 1 / Allele 2, i.e., G / A genotype.

[0042] Figure 3 This is an information chart of the 46 melon materials tested.

[0043] Figure 4 For CmSNP21 marker, the first F 2 Genotyping plots of segregating populations.

[0044] Figure 5 The second F 2 Genotyping plots of segregating populations. DETAILED DESCRIPTION

[0045] The present invention will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the present invention belong to the scope of protection of the present invention.

[0046] Unless otherwise indicated in specific cases in the present invention, the numerical ranges listed herein include the upper and lower limits, and all integers and fractions within the range, and are not limited to the specific values ​​listed when defining the range.

[0047] 1. A molecular marker for detecting melon flesh color traits

[0048] The molecular marker is a single nucleotide polymorphism marker, and the molecular marker is shown in SEQ ID NO.1; wherein, the base combination type at position 89 shown in the nucleotide sequence of SEQ ID NO.1 is related to the melon flesh color trait.

[0049] The sequence of SEQ ID NO.1 is as follows:

[0050] 5'-GATACTTGGCATGTGCTCGCTGTTCAAACACAGGAGCTCTTGTGCTGATTG AGCCAGTATCGACTTTAAATGGTGAACATCAGCCTCT[G / A]TCGCTACCTAAGACTGAAAGATGCCAAAATTGTTCGGGTTCAGGAAAG-3'.

[0051] Note: [] The SNP polymorphism site of CmSNP21 marker is shown in brackets, but the sequences of this region may be different in different melon materials. Any SNP variation occurring in this region may become the basis for developing linkage markers. Therefore, any variation in this region should be considered as protected content.

[0052] After studying the prior art, the present invention found that the prior art has found that the gene Gf (CmOr) controlling the orange flesh of melon is located between 5207122bp and 5214439bp of scaffold 5 of chromosome 9 of melon, and at the same time cloned and obtained the cDNA sequence of Gf (CmOr) and its alleles (sequence information is logged in GenBank, orange flesh gene sequence accession number KM505046.1, non-orange flesh gene sequence accession number KM505047.1), and proved to be co-segregated with the color of melon flesh, and can distinguish orange flesh from non-orange flesh. At the same time, the prior art has found that there are 6 SNP mutations between the allele cDNA sequences, which can be used to develop molecular markers for melon flesh color trait transformation for auxiliary selection. After comparing and analyzing these mutation points, the present invention unexpectedly found that G 852 The G→A mutation at the site has a very high degree of discrimination. Based on this discovery, the present invention designs a KASP-SNP marker primer suitable for the detection process of a commercial kit (KASP technology) for detecting the color of melon flesh. Subsequent verification shows that the marker can stably distinguish between orange and non-orange flesh and has excellent commercial value.

[0053] 2. A primer composition

[0054] The primer composition is used to detect the above-mentioned molecular marker; the primer composition comprises:

[0055] The upstream primer CmSNP21F1 having a nucleotide sequence as shown in SEQ ID NO.2;

[0056] The sequence of SEQ ID NO.2 is as follows:

[0057] 5'-GAAGGTCGGAGTCAACGGATTAATGGTGAACATCAGCCT CTG-3'.

[0058] The upstream primer CmSNP21F2 having a nucleotide sequence as shown in SEQ ID NO.3;

[0059] The sequence of SEQ ID NO.3 is as follows:

[0060] 5'-GAAGGTGACCAAGTTCATGCTTTAAATGGTGAACATCAGCCTCTA-3'.

[0061] The downstream primer CmSNP21R having a nucleotide sequence as shown in SEQ ID NO.4;

[0062] The sequence of SEQ ID NO.4 is as follows:

[0063] 5'-AACAATTTTGGCATCTTTCAGTCT-3'.

[0064] According to the use requirements of the KASP genotyping detection kit used in the present invention, the forward primers F1 and F2 are nucleotide sequences of 18-25bp (including the base of the SNP site) upstream of the SNP site, and a VIC or FAM linker is added to the 5' end of the sequence; the reverse primer needs to be designed using primer design software such as Primer3.0, and the reverse primer design principle is: the primer length is 18-25bp, the GC content is 40-60%, and the Tm value (annealing temperature) is 55-62° C. Similarly, the above primers can be designed for detecting the SNP site according to the technical requirements of kits from different companies (such as TaqMan fluorescent primer labeling technology used for SNP genotyping by Thermo Fisher Scientific, etc.), with reference to the above principles.

[0065] 3. A method for identifying the color characteristics of melon flesh

[0066] The above molecular markers are detected on the melon to be tested so as to determine the color trait of the flesh of the melon to be tested.

[0067] Preferably, the above primer combination or the above kit is used to perform PCR amplification on the genomic DNA of the melon to be tested, and the amplified product is subjected to genotyping detection of SNP sites to further determine the flesh color trait of the melon sample to be tested.

[0068] Preferably, the specific steps are as follows:

[0069] Step 1: Extracting genomic DNA from the melon sample to be tested;

[0070] Step 2: using the genomic DNA of the melon sample to be tested obtained in step 1 as a template, and performing a PCR amplification reaction on it using the primer combination described in claim 4 to obtain a PCR product;

[0071] Step 3: Perform genotyping detection of the SNP loci on the PCR product obtained in step 2, and then determine the flesh color trait of the melon sample to be tested.

[0072] Wherein, in step 2, the reaction system for 5 μL PCR amplification includes: 0.5 μL of genomic DNA with a sample of 50 ng / μL, 0.07 μL of primer mixture, 2×KASP Mix 2.5 μL, and 1.93 μL of ddH2O; wherein, in the primer mixture, the concentration of the upstream primer CmSNP21F1 is 25 μmol / L, the concentration of the upstream primer CmSNP21F2 is 25 μmol / L, and the concentration of the downstream primer CmSNP21R is 50 μmol / L.

[0073] In step 2, the amplification conditions were: pre-denaturation at 94°C for 10 min, 1 cycle; denaturation at 94°C for 15 s, 61°C for 1 min-0.6°C / cycle, 29 cycles; denaturation at 94°C for 15 s, annealing at 55°C for 60 s, 44 cycles.

[0074] In step 3, if the result is Homozygous Allele 1 / Allele 1, the genotype of the SNP site is G / G, and the sample is an orange flesh material; if the result is HomozygousAllele 2 / Allele 2, the genotype of the SNP site is A / A, and the sample is a non-orange flesh material; if the result is Heterozygous Allele 1 / Allele 2, the genotype of the SNP site is G / A, and the sample is a material that expresses orange flesh and is incompletely dominant in orange.

[0075] IV. Specific implementation

[0076] 1. The developed KASP-SNP marker CmSNP21 was used to identify 43 melon homozygous inbred lines and 3 F 1 The specific detection method is as follows:

[0077] a) Extraction of genomic DNA

[0078] The CTAB method was used to extract genomic DNA: 20 mg to 30 mg of young melon leaves were taken into a 2.0 mL centrifuge tube and ground in a grinder for 10 minutes; after adding 750 μL of preheated CTAB extraction solution, the mixture was shaken thoroughly and placed in a 65°C water bath for 45 minutes; 750 μL of chloroform was added, the mixture was mixed up and down for 3 minutes, and centrifuged at 12000 g for 5 minutes; 500 μL of supernatant was transferred to another 2.0 mL centrifuge tube, 0.7 times the volume of precooled isopropanol was added, the centrifuge tube was inverted several times, and the supernatant was discarded; 75% ethanol was added to rinse twice, and the supernatant was discarded after centrifugation, and the mixture was naturally air-dried; 100 μL of 1.0×TE buffer was added, and the mixture was fully dissolved and stored at 4°C for later use.

[0079] Note: The above are the preferred DNA extraction methods. Other DNA extraction methods that meet the quality requirements of PCR amplification can also achieve the same detection purpose.

[0080] b) KASP-SNP marker detection and reaction system:

[0081] Fluorescence quantitative PCR instrument AB-Q6 Flex detection:

[0082] The 5μL PCR fluorescence quantitative instrument detection reaction system includes: genomic DNA 50ng / μL 0.5μL, primer mixture 0.07μL (preferred primer mixture ratio: forward primer F1, F2 100μmol·L -1 12 μL each, reverse primer R 100 μmol·L -1 30μL, ddH2O 46μL, other reasonable primer mixture ratios can also achieve the same detection purpose), LGC 2×KASP Mix (Low Rox) 2.5μL, ddH 2 O 1.93 μL. Edit the sample table, execute the run program, and save the data according to the AB-Q6 fluorescence quantitative PCR instrument operation manual.

[0083] The above reaction system is the preferred reaction system for AB-Q6 Flex. Other reasonable reaction systems can also achieve the same detection purpose.

[0084] Or choose Douglas Scientific's ArrayTape platform for detection

[0085] The 1.6μL PCR Array Tape platform detection reaction system includes: 0.8μL of genomic DNA 50ng / μL, 0.03μL of primer mixture (preferred primer mixture ratio: forward F1, F2 100μmol·L -1 12 μL each, reverse primer R 100 μmol·L - 1 30μL, ddH2O 46μL, other reasonable primer mixture ratios can also achieve the same detection purpose), LGC 2×KASPMix (StdRox) 0.8μL. According to the ArrayTape platform instrument operation manual, write the sample table, run the program, and read the data.

[0086] The above reaction system is the preferred reaction system for the ArrayTape platform of Douglas Scientific. Other reasonable reaction systems can also achieve the same detection purpose.

[0087] Note: The above are recommended detection methods. Other detection methods that can achieve the same detection purpose can also be used in the present invention.

[0088] c) Amplification procedure: TCHdown method was used for amplification, with pre-denaturation at 94°C for 10 min, 1 cycle; denaturation at 94°C for 15 s, 61°C for 1 min-0.6°C / cycle, 29 cycles; denaturation at 94°C for 15 s, annealing at 55°C for 60 s, 44 cycles.

[0089] d) Result statistics:

[0090] Amplification using the CmSNP21 preferred primer combination can detect three results: Homozygous Allele 1 / Allele 1, Homozygous Allele 2 / Allele 2, and Heterozygous Allele 1 / Allele 2. If the result is Homozygous Allele 1 / Allele 1, the material genotype is recorded as G / G; if the result is HomozygousAllele2 / Allele 2, the material genotype is A / A; if the result is HeterozygousAllele 1 / Allele 2, the genotype is recorded as G / A.

[0091] 2. Analysis results

[0092] Field phenotypic consistency analysis: 43 melon materials and 3 F 1 The combined CmSNP21 test results were compared with the flesh color. The results showed that 16 orange flesh materials amplified the G / G genotype, 27 non-orange flesh materials and 1 white flesh F 1 The A / A genotype was amplified from the combination, and one orange green flesh F 1 And 1 portion of orange white meat F 1 The G / A genotype was amplified, and the consistency between the genotype and the phenotype could reach 95.6%, indicating that the marker can be used for molecular marker-assisted breeding of melon flesh color gene CmOr.

[0093] Table 1 Phenotypic and genotypic data of 46 tested melon materials

[0094]

[0095]

[0096] 3. Group Verification

[0097] The present invention utilizes F 2 Segregation population to verify the accuracy of markers: 2 white-fleshed melon materials and 2 orange-fleshed melon materials were selected for hybridization to obtain F 1 Combination, self-crossed to obtain 2 F 2 Separation groups, CmSNP21 was used to perform molecular detection on these two isolation groups, with 345 and 472 strains detected respectively. The detection results were as follows: 93 strains of G / G genotype, 81 strains of A / A genotype and 171 strains of G / A heterozygous genotype were amplified from the first group (χ 2 =0.366,χ 2 0.05,1=3.84); the second population amplified 119 strains of G / G genotype, 133 strains of A / A genotype and 220 strains of G / A heterozygous genotype (χ 2 =3.4,χ 2 0.05,1 =3.84). After maturity, the flesh color of each plant was investigated: the flesh color of the plants with the G / G genotype amplified results was orange, the flesh color of the plants with the A / A genotype amplified results was white, and the flesh of the plants with the G / A genotype amplified results was orange or orange-white flesh; the consistency between the homozygous G / G and A / A genotype results and the phenotype was 100% in both segregation groups, but the consistency between the heterozygous genotype G / A genotype results and the phenotype was 62.6% and 33.2% in the two segregation groups, respectively, proving that the marker can accurately screen out the plants with homozygous flesh color genes in the segregation group and can be applied to the molecular marker-assisted selection process.

[0098] When the fruits were ripe, the flesh color of the plants in the group was investigated, and the results showed that the consistency between the homozygous genotype and the phenotype could reach 100% (Table 2).

[0099] Table 2 Two F 2 Comparison table of phenotype and genotype of segregating population

[0100]

[0101] Therefore, the KASP-SNP marker CmSNP21 of the present invention can be used for molecular marker-assisted detection of the melon flesh color gene CmOr.

[0102] Note: The melon materials used in the present invention are some representative materials. The same purpose and similar results can be achieved by verifying or analyzing the KASP-SNP markers using other melon inbred lines or varieties.

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the technical solution. Those skilled in the art should understand that those modifications or equivalent substitutions of the technical solution of the present invention that do not depart from the purpose and scope of the technical solution should be included in the scope of the claims of the present invention.

Claims

1. A molecular marker for detecting the color trait of melon pulp, wherein the molecular marker is a single nucleotide polymorphism marker, characterized in that: The molecular marker is shown in SEQ ID NO.1; wherein, the base combination type at position 89 shown in the nucleotide sequence of SEQ ID NO.1 is related to the melon flesh color trait.

2. The molecular marker according to claim 1, characterized in that When the base combination at the 89th position is G / G, the melon flesh color trait is orange; when the base combination at the 89th position is A / A, the melon flesh color trait is non-orange; when the base combination at the 89th position is G / A, the melon flesh color trait is orange and is incompletely dominant.

3. An application of a molecular marker, characterized in that: The use of the molecular marker described in claim 1 or 2 in melon molecular marker-assisted breeding, melon pulp trait-assisted identification and assisted breeding, melon pulp trait-assisted identification, and melon pulp trait screening.

4. A primer composition, characterized in that The primer composition is used to detect the molecular marker described in claim 1 or 2; the primer composition comprises: The upstream primer CmSNP21F1 having a nucleotide sequence as shown in SEQ ID NO.2; The upstream primer CmSNP21F2 having a nucleotide sequence as shown in SEQ ID NO.3; And a downstream primer CmSNP21R having a nucleotide sequence as shown in SEQ ID NO.

4.

5. A kit for detecting the molecular marker according to claim 1 or 2, characterized in that: Include: The primer composition according to claim 4.

6. A method for identifying the color characteristics of melon pulp, characterized in that: The melon to be tested is subjected to the detection of the molecular markers of claim 1 or 2 to determine the flesh color trait of the melon to be tested.

7. The method according to claim 6, characterized in that: The primer combination described in claim 4 or the kit described in claim 5 is used to perform PCR amplification on the genomic DNA of the melon to be tested, and the amplified product is subjected to genotyping detection of SNP sites to further determine the flesh color trait of the melon sample to be tested.

8. The method according to claim 7, characterized in that: The reaction system for 5 μL PCR amplification includes: 0.5 μL of genomic DNA with a sample size of 50 ng / μL, 0.07 μL of primer mixture, 2.5 μL of 2×KASP Mix, and 1.93 μL of ddH2O; wherein, in the primer mixture, the concentration of the upstream primer CmSNP21F1 is 25 μmol / L, the concentration of the upstream primer CmSNP21F2 is 25 μmol / L, and the concentration of the downstream primer CmSNP21R is 50 μmol / L.

9. The method according to claim 7, characterized in that: The amplification conditions were as follows: pre-denaturation at 94°C for 10 min, 1 cycle; denaturation at 94°C for 15 s, 61°C for 1 min-0.6°C / cycle, 29 cycles; denaturation at 94°C for 15 s, annealing at 55°C for 60 s, 44 cycles.

10. A melon assisted breeding method, characterized in that: The method comprises: By using the method described in any one of claims 6 to 9, the molecular marker described in claim 1 or 2 is detected in the melon to be tested, so as to determine the color trait of the melon flesh to be tested.