InDel molecular marker of wheat HGGT gene as well as primer and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker of a wheat HGGT gene as well as a primer and application of the InDel molecular marker. The InDel molecular marker of the wheat HGGT gene comprises a DNA (Deoxyribose Nucleic Acid) fragment and a DNA fragment, wherein the DNA fragment is shown in SEQ ID No.5 and is 416 bp in length, and the DNA fragment is shown in SEQ ID No.6 and is 215 bp in length. The specific primer group comprises an IndHggt1 primer pair as shown in SEQ ID No. 1 to SEQ ID No. 2, and an IndHggt2 primer pair as shown in SEQ ID No. 3 to SEQ ID No. 4. According to the invention, an IndHggt1 and IndHggt2 codominant molecular marker system is developed based on HGGT gene sequence polymorphism characteristics, the IndHggt1 marker is subjected to typing by detecting whether an amplification band exists or not, the IndHggt2 marker is subjected to typing through characteristic band length difference, a double-verification system is constructed by introducing the markers, and a target genotype can be accurately locked.

Description

Technical Field

[0001] The invention relates to a wheat molecular marker-assisted breeding technology, and in particular to an InDel molecular marker of a wheat HGGT gene and a primer and application thereof. Background Art

[0002] Wheat fusarium head blight is caused by Fusarium graminearum ( Fusarium graminearum ) and Fusarium asiatica ( Fusarium Asiaticum ) and other pathogens. The winter wheat areas in the middle and lower reaches of the Yangtze River in my country are the hardest hit areas of Fusarium fusarium head blight. The disease causes annual yield losses of up to 20%-50%, and the trichothecenes secreted by the pathogen - deoxynivalenol (DON, vomitoxin) seriously threatens food security. DON is listed as the most dangerous natural pollutant by the Food and Agriculture Organization of the United Nations (FAO) and the World Health Organization (WHO). It damages cellular DNA, protein and lipid metabolism by inducing oxidative stress, and causes symptoms of poisoning in humans and animals (such as vomiting, immunosuppression, fertility disorders, etc.). my country's "National Food Safety Standard" stipulates that the limit of DON in wheat grains is 1000 μg·kg -1 However, market monitoring in recent years has shown that the DON content in wheat in some producing areas exceeds the standard by more than 30%, and breakthrough technologies are urgently needed to reduce the risk of toxins.

[0003] Traditional breeding for resistance to Fusarium fusarium disease relies on quantitative trait loci (QTLs) such as Fhb1, which indirectly reduce DON accumulation by inhibiting the expansion of pathogens, but there is a phenotypic separation between toxin regulation and disease resistance. For example, although some disease-resistant varieties have reduced diseased ear rates, the DON content in the grains still exceeds the standard. In addition, genetic engineering strategies based on UGT glycosyltransferases or ABC transporters are difficult to apply on a large scale due to their complex operations and low field applicability. Therefore, exploring key genes that directly regulate DON metabolism and developing efficient molecular markers are the core breakthroughs for achieving precise control of toxins.

[0004] Previous studies have found that exogenous vitamin E treatment can significantly reduce the DON content in the grains of highly susceptible wheat varieties (by more than 40%), suggesting that the vitamin E synthesis pathway may be involved in the regulation of toxin metabolism. Further genetic association analysis confirmed for the first time that the expression level of homogentisate geranylgeranyltransferase gene (HGGT) was significantly negatively correlated with DON accumulation (p<0.01) (Wu Di, Zhu Suqin, Zhang Yuhui, et al. Analysis of the relationship between HGGT gene and toxin accumulation in wheat fusarium head blight [J]. Jiangsu Agricultural Science, 2020, 48(11):96-100.). HGGT is a key enzyme in the synthesis of vitamin E. Its mechanism of resisting oxidative damage by enhancing the antioxidant capacity of plants has been widely reported, but the following key issues have not yet been resolved: existing research focuses on the basic functions of HGGT, and lacks a systematic analysis of the relationship between HGGT allelic variation (such as insertions and deletions, SNPs) and DON accumulation in natural germplasm, which cannot guide the development of molecular markers; molecular markers are not practical enough, and the reported HGGT markers are mostly designed based on gene expression or a single SNP site, which cannot distinguish functional allelic variation and has not established a direct correlation with DON content; there is a gap in multi-target synergistic regulation technology, and the HGGT gene has the dual potential to reduce DON toxins and enrich vitamin E, but the existing breeding technology lacks molecular tools that integrate the "toxicity reduction-nutritional enhancement" goals, resulting in low breeding efficiency. Summary of the invention

[0005] In response to the great need for the coordinated optimization of "toxin reduction-nutrition fortification" in the prevention and control of wheat fusarium head blight, based on the discovery that vitamin E can negatively regulate the accumulation of DON toxins, the key gene HGGT for vitamin E synthesis was targeted, and the co-dominant InDel molecular markers IndHggt1 (416 bp, SEQ ID No.5) and IndHggt2 (215 bp, SEQ ID No.6) were successfully developed to construct a dual molecular marker verification detection system: through the complementary interpretation mechanism of the presence or absence of bands (IndHggt1) and length differences (IndHggt2), the dominant allele genotype with high vitamin E and low DON toxin content in grains was accurately identified. This system breaks through the traditional disease resistance gene-dependent path, realizes the molecular-level coordination of toxin control and nutrition fortification, improves the efficiency of "toxicity reduction-quality improvement" polymerization breeding, and provides key technical support for the selection and breeding of high-quality special wheat varieties.

[0006] SEQ ID No.5: TTCATGGTGCAATTATAAGGGAGATCAAGCTTCACTCGGAACTCTTTGAGGAATGCAAGTTTACTCACGGAAGTAGGTCAAGAAATTACGAAGCTGATAGTCTGGCAAAGTTTGCTTTATATCAAGATTTTGGTAGACGTGTTTAGCTAATCGATCCGCATAACAATGCAATCATTCCTTTGGAACTTGTTAAATAAAGTTTTAGT CCACCTAAAAAAAATTCCCCAGCCCGGCTCAGCTTTGGTATTGGAAAACCCTATTTGACGTGCATTAAGTCAAGTAGCCGGGGCTTCGAGTTGTMAAAAAAAGTAGCCGGGGCTTCGCACAGGGGCGCCATGACTGGGCCGACCCGTTTCTCATTTTATTTATGTTTCTATTTTTCTATTATTTTCTTTTTTCTTCCCTTTTCCTT; SEQ ID No. 6: TCCGCATAACAATGCAATCATTCCTTTGGAACTTGTTAAATAAAGTTTTAGTCCACCTAAAAAAAATCCCCAGCCCGGCTCAGCTTTGGTATTGGAAAACCCTATTTGACGTGCATTAAGTCAAGTAGCCGGGGCTTCGAGTTGTMAAAAAAAAAAGTAGCCGGGGCTTCGCACAGGGGCGCCATGACTGGGCCGACCCGTTTCTCATTTTAT.

[0007] The objective of the present invention is achieved through the following technical solutions: First, based on the correlation between HGGT gene allele variation and DON toxin accumulation, the HGGT gene (key gene for vitamin E synthesis) was identified, and the complete gene sequence of HGGT on wheat chromosome 3B was obtained through BAC cloning (accession number: KU641029):

[0008] Based on the homology comparison of the resequencing varieties, the sequence variation of the gene was analyzed, and the specific amplification primers IndHggt1 and IndHggt2 of the HGGT gene were designed using Primer Premier5.0 software. IndHggt1 marker primer information: the nucleotide sequence is the front primer sequence shown in SEQ ID No.1, and the nucleotide sequence is the rear primer sequence shown in SEQ ID No.2. IndHggt2 marker primer information: the nucleotide sequence is the front primer sequence shown in SEQ ID No.3, and the nucleotide sequence is the rear primer sequence shown in SEQ ID No.4.

[0009] SEQ ID No.1: 5'-TTCATGGTGCAATTATAAGGGAG-3'; SEQ ID No.2: 5'-AAGGAAAAGGGAAGAAAAAAGAA-3'; SEQ ID No.3: 5'-TCCGCATAACAATGCAATCA-3'; SEQ ID No. 4: 5'-ATAAAATGAGAAACGGGTCGG-3'.

[0010] Then, the present invention provides a kit or a reagent kit containing the specific primer set of SEQ ID No. 1 to SEQ ID No. 4 above.

[0011] Again, the present invention provides the use of the above-mentioned InDel molecular marker, specific primer set, reagent or kit in any of the following: (1) HGGT genotyping of wheat materials; (2) Detection of vitamin E and DON toxin content in wheat grains; (3) Wheat genetics and breeding.

[0012] Furthermore, the present invention also provides the application of a dual-molecule marker verification system constructed by IndHggt1 and IndHggt2 in identifying high vitamin E and low DON toxin germplasm in grains of natural wheat populations.

[0013] The application of the above-mentioned Indel primer set in identifying vitamin E and DON toxin in grains of natural populations refers to using the genomic DNA of wheat to be tested as a template, using the Indel primer set shown in nucleotide sequences such as SEQ ID No.1-SEQ ID No.4 as primers for PCR amplification, and performing genotyping according to the electrophoresis results of 2% agarose gel or 8% polyacrylamide gel (the medium is selected according to the size of the product fragment), and double-marker joint interpretation: IndHggt1 detection: band type 1 (target band) indicates that the HGGT gene is carried with favorable allele variation, and band type 2 (no band) indicates that it is not carried; IndHggt2 detection: band type 3 (target band) indicates that the favorable allele variation is carried, and band types 4 and 5 indicate that it is not carried. If the IndHggt1 detection has a band, and the IndHggt2 detection has only a target band with a length of 215 bp, the wheat genomic DNA carries the favorable allele variation, otherwise it does not carry it. The phenotype of natural populations in the field was used to verify that varieties carrying favorable alleles of the HGGT gene had higher vitamin E content and lower DON toxin content in their grains.

[0014] The beneficial effects of the present invention are: 1. Based on the polymorphism characteristics of the HGGT gene sequence, a co-dominant molecular marker system of IndHggt1 and IndHggt2 was developed. The IndHggt1 marker was typed by detecting the presence or absence of the amplified band, while the IndHggt2 marker was typed by the difference in characteristic band length. By introducing markers to construct a dual verification system, the target genotype can be accurately locked.

[0015] 2. The primer combination is highly specific and can achieve stable amplification on a conventional PCR instrument without relying on special detection equipment, significantly improving the universality and operability of the detection scheme.

[0016] 3. By establishing a molecular marker-assisted selection system, it is expected to achieve the directional aggregation of the dual-excellent traits of "low DON toxin accumulation + high vitamin E content". This technology can be simultaneously applied to natural population screening and early selection of hybrid F1 generations, reducing the scale of field trials by 50% compared with traditional breeding methods, and providing efficient technical solutions for the cultivation of high-quality special wheat varieties that meet the national strategy of "toxicity reduction and quality improvement". BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the electrophoresis pattern of the amplified product of the IndHggt1 marker in the natural population in Example 1 of the present invention; Figure 2 It is the electrophoresis pattern of the amplified product of the IndHggt2 marker in the natural population in Example 1 of the present invention; Figure 3This is the correlation analysis between the HGGT gene and the accumulation of vitamin E and DON toxin content in grains in Example 2 of the present invention; in the figure, × is the average value, the horizontal line represents the median, the points above and below the figure represent outliers, and the horizontal axes A and B represent varieties that do not carry favorable alleles and varieties that carry favorable alleles, respectively. * indicates a significant difference ( P <0.05, ** indicates extremely significant difference ( P <0.01). DETAILED DESCRIPTION

[0018] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0019] Example 1: Genotyping of natural populations using IndHggt1 and IndHggt2 markers (1) Experimental materials: In 2022 and 2023, 113 natural populations of nationally recommended varieties, strains, and some local varieties were planted at the Wantou Base of the Agricultural Science Institute in Lixiahe, Jiangsu Province (10-20 m above sea level, 32.24 degrees north latitude, 119.26 degrees east longitude, and annual precipitation of 1020 mm). Each variety was sown with 30 seeds per row, with 1 replicate for 2 rows. The experiment had two replicates, with a row length of 150 cm and a row spacing of 30 cm. The field management of the experiment was carried out according to the local standard model, and no disease control was performed. The 113 wheat varieties are shown in Table 1.

[0020] (2) DNA extraction: Tender leaves of the materials were taken at the seedling stage, and the genomic DNA of each material was extracted using the CTAB method. The DNA concentration was detected using an ultra-micro spectrophotometer, and the DNA concentration was about 6000 ng / μL, and the D260nm / D280nm was between 1.7 and 2.0.

[0021] (3) PCR reaction system: The PCR reaction system used a 10 μL system, including 50 ng DNA template, 0.2 μL of upstream and downstream primers (10 μmol / L), 5 μL of 2× Taq Plus Master Mix (Novagen), and the remaining volume was washed with ddH 2 O complement.

[0022] (4) PCR program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55-58°C for 45 s according to primer requirements, extension at 72°C for 1 min, 33 cycles; extension at 72°C for 5 min.

[0023] (5) Electrophoresis detection: 2% agarose gel electrophoresis and polyacrylamide gel electrophoresis analysis results.

[0024] like Figure 1 As shown in Table 1, under the IndHggt1 marker detection, a total of 21 varieties from 1 to 21 were band type 1 (with bands), and a total of 92 varieties from 22 to 113 were band type 2 (without bands).

[0025] like Figure 2 As shown in Table 1, under the IndHggt2 marker detection, a total of 20 varieties, including No. 1 to 19 and No. 22, were band type 3 (band length was 215 bp), a total of 90 varieties, including No. 20 to 21 and No. 23 to 110, were band type 4 (band length was 190 bp), and a total of 3 varieties, including No. 111 to 113, were band type 5 (heterozygous band).

[0026] Table 1 Genotyping results of 113 wheat varieties

[0027] Note: In the table, “+” represents “yes” and “-” represents “no”.

[0028] Example 2: Application of the dual-marker detection system to screen for high vitamin E and low DON toxin germplasm in natural populations In 2022 and 2023, the vitamin E content in the seeds of the natural populations of 113 nationally recommended varieties and some local varieties and strains listed in Table 1, the DON toxin content under uninoculated conditions, and the DON toxin content under inoculated conditions were collected and data were obtained. Among them: The single flower drip method was used for fusarium inoculation. During the flowering period of wheat, one of the replicates was inoculated, and the prepared bacterial solution was injected between the inner and outer lemmas of the florets outside the spikelets. Ten spikelets were inoculated in each row. The number of susceptible spikelets was identified 21 days after inoculation, and the diseased spikelet rate was calculated. The other replicate was not inoculated.

[0029] The toxin content in the grains was determined by liquid chromatography-mass spectrometry (LC-MS), and the instrument used was QTRAP-4500 ultra-high performance liquid chromatography-tandem mass spectrometer (Sciex, USA). At the maturity stage of wheat, 10 ears of inoculated diseased ears and uninoculated ears were harvested for each variety. After threshing, the samples were processed, the standard solution was prepared, the chromatography and mass spectrometry conditions were set, the data were collected using Analyst software, and the data were processed using MultiQuant3.0.3 software to obtain the toxin content in the grains under the two conditions of inoculation and non-inoculation of the variety.

[0030] The vitamin E content in the grains was determined by high performance liquid chromatography (HPLC) combined with a fluorescence detector. The instrument used was an Agilent 1260 Infinity II HPLC system (Agilent, USA), equipped with a quaternary gradient pump, an autosampler, a column oven, and a fluorescence detector (FLD). After harvesting and threshing the uninoculated wheat ears, the samples were processed, the standard solution was prepared, the chromatographic conditions were set, and the chromatographic peaks were recorded using the Agilent OpenLab CDS software. Based on the standard curve method, the vitamin E content in the grains was calculated by the peak area.

[0031] The genotype data were correlated with the average vitamin E content and DON toxin content under natural disease (no inoculation) conditions in the field environment for two years, as well as the average grain DON toxin content measured after inoculation. The results showed that band 1 and band 3 were varieties that carried favorable alleles of the gene, while other bands were varieties that did not carry favorable alleles of the gene. As shown in Table 2 and Figure 3 As shown in the results, under non-inoculated conditions, there were significant differences in the content of vitamin E and DON toxin in the grains between varieties carrying the favorable allele of the HGGT gene and varieties not carrying the allele (P<0.05). The average content of vitamin E in the grains of varieties carrying the favorable allele was 10.34μg / g in two years, which was 37.9% higher than the 6.41μg / g of varieties not carrying the allele; the content of DON toxin in the grains was 0.11mg / kg, which was 76.5% lower than the 0.48mg / kg of varieties not carrying the allele, indicating that the allele can significantly increase the content of vitamin E in the grains and reduce the accumulation of toxins. Under inoculated conditions, there was a very significant difference in the content of toxins in the grains between varieties carrying the favorable allele of the HGGT gene and varieties not carrying the allele (P<0.01). The average content of toxins in the grains of varieties carrying the gene was 5.73mg / kg in two years, which was 51.3% lower than the 11.77mg / kg of varieties not carrying the gene. Further comparison of the changes in grain toxin content before and after inoculation showed that the toxin content of varieties carrying the favorable allele variation of the HGGT gene increased by an average of only 5.62 mg / kg after inoculation, while that of varieties not carrying the gene increased by 11.2 mg / kg. The toxin accumulation of varieties carrying this gene decreased by 49.7%, indicating that the HGGT gene has a significant effect in reducing toxin accumulation.

[0032] It can be seen that the dual-marker detection system constructed by the present invention can accurately distinguish between varieties carrying and not carrying favorable alleles, and provides an efficient molecular detection tool for the screening of wheat germplasm with high vitamin E nutrition and low DON toxin.

[0033] Table 2 Analysis of variance of vitamin E and DON toxin contents in seeds of natural populations

[0034] Note: The data are derived from the average of two-year field trials; "+" indicates that the variant carries a favorable allele, and "-" indicates that the variant does not carry a favorable allele.

[0035] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0036] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0037] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. An InDel molecular marker of wheat HGGT gene, characterized in that: It includes a DNA fragment with a length of 416 bp as shown in SEQ ID No.5 and a DNA fragment with a length of 215 bp as shown in SEQ ID No.

6.

2. A specific primer set, characterized in that: It includes the IndHggt1 primer pair shown by SEQ ID No.1-SEQ ID No.2 and the IndHggt2 primer pair shown by SEQ ID No.3-SEQ ID No.

4.

3. A kit or a reagent kit comprising the specific primer set according to claim 2.

4. Use of the InDel molecular marker according to claim 1, or the specific primer set according to claim 2, or the reagent or kit according to claim 3 in any of the following: (1) HGGT genotyping of wheat materials; (2) Detection of vitamin E and DON toxin content in wheat grains; (3) Wheat genetics and breeding.

5. A method for screening wheat grain germplasm with high vitamin E and low DON toxin content, characterized in that: include: The wheat genomic DNA to be tested was used as a template, and parallel PCR amplification was performed using IndHggt1 and IndHggt2 primers respectively; if IndHggt1 detected a band, and IndHggt2 detected a target band with a length of 215 bp, the wheat genomic DNA carried a favorable allele variation, otherwise it did not carry it. Among them, the varieties carrying the favorable allele variation of the HGGT gene had higher vitamin E content and lower DON toxin content in the grains.

6. The screening method according to claim 5, characterized in that PCR reaction system 10 μL: 50 ng DNA template, 0.2 μL each of upstream and downstream primers, 5 μL 2× Taq Plus MasterMix, supplemented with ddH2O; PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55-58°C for 45 s, extension at 72°C for 1 min, 33 cycles; extension at 72°C for 5 min.

Images