KASP marker and primer for detecting rust-resistant gene of foxtail millet and application of KASP marker and primer

Abstract

The invention discloses a KASP marker for detecting a rust-resistant gene of foxtail millet, primers and application of the KASP marker, the marker is a KASP marker KASP52580 located at the 52580012th site of a No.9 chromosome of foxtail millet, the primers comprise a downstream primer, a disease-resistant site upstream primer and a disease-susceptible site upstream primer, the interval position of the rust-resistant gene is determined through genetic localization, and the interval position of the rust-resistant gene is determined through genetic localization. According to the present invention, the Setaria italica L. Beauv. Rust resistance gene SiLr2 is constructed, the KASP marker linked with the gene is correspondingly developed, and the KASP 52580 is closely linked with the Setaria italica L. Beauv. Rust resistance gene SiLr2, such that the SiLr2 genetic mapping large population can be efficiently and accurately detected with high throughput, and the gene can be used for fine positioning and map-based cloning of the SiLr2; high-throughput detection of other alleles at the SiLr2 site can be realized; when the marker is used for molecular marker-assisted selection, high-throughput screening of SiLr2 disease-resistant genes in large breeding groups in a short time can be realized, the progress of disease-resistant breeding of millet is accelerated, the goal of pyramiding breeding of multiple disease-resistant genes is realized, the breeding efficiency is effectively improved, and the marker serves for disease-resistant molecular breeding of millet.

Description

Technical Field

[0001] The invention relates to the fields of biotechnology and genetic breeding, and in particular to a millet rust resistance gene detection KASP marker, a primer and an application thereof. Background Art

[0002] Millet rust is an epidemic disease caused by infection with Puccinia milletii, which poses a serious threat to millet yield. Once millet rust breaks out on a large scale, millet yield can be reduced by 40% or even higher, and in extreme cases, there will be no harvest at all, which will undoubtedly bring huge economic losses to millet production. From the current prevention and control methods, breeding disease-resistant varieties is recognized as the most economical and effective prevention and control method.

[0003] The lack of millet rust-resistant resources has hindered the breeding process of disease-resistant varieties. Researcher Dong Zhiping of our research group used millet highly toxic species to identify the disease resistance of more than 16,000 millet germplasm resources, and finally screened out 89 resistant sources, of which only 9 were highly resistant, accounting for as low as 0.056% of the total number of identifications.

[0004] Millet "Shilixiang" is one of the above 9 highly resistant resources. Our research group located the main rust resistance gene SiLr1 carried by it on chromosome 8, and developed two molecular markers closely linked to SiLr1 in the positioning interval through genetic linkage analysis, one is a SNP+Indel marker named SLAF75316, and the other is a SNP marker named KASP34524. Both molecular markers are disclosed in the patents applied for by our research group (Bai Hui, Li Zhiyong, Zhu Yanbin, et al. Molecular markers for co-segregation of millet rust resistance genes and their detection methods [P]. CN201210131171.9; Bai Hui, Dong Zhiping, Li Zhiyong, et al. KASP markers, primers and their applications for high-throughput detection of millet rust resistance genes [P]. CN202311825134.2). The development of molecular markers lays the foundation for molecular-assisted breeding and accelerates the process of using the resistance source "Shilixiang" to cultivate rust-resistant varieties.

[0005] However, millet varieties with a single resistance source are prone to losing resistance during actual production. In order to ensure that millet can maintain lasting resistance in production applications, aggregating multiple disease resistance genes in one variety material is an effective solution.

[0006] "Xiaojia Hangu" is also one of the above 9 highly resistant millet resources, carrying disease-resistant genes different from "Shilixiang". This application is dedicated to finding available disease-resistant molecular markers from "Xiaojia Hangu", making marker-assisted breeding and molecular design breeding possible, further improving the efficiency and accuracy of millet disease-resistant breeding, and extending the service life of disease-resistant varieties. Summary of the invention

[0007] The invention aims to provide a millet rust resistance gene detection KASP marker, primers and their application, which provide a favorable tool for efficient, accurate and high-throughput detection of millet rust resistance genes and their fine positioning and map-based cloning, and can be effectively applied to millet molecular marker-assisted selection breeding.

[0008] The technical solution of the present invention is:

[0009] A millet rust resistance gene detection KASP marker, the key point is that the KASP marker is located at KASP52580 at position 52580012 of chromosome 9 of the millet genome, and its polymorphism is A or G; wherein the millet genome is derived from Yugu No. 1, V2.2.

[0010] The key point of detecting the primers for KASP markers as described above is that the primers include a downstream primer, an upstream primer for a disease resistance site, and an upstream primer for a disease sensitivity site;

[0011] The nucleotide sequence of the downstream primer is: AACGTGACAACGATATACAGTATGC,

[0012] As shown in SEQ ID NO.1;

[0013] The nucleotide sequence of the upstream primer of the disease resistance site is: CGTAAAAACATACTGCCGCTG;

[0014] The nucleotide sequence of the upstream primer of the susceptible site is: CGTAAAAACATACTGCCGCTA.

[0015] A universal tag sequence corresponding to HEX fluorescence is added before the upstream primer of the disease-resistant site, as shown in SEQ ID NO.2; a universal tag sequence corresponding to FAX fluorescence is added before the upstream primer of the disease-susceptible site, as shown in SEQ ID NO.3.

[0016] Application of primers for detecting KASP marker in marker-assisted selection breeding of millet.

[0017] Application of primers for detecting KASP markers in detecting millet rust resistance genes and their fine positioning and map-based cloning.

[0018] Application of primers for detecting KASP markers in identifying or assisting in identifying alleles of millet rust resistance genes.

[0019] A method for identifying or assisting in identifying millet rust resistance genes and their alleles, the key point of which is that the method comprises the following steps:

[0020] A. Extract DNA from the sample to be tested as a template;

[0021] B. Performing PCR on the DNA template using KASP marker KASP52580 primers to obtain an amplified product; the KASP marker KASP52580 includes a downstream primer, a disease resistance site upstream primer, and a disease sensitivity site upstream primer;

[0022] C. Use TECAN infinite M1000 microplate reader to read the fluorescence signal, and use the online software snpdecoder to parse and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and output the genotype results according to different colors.

[0023] The PCR amplification reaction system in step B is: 1 μL of 100 ng / μL DNA, 5 μL of 2×PARMS PCR Mix, 0.7 μL of Primer Mix, and the total system is 10 μL. The Primer Mix includes a downstream primer, an upstream primer of a disease-resistant site, and an upstream primer of a disease-susceptible site. The concentration of the downstream primer working solution is 400 nM; the concentrations of the two upstream primer working solutions are both 150 nM.

[0024] The PCR amplification program in step B is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, gradient annealing and extension at 65°C for 60 seconds, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; denaturation at 94°C for 20 seconds, annealing and extension at 57°C for 60 seconds, 28 cycles.

[0025] If the genotype result is "GG", it means that the site is homozygous for disease resistance and has the disease resistance gene; if the genotype result is "AA", it means that the site is homozygous for disease sensitivity and does not have the disease resistance gene; if the genotype result is "GA", it means that the site is heterozygous for disease resistance.

[0026] The beneficial effects of the present invention are as follows: the present invention performs BSA-Seq (Bulked Segregant Analysis-Seq) sequencing analysis on a total of 4 samples, including Xiaojia Han Gu, Yu Gu No. 1, a disease-resistant pool and a disease-susceptible pool, performs whole-genome SNP identification, calculates the genotype frequency difference (Δ(SNP-index)) between mixed pools and performs disease resistance association analysis on the BSA-Seq data, and finds that the whole genome has obvious enrichment only on chromosome 9, and obtains a disease resistance association region; further, based on the SNP in the association region, S The seven groups of KASP markers developed were polymorphic between the parents and encrypted into the localization interval of the rust resistance gene, which was named SiLr2. Among them, KASP marker KASP52580 was closely linked to the rust resistance gene SiLr2.

[0027] The KASP marker KASP52580 provided by the present invention is closely linked to the millet rust resistance gene SiLr2, and can not only efficiently, accurately and high-throughput detect a large genetic mapping population of SiLr2, and be applied to the fine positioning and map-based cloning of SiLr2, but also realize high-throughput detection of the SiLr2 locus and its alleles, laying a foundation for the in-depth analysis and utilization of the SiLr2 locus; the use of the marker for molecular marker-assisted selection can realize high-throughput screening of the SiLr2 disease resistance gene in a large breeding population in a short period of time, effectively improve breeding efficiency, and serve the molecular breeding of millet disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a diagram showing the typing results of some RIL population individuals derived from the hybridization of the disease-resistant parent Xiaojia Han Gu and the susceptible parent Yu Gu No. 1 using the KASP marker KASP52580 of the millet rust resistance gene SiLr2.

[0029] Figure 2 This is the typing result of using KASP marker KASP52580 of millet rust resistance gene SiLr2 to detect 20 millet materials carrying or not carrying SiLr2 allele. DETAILED DESCRIPTION

[0030] The examples provided below can be used as a guide for further improvement by those of ordinary skill in the art and do not constitute a limitation of the present invention in any way. The experimental methods in the following examples, unless otherwise specified, are conventional methods, carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents used were purchased from Wuhan Jingpeptide Biotechnology Co., Ltd., and unless otherwise specified, they can all be obtained from commercial channels. At the same time, the millet varieties used in the following examples can all be obtained from commercial channels.

[0031] The present invention relates to a KASP marker for detecting a millet rust resistance gene, wherein the KASP marker is located at KASP52580 at position 52580012 of chromosome 9 of the millet genome, and its polymorphism is A or G; wherein the millet genome is derived from Yugu1, V2.2. Primers for detecting the KASP marker as described above, wherein the primers include a downstream primer, an upstream primer of a disease resistance site, and an upstream primer of a disease susceptible site;

[0032] The nucleotide sequence of the downstream primer is: AACGTGACAACGATATACAGTATGC, as shown in SEQ ID NO.1;

[0033] The nucleotide sequence of the upstream primer of the disease resistance site is: CGTAAAAACATACTGCCGCTG, and a universal tag sequence corresponding to HEX fluorescence is added before the upstream primer of the disease resistance site, as shown in SEQ ID NO.2;

[0034] The nucleotide sequence of the upstream primer of the susceptible site is: CGTAAAAACATACTGCCGCTA, and a universal tag sequence corresponding to FAX fluorescence is added before the upstream primer of the susceptible site, as shown in SEQ ID NO.3.

[0035] Embodiment 1:

[0036] Development of KASP marker KASP52580 for millet rust resistance gene SiLr2

[0037] 1) Materials

[0038] The F hybrid of the disease-resistant parent Xiaojia Hangu and the susceptible variety Yugu No. 1 1 After self-pollination, F 2 There were 533 individuals in the first generation population, and 474 F2 clones were obtained through single seed propagation. 5 Generation of recombinant inbred line (RIL) population.

[0039] 2) Extraction method of millet genomic DNA

[0040] The CTAB method was used to extract genomic DNA from millet leaves. The specific steps are as follows:

[0041] (1) Take young leaves of millet material, grind them into powder using liquid nitrogen in a pre-cooled mortar and put them into a 1.5 mL centrifuge tube.

[0042] (2) Add 650 μL of CTAB extract (preheated in a 65°C water bath) to the centrifuge tube, mix well, and place in a 65°C water bath for 40 min. During this time, invert and mix the sample 3-4 times.

[0043] (3) After cooling to room temperature, add an equal volume of chloroform:isoamyl alcohol (24:1) to the centrifuge tube, invert to mix, and centrifuge at 12,000 rpm for 10 min;

[0044] (4) Take the supernatant and transfer it to a new 1.5 mL centrifuge tube. Repeat (3) once.

[0045] (5) Take the supernatant and transfer it to a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol, invert and mix, and precipitate at -20°C for 30 min.

[0046] (6) Centrifuge at 12000 rpm for 10 min, discard the supernatant, and add appropriate volume of 75% ethanol to wash the precipitate twice.

[0047] (7) After air-drying the DNA pellet, add 150 μL of 1× TE to dissolve it;

[0048] (8) After the DNA is fully dissolved, test the concentration and purity.

[0049] 3) F 2 Identification of rust resistance in populations and RIL populations

[0050] The resistant parent, the susceptible parent and the F 2 The population was planted in the net house in late July 2020, and the RIL population was sown in the field in late June 2023. The grain rust was inoculated by spraying during the mature stage. After the susceptible control Yugu No. 1 was fully diseased, the rust resistance was identified, and the highest reaction type and severity of each plant were investigated and recorded. The reaction type was recorded according to the 1-4 level standard, and the severity was recorded in nine levels of 0, 1%, 5%, 10%, 25%, 40%, 65%, 80%, and 100% (Bai Hui, Li Zhiyong, Wang Yongfang, et al. Technical procedures for identification of millet resistance to diseases and insect pests Part 1: Grain rust, Hebei Provincial Local Standard DB13 / T 2338.1-2016).

[0051] 4) BSA-Seq sequencing analysis

[0052] According to the above resistance identification results, F 2 The 50 extremely resistant and 50 extremely susceptible plants in the population were used to construct the disease-resistant pool and the disease-susceptible pool. BSA-Seq sequencing analysis was further performed on 4 samples, including Xiaojia Hangu, Yugu No. 1, and the disease-resistant pool and the disease-susceptible pool.

[0053] 5) Development of SNP molecular markers closely linked to SiLr2

[0054] The BSA-Seq data were used for whole-genome SNP identification, calculation of genotype frequency difference (Δ(SNP-index)) between mixed pools, and disease resistance association analysis. It was found that the whole genome was only significantly enriched on chromosome 9, and a disease resistance association region was obtained: 45.5-55.1Mb, with a physical distance of 9.63Mb. Further, a series of SNP sites were screened based on the SNP data in the association region and the corresponding KASP markers were developed. There were 7 groups of KASP markers (Table 1) that were polymorphic between the parents and encrypted into the positioning interval of the rust resistance gene (named SiLr2). The interval flanking markers KASP45480 and KASP54107 were used to detect all the individuals in the RIL population derived from the hybridization of Xiaojia Han Gu and Yu Gu No. 1, and 151 recombinant individuals were screened; the remaining 5 groups of KASP markers in the interval of KASP45480 and KASP54107 were further used to genotype the 151 recombinant individuals. The number of recombinant individuals detected by the KASP52580 marker was the least, which was 1, indicating that the KASP52580 marker was closely linked to SiLr2.

[0055] Table 1 Seven KASP markers developed within the disease resistance association interval and the number of recombinant plants detected

[0056] Sequence Number SNP markers Location on chromosome 9 Number of recombinant plants 1 KASP45480 45480954 120 2 KASP46613 46613730 83 3 KASP48019 48019910 56 4 KASP49500 49500815 38 5 KASP51000 51000042 28 6 KASP52580 52580012 1 7 KASP54107 54107150 48

[0057] The primers for molecular marker KASP52580 include one downstream primer and two upstream primers.

[0058] Downstream primer sequence:

[0059] KASP52580-R:5'-AACGTGACACGATATACAGTATGC-3'(SEQ ID NO.1)

[0060] Upstream primer sequence:

[0061] KASP52580-Fg:

[0062] 5'-gaaggtcggagtcaacggattCGTAAAAACATACTGCCGCTG-3' (SEQ ID NO. 2, the lowercase letters are the universal tag sequence corresponding to HEX fluorescence).

[0063] KASP52580-Fa:

[0064] 5'-gaaggtgaccaagttcatgctCGTAAAAACATACTGCCGCTA-3' (SEQ ID NO. 3, the lowercase letters are the universal tag sequence corresponding to FAM fluorescence);

[0065] The PCR amplification reaction system is: 1μL of 100ng / μL DNA, 5μL of 2×PARMS PCR Mix, 0.7μL of Primer Mix, and the total system is 10μL. The Primer Mix includes downstream primers, upstream primers of disease-resistant sites, and upstream primers of disease-susceptible sites. The working solution concentration of the downstream primer is 400nM; the working solution concentrations of the two upstream primers are both 150nM.

[0066] The PCR amplification program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, gradient annealing and extension at 65°C for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 57°C for 60 s, 28 cycles; PCR reactions were performed using ABI Gene Amp9700.

[0067] The fluorescence signal was read by TECAN infinite M1000 microplate reader, and the online software snpdecoder was used to analyze and convert the fluorescence signal, and the PCR products were genotyped and data analyzed. When detected, if the homozygous disease resistance is green on the typing chart, the output result is HEX, if the homozygous disease sensitivity is blue on the typing chart, the output result is FAM, and the heterozygous disease resistance signal is red on the typing chart, and the output result is FAMHEX.

[0068] Using the primers obtained, the genotyping of the Xiaojia Hangu and Yugu No. 1 and some RILs derived from their hybridization (33 recombinant plants with susceptible or resistant phenotypes, 10 plants with resistant phenotypes, and 10 plants with susceptible phenotypes) was performed according to the PCR amplification reaction system and amplification procedure described above. The typing results are as follows: Figure 1 shown. Figure 1In the figure, the horizontal axis value is set to represent the FAM fluorescence signal value, and the vertical axis value is set to represent the HEX fluorescence signal value. Then the genotype of the KASP52580 site of the millet genome to be tested is determined as follows, that is, the 52580012th base of chromosome 9 of the millet genome is detected to be A or G. If the fluorescence signal value of the amplified product of the millet to be tested is close to the horizontal axis, and the fluorescence reading is blue (FAM signal), the genotype of the KASP52580 site in the millet genome to be tested is AA homozygous (that is, the 52580012th base of chromosome 9 of the millet genome is AA homozygous); if the fluorescence signal value of the amplified product of the millet to be tested is close to the vertical axis, the fluorescence reading is blue (FAM signal), then the genotype of the KASP52580 site in the millet genome to be tested is AA homozygous (that is, the 52580012th base of chromosome 9 of the millet genome is AA homozygous); If the light reading is green (HEX signal), the genotype of the KASP52580 site in the millet genome to be tested is GG homozygous (i.e., the 52580012th base of chromosome 9 of the millet genome is GG homozygous); if the fluorescence signal value of the amplified product of the millet to be tested is close to the middle of the horizontal axis and the vertical axis, and the fluorescence reading is red (FAM and HEX signals), the genotype of the KASP52580 site in the millet genome to be tested is AG heterozygous (i.e., the 52580012th base of chromosome 9 of the millet genome is AG heterozygous). The gray sample displayed near the origin in the lower left corner is the blank control. The typing results (Table 2) showed that among the 53 tested plants, 18 had a genotype of GG at the KASP52580 locus, and their rust resistance was R; 1 had a genotype of AG at the KASP52580 locus, and their rust resistance was R; 34 had a genotype of AA at the KASP52580 locus, and their rust resistance was S. This result showed that the KASP52580 marker could obtain stable PCR products in the 53 tested plants, the three genotypes could be clearly distinguished and clustered, and the KASP52580 marker was consistent with the rust resistance phenotypic identification results.

[0069] Therefore, the KASP52580 marker described in the present invention can be used for molecular marker-assisted breeding of millet rust resistance gene SiLr2.

[0070] Table 2. Phenotypes of millet RIL population and genotype information of KASP52580 marker locus

[0071]

[0072]

[0073] Note: "R" in the table indicates that the phenotype of the material is disease-resistant; "S" indicates that the phenotype of the material is susceptible; "GG" indicates GG homozygous; "AA" indicates AA homozygous; "AG" indicates AG heterozygous.

[0074] Embodiment 2:

[0075] Application of KASP marker KASP52580, which is tightly linked to millet rust resistance gene SiLr2, in marker-assisted selection of millet rust-resistant plants.

[0076] In order to detect the practicality of the KASP52580 marker of the present invention, 20 millet materials known to contain / not contain SiLr2 were screened. First, rust inoculation identification was performed on the 20 millet materials to obtain the disease resistance data of the materials to rust. The rust inoculation identification method and evaluation criteria are shown in the Hebei Provincial Standard (recorded in Bai Hui, Li Zhiyong, Wang Yongfang, et al. Technical regulations for identification of millet resistance to diseases and insect pests Part 1: Millet rust, Hebei Provincial Standard DB13 / T 2338.1-2016.) Using the method described in Example 1, genomic DNA of 20 millet materials was extracted as PCR amplification templates; PCR amplification was performed using the KASP52580 primers or kit; PCR reaction was performed using ABI Gene Amp 9700; PCR products were genotyped and data analyzed using TECAN infinite M1000 microplate reader and online software snpdecoder, wherein the ordinate value is set to represent the HEX fluorescence signal value, and the abscissa value is set to represent the FAM fluorescence signal value.

[0077] The test results are shown in Table 3. The KASP52580 marker can obtain stable PCR products in 20 materials, and can detect two alleles, G-HEX and A-FAM. Through the consistency analysis of the KASP52580 marker and the rust resistance phenotypic identification results, the KASP52580 genotypes of the 20 materials are consistent with the resistance identification results.

[0078] Therefore, the KASP52580 marker described in the present invention is highly practical in the screening of millet rust-resistant plants and can be used for molecular marker-assisted breeding of the millet rust-resistant gene SiLr2.

[0079] Table 3. Phenotypes of 20 tested millet materials and genotype information of KASP52580 marker locus

[0080] Material Name Phenotype genotype Material Name Phenotype genotype 24B1-107 R GG Canggu No.4 S AA 24B1-174 R GG Golden Rice S AA Jigu19 S AA Dragon Valley 31 S AA Jigu 31 S AA Jigu 30 S AA Jigu41 S AA Chaogu No. 12 S AA Jigu11 S AA Jigu No.12 S AA Yellow Flag Emperor S AA Changnong 35 S AA Anfeng S AA Golden seedlings S AA No. 33 Jingu S AA Tender Selection 16 S AA Male dwarf No. 3 S AA Gonggu 88 S AA

[0081] Note: 24B1-107 and 24B1-174 are stable strains that have been self-pollinated for many generations after hybridization between Yugu No. 1 and Xiaojia Hangu and show a disease-resistant phenotype. "R" indicates that the material is resistant; "S" indicates that the material is susceptible; "AA" indicates AA homozygous; "GG" indicates GG homozygous.

[0082] Those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A KASP marker for detecting millet rust resistance genes, characterized in that: The KASP marker is located at KASP52580 at position 52580012 of chromosome 9 of the millet genome, and its polymorphism is A or G; wherein the millet genome is derived from Yugu No. 1, V2.

2.

2. A primer for detecting the KASP marker as claimed in claim 1, characterized in that: The primers include a downstream primer, an upstream primer for a disease-resistant site, and an upstream primer for a disease-susceptible site; The nucleotide sequence of the downstream primer is: AACGTGACAACGATATACAGTATGC, As shown in SEQ ID NO.1; The nucleotide sequence of the upstream primer of the disease resistance site is: CGTAAAAACATACTGCCGCTG; The nucleotide sequence of the upstream primer of the susceptible site is: CGTAAAAACATACTGCCGCTA.

3. The primer for detecting KASP marker according to claim 2, characterized in that: A universal tag sequence corresponding to HEX fluorescence is added before the upstream primer of the disease resistance site, as shown in SEQ ID NO.2; A universal tag sequence corresponding to FAX fluorescence is added before the upstream primer of the susceptible site, as shown in SEQ ID NO.

3.

4. Use of the primers for detecting KASP markers according to claims 2-3 in marker-assisted selection breeding of millet.

5. Use of the primers for detecting KASP markers according to claims 2-3 in detecting millet rust resistance genes and their fine positioning and map-based cloning.

6. Use of the primers for detecting KASP markers according to claims 2-3 in identifying or assisting in identifying alleles of millet rust resistance genes.

7. A method for identifying or assisting in identifying millet rust resistance genes and their alleles, characterized in that: The method comprises the following steps: A. Extract DNA from the sample to be tested as a template; B. Performing PCR on the DNA template using KASP marker KASP52580 primers to obtain an amplified product; the KASP marker KASP52580 includes a downstream primer, a disease resistance site upstream primer, and a disease sensitivity site upstream primer; C. Use TECAN infinite M1000 microplate reader to read the fluorescence signal, and use the online software snpdecoder to parse and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and output the genotype results according to different colors.

8. The method for identifying or assisting in identifying millet rust resistance genes and their alleles according to claim 7, characterized in that: The PCR amplification reaction system in step B is: 1 μL of 100 ng / μL DNA, 5 μL of 2×PARMS PCR Mix, 0.7 μL of Primer Mix, and the total system is 10 μL. The Primer Mix includes a downstream primer, an upstream primer of a disease-resistant site, and an upstream primer of a disease-susceptible site. The concentration of the downstream primer working solution is 400 nM; the concentrations of the two upstream primer working solutions are both 150 nM.

9. A method for identifying or assisting in identifying millet rust resistance genes and their alleles according to claims 7-8, characterized in that: The PCR amplification program in step B is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, gradient annealing and extension at 65°C for 60 seconds, 10 cycles, with the annealing and extension temperature decreasing by 0.8°C in each cycle; denaturation at 94°C for 20 seconds, annealing and extension at 57°C for 60 seconds, 28 cycles.

Images