Gene editing system and application thereof

Abstract

The invention discloses gRNA (guide ribonucleic acid) targeting VEGFA (vascular endothelial growth factor A), a gene editing system and application of the gRNA. The gRNA of the present disclosure comprises a guide sequence having at least 80% sequence identity as compared to any of SEQ ID NO: 10-18, 40-230. The gene editing system disclosed by the invention comprises the gRNA disclosed by the invention and a coding sequence thereof, and RNA-guided nuclease and a coding sequence thereof.

Description

Gene editing systems and their applications

[0001] This application claims priority to Chinese Patent Application No. 2022113208591 filed on October 26, 2022, Chinese Patent Application No. 2023100880960 filed on January 18, 2023, and Chinese Patent Application No. 2023103961404 filed on April 12, 2023. This application incorporates the entirety of the aforementioned Chinese patent applications. Technical Field

[0002] The present disclosure belongs to the field of gene editing technology, and specifically relates to a gene editing system and its application, and more specifically, to a gRNA and CRISPR system targeting VEGFA and its application. Background Art

[0003] Vascular endothelial growth factor A (VEGFA) plays a role in the angiogenesis signaling pathway, regulating a variety of physiological and disease-related pathways, such as angiogenesis from embryonic development to various organs and tissues. When specific tissues or organs are hypoxic, VEGFA is activated by the hypoxia-inducible factor (HIF) transcription factor and its expression is upregulated. Upregulated VEGFA binds to its receptor, activating angiogenesis signaling pathways and providing nutrients to the body. In various diseases, such as cancer, where tissues are hypoxic, VEGFA expression is significantly upregulated, activating angiogenesis pathways. Studies have found that VEGFA-related angiogenesis signaling pathways are upregulated in various pathological processes, including lung cancer, breast cancer, liver cancer, and glioblastoma, as well as in diseases such as diabetic nephropathy, neovascular age-related macular degeneration, neovascular glaucoma, rheumatoid arthritis, psoriatic arthritis, and ovarian hyperstimulation syndrome, where VEGF expression is significantly upregulated.

[0004] The marketed VEGF antibody Aflibercept and the anti-VEGF overexpression drug RGX-314, currently in clinical trials, are both used to treat diabetic macular edema (DME), macular edema following retinal vein occlusion (RVO), and diabetic retinopathy (DR), with good efficacy. Bayer's anti-VEGF Aflibercept is in Phase III clinical trials for colorectal cancer and is also in Phase III clinical trials for non-small cell lung cancer. Genentech's anti-VEGF Bevacizumab is used to treat colon cancer, lung cancer, breast cancer, glioblastoma, and kidney cancer, and clinical trials for colon cancer and breast cancer have entered Phase III.

[0005] Age-related macular degeneration (AMD) has become the leading cause of blindness in people over 50 worldwide, causing irreversible vision loss. AMD is divided into dry, or atrophic, and neovascular, or wet, forms. Neovascular AMD (nAMD) accounts for 10-15% of cases and is one of the leading causes of vision loss. nAMD patients present with gradual or sudden onset of severe visual impairment, including fundus hemorrhages and exudates, accompanied by choroidal neovascularization, and disciform scarring in the macular area. Neovascular AMD begins at age 50 and has a prevalence of up to 13% in people over 60. Current research has demonstrated that the key molecular mechanism of nAMD is overexpression of vascular endothelial growth factor (VEGFA) in the retinal pigment epithelium (RPE), either due to genetic or external stressors. This activates the angiogenesis pathway, leading to retinal hemorrhage and severe vision impairment. Therefore, intravitreal injection of VEGF antibody drugs can effectively inhibit retinal and choroidal neovascularization and the deterioration of central vision damage.

[0006] Intravitreal injection of VEGF antibodies is currently the most effective treatment for nAMD and holds the largest market share. VEGF antibodies are typically administered every 1-3 months.

[0007] The CRISPR / Cas (clustered regularly interspaced short palindromic repeats / CRISPR-associated proteins) system is currently the most widely used gene editing technology. However, for CRISPR-based disease therapies, obtaining "Cas protein + guide RNA" drug molecules with high editing efficiency and high safety remains a significant challenge, a challenge that the field has been working to address.

[0008] Summary of the Invention

[0009] The present disclosure provides guide RNA targeting VEGFA, a gene editing system, and applications thereof.

[0010] A first aspect of the present disclosure provides a guide RNA (gRNA) for a gene editing system, comprising a guide sequence having at least 80% sequence identity with the sequence shown in any one of SEQ ID NOs: 10-18, 40-230.

[0011] In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0012] In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 10-18, 40-230. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 10-18, 40-230. In some embodiments of the present disclosure, the guide sequence is selected from the sequence shown in any one of SEQ ID NOs: 10-18, 40-230. In some embodiments, the guide sequence is engineered to hybridize to the target RNA.

[0013] In some embodiments of the disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 12, 13, 15, 40-43, 45-47, 52-60, 64, 65, 73, 216, 219, 220, 223, 227, 228, 229, and 230. In some embodiments of the disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 12, 13, 15, 40-43, 45-47, 52-60, 64, 65, 73, 216, 219, 220, 223, 227, 228, 229, and 230. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 12, 13, 15, 40-43, 45-47, 52-60, 64, 65, 73, 216, 219, 220, 223, 227, 228, 229, and 230. In some embodiments of the disclosure, the guide sequence is selected from the group consisting of SEQ ID NOs: 12, 13, 15, 40-43, 45-47, 52-60, 64, 65, 73, 216, 219, 220, 223, 227, 228, 229, and 230. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0014] In some embodiments of the disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 12, 13, 15, 47, 58, 59, 227, 228, and 230. In some embodiments of the disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 12, 13, 15, 47, 58, 59, 227, 228, and 230. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 12, 13, 15, 47, 58, 59, 227, 228, and 230. In some embodiments of the disclosure, the guide sequence is selected from the group consisting of SEQ ID NOs: 12, 13, 15, 47, 58, 59, 227, 228, and 230. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0015] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence set forth in SEQ ID NO: 12. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 12. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 12. In some embodiments of the present disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 12. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0016] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 13. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 13. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 13. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 13. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0017] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence set forth in SEQ ID NO: 15. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 15. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 15. In some embodiments of the present disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 15. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0018] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 40. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 40. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 40. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 40. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0019] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 41. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 41. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 41. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 41. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0020] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 42. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 42. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 42. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 42. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0021] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 43. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 43. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 43. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 43. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0022] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 45. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 45. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 45. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 45. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0023] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 46. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 46. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 46. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 46. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0024] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence set forth in SEQ ID NO: 47. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 47. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 47. In some embodiments of the present disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 47. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0025] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 52. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 52. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 52. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0026] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 53. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 53. In some embodiments of the disclosure, the guide sequence is the sequence shown in SEQ ID NO: 53. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0027] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 54. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 54. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 54. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0028] In some embodiments of the present disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 55. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 55. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 55. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0029] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 56. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 56. In some embodiments of the disclosure, the guide sequence is the sequence shown in SEQ ID NO: 56. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0030] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 57. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 57. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 57. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0031] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 58. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 58. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 58. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 58. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0032] In some embodiments of the present disclosure, the guide sequence has at least 80% sequence identity compared to the sequence shown in SEQ ID NO: 59. In some embodiments of the present disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 59. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 59. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 59. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0033] In some embodiments of the present disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 60. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 60. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 60. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0034] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 64. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 64. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 64. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0035] In some embodiments of the present disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 65. In some embodiments of the present disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 65. In some embodiments of the present disclosure, the guide sequence is the sequence shown in SEQ ID NO: 65. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0036] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 73. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 73. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 73. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0037] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 216. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 216. In some embodiments of the disclosure, the guide sequence is the sequence shown in SEQ ID NO: 216. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0038] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 219. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 219. In some embodiments of the disclosure, the guide sequence is the sequence shown in SEQ ID NO: 219. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0039] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 220. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 220. In some embodiments of the disclosure, the guide sequence is the sequence shown in SEQ ID NO: 220. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0040] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence shown in SEQ ID NO: 223. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence shown in SEQ ID NO: 223. In some embodiments of the disclosure, the guide sequence is the sequence shown in SEQ ID NO: 223. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0041] In some embodiments of the disclosure, the guide sequence has at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 227. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 227. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 227. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0042] In some embodiments of the disclosure, the guide sequence has at least 80% sequence identity compared to the sequence set forth in SEQ ID NO: 228. In some embodiments of the disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 228. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 228. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 228. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0043] In some embodiments of the disclosure, the guide sequence has at least 80% sequence identity compared to the sequence set forth in SEQ ID NO: 229. In some embodiments of the disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 229. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 229. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 229. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0044] In some embodiments of the disclosure, the guide sequence has at least 80% sequence identity compared to the sequence set forth in SEQ ID NO: 230. In some embodiments of the disclosure, the guide sequence has at least 85%, at least 90%, at least 95%, or 100% sequence identity compared to the sequence set forth in SEQ ID NO: 230. In some embodiments of the disclosure, the guide sequence has 100% sequence identity compared to the sequence set forth in SEQ ID NO: 230. In some embodiments of the disclosure, the guide sequence is the sequence set forth in SEQ ID NO: 230. In some embodiments, the guide sequence is engineered to hybridize to a target RNA.

[0045] gRNA-1 to gRNA-10 can target the exon region of the conserved VEGFA RNA between humans and mice, gRNA-11 to gRNA-32 can target the exon region of the human VEGFA RNA, and gRNA-33 to gRNA-45 can target near the splice site of the human VEGFA RNA. For example, gRNA-36 can target the intron sequence immediately adjacent to the 5' end of exon 2 in the VEGFA pre-mRNA, and gRNA-35 can target the splice site at the 5' end of exon 2 in the VEGFA pre-mRNA. gRNA-5-2, gRNA-5-3, and gRNA-5-5 can target exon 1 and exon 2 of the mature VEGFA mRNA.

[0046] Table 1. Guide sequences of gRNA

[0047] In some embodiments of the present disclosure, the guide sequence is engineered to hybridize to the target RNA. In some embodiments of the present disclosure, the guide sequence is engineered to hybridize to the target RNA with no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide mismatch.

[0048] In some embodiments of the present disclosure, the guide RNA is capable of forming a complex with an RNA-guided nuclease and directing sequence-specific binding of the complex to the target RNA.

[0049] In some embodiments of the present disclosure, the guide RNA is capable of forming a complex with an RNA-guided nuclease and directing the complex to bind to and cleave the target RNA.

[0050] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas protein.

[0051] In some embodiments of the present disclosure, the guide RNA is capable of forming a CRISPR complex with the Cas protein and guiding the sequence-specific binding of the CRISPR complex to the target RNA.

[0052] In some embodiments of the present disclosure, the guide RNA is capable of forming a CRISPR complex with the Cas protein and guiding the CRISPR complex to bind to and cleave the target RNA.

[0053] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas13 protein.

[0054] In some embodiments of the present disclosure, the RNA-guided nuclease is Cas13a protein, Cas13b protein, Cas13c protein or Cas13d protein.

[0055] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas13d protein.

[0056] In some embodiments of the present disclosure, the Cas protein comprises an amino acid sequence that is ≥50% identical to the sequence shown in any one of SEQ ID NOs: 1-3. In some embodiments of the present disclosure, the Cas protein comprises an amino acid sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0057] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0058] In some embodiments of the present disclosure, the Cas protein comprises a sequence as shown in any one of SEQ ID NOs: 1-3.

[0059] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in SEQ ID NO: 3. In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in SEQ ID NO: 3.

[0060] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in SEQ ID NO:3.

[0061] In some embodiments of the present disclosure, the Cas protein comprises the sequence shown in SEQ ID NO:3.

[0062] In some embodiments of the present disclosure, the Cas protein comprises a sequence with a sequence identity of ≥50% to CasRx. In some embodiments of the present disclosure, the Cas protein comprises a sequence with an identity of ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99% or ≥99.5% to the sequence shown in any one of SEQ ID NOs: 1-3.

[0063] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to CasRx.

[0064] In some embodiments of the present disclosure, the Cas protein comprises the sequence of CasRx.

[0065] In some embodiments of the present disclosure, the RNA-guided nuclease comprises a nuclease portion and a fused homologous or heterologous domain.

[0066] In some embodiments of the present disclosure, the RNA-guided nuclease comprises any one or more of the following: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter domain, a reporter tag, an affinity domain, and an affinity tag.

[0067] In some embodiments of the present disclosure, the Cas protein comprises any one or more of the following: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter domain, a reporter tag, an affinity domain, and an affinity tag.

[0068] In some embodiments of the present disclosure, the subcellular localization signal is selected from a nuclear localization signal and a nuclear export signal sequence.

[0069] In some embodiments of the present disclosure, the target RNA is VEGFA RNA. In some embodiments of the present disclosure, the target RNA is human VEGFA RNA. In some embodiments of the present disclosure, the target RNA is VEGFA pre-mRNA. In some embodiments of the present disclosure, the target RNA is mature VEGFA mRNA.

[0070] In some embodiments of the present disclosure, the guide RNA comprises a guide sequence and a direct repeat sequence. In some embodiments of the present disclosure, the guide RNA comprises a guide sequence and a direct repeat sequence, and the direct repeat sequence interacts with the RNA-guided nuclease.

[0071] In some embodiments of the disclosure, the complex reduces the level of the target RNA in an animal (eg, a human).

[0072] In some embodiments of the disclosure, the complex reduces the level of the target RNA in a cell, such as a cell expressing the target RNA.

[0073] In some embodiments of the present disclosure, the complex reduces the level of the target RNA in the cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. The reduction in the level of the target RNA can be tested using conventional methods in the art; including but not limited to the qPCR method described in the Examples, untreated cells or cells treated with a gene editing system targeting a non-mammalian genome can be used as negative controls to calculate the target RNA knockdown level of the experimental group compared to the negative control.

[0074] In some embodiments of the present disclosure, the number of off-target genes when the complex binds to and cuts the target RNA is less than 40, less than 35, less than 30, less than 25, less than 20, less than 19, less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2 or less than 1. The number of off-target genes can be determined by conventional methods in the art. In some embodiments, the number of off-target genes is determined by taking the intersection of the differentially expressed gene set determined by RNA sequencing and the off-target gene set predicted by the program. As a non-limiting example, the program predicts the target gene using the EMBOSS-water program in the whole genome and full cDNA sequence of the target species (Homo sapiens / Mus musculus), setting the parameters to gap_extend=0.5&gap_extend=10, using the forward and reverse strands of the gRNA guide sequence for alignment, filtering the prediction results, and obtaining predicted potential target genes (including on-target genes and off-target genes).

[0075] In some embodiments of the present disclosure, the complex reduces the level of the protein encoded by the target RNA in an animal (eg, a human).

[0076] In some embodiments of the present disclosure, the complex reduces the level of the target RNA-encoded protein in the cell. In some embodiments of the present disclosure, the target RNA-encoded protein is VEGFA protein. In some embodiments of the present disclosure, the complex reduces the level of VEGFA protein in the cell.

[0077] In some embodiments of the present disclosure, the complex reduces the level of VEGFA protein in the cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. The reduction in the level of the target RNA-encoded protein can be tested using conventional methods in the art; including but not limited to ELISA and Western Blotting. Untreated cells or cells treated with a gene editing system targeting a non-mammalian genome can be used as negative controls to calculate the knockdown level of the target RNA-encoded protein in the experimental group compared to the negative control.

[0078] A second aspect of the present disclosure provides an isolated nucleic acid encoding a guide RNA according to the present disclosure.

[0079] The third aspect of the present disclosure provides a vector comprising a polynucleotide sequence encoding the guide RNA according to the present disclosure, and a regulatory sequence for regulating the expression of the guide RNA.

[0080] In some embodiments of the present disclosure, the vector is an adeno-associated virus vector.

[0081] In some embodiments of the present disclosure, the regulatory sequence is a promoter and / or enhancer sequence. In some embodiments of the present disclosure, the regulatory sequence is a promoter sequence. In some embodiments of the present disclosure, the regulatory sequence is a promoter and enhancer sequence.

[0082] In some embodiments of the present disclosure, the regulatory sequence is selected from: a native promoter, a ubiquitous promoter, a CAG promoter, a CBA promoter, a CBh promoter, a CMV promoter, and a tissue-specific promoter.

[0083] In some embodiments of the present disclosure, the regulatory sequence is a promoter, and the promoter is selected from the group consisting of: RPE65, VDM2, Mlc1, GFAP, and ICAM-2 promoters.

[0084] In some embodiments of the present disclosure, the regulatory sequence is a U6 promoter.

[0085] In some embodiments of the present disclosure, the promoter is an eye-specific promoter.

[0086] In some embodiments of the present disclosure, the promoter is a CBh promoter.

[0087] In some embodiments of the disclosure, the regulatory sequence comprises an HRE enhancer element.

[0088] In some embodiments of the present disclosure, the regulatory sequence comprises an NRS element and an HRE enhancer element in tandem.

[0089] A fourth aspect of the present disclosure provides a gene editing system comprising:

[0090] (a) a guide RNA as disclosed herein, or a polynucleotide sequence encoding the guide RNA; and

[0091] (b) an RNA-guided nuclease, or a polynucleotide sequence encoding the RNA-guided nuclease;

[0092] The guide RNA is capable of forming a complex with the nuclease and directing sequence-specific binding of the complex to the target RNA.

[0093] In some embodiments of the present disclosure, the guide RNA is capable of forming a complex with the nuclease and guiding the complex to bind to and cleave the target RNA.

[0094] In some embodiments of the present disclosure, the guide sequence is engineered to hybridize to the target RNA. In some embodiments of the present disclosure, the guide sequence is engineered to hybridize to the target RNA with no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 nucleotide mismatch.

[0095] In some embodiments of the present disclosure, the polynucleotide sequence encoding the RNA-guided nuclease is linked to a regulatory sequence, and the regulatory sequence is used to regulate the expression of the RNA-guided nuclease.

[0096] In some embodiments of the present disclosure, the polynucleotide sequence encoding the guide RNA is linked to a regulatory sequence, and the regulatory sequence is used to regulate the expression of the guide RNA.

[0097] In some embodiments of the present disclosure, the regulatory sequence that regulates expression of the RNA-guided nuclease is the same as or different from the regulatory sequence that regulates expression of the guide RNA.

[0098] In some embodiments of the present disclosure, the regulatory sequence is a promoter and / or enhancer sequence. In some embodiments of the present disclosure, the regulatory sequence is a promoter sequence. In some embodiments of the present disclosure, the regulatory sequence is a promoter and enhancer sequence.

[0099] In some embodiments of the present disclosure, the regulatory sequence is selected from: a native promoter, a ubiquitous promoter, a CAG promoter, a CBA promoter, a CBh promoter, a CMV promoter, and a tissue-specific promoter.

[0100] In some embodiments of the present disclosure, the regulatory sequence is a promoter, and the promoter is selected from the group consisting of: RPE65, VDM2, Mlc1, GFAP, and ICAM-2 promoters.

[0101] In some embodiments of the present disclosure, the regulatory sequence is a U6 promoter.

[0102] In some embodiments of the present disclosure, the promoter is an eye-specific promoter.

[0103] In some embodiments of the present disclosure, the promoter is a CBh promoter.

[0104] In some embodiments of the present disclosure, the regulatory sequence comprises an HRE enhancer element (hypoxia response element). In some embodiments, the regulatory sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 HRE enhancer elements in series. In some embodiments, the regulatory sequence comprises 2, 3, 4, 5, 6, 7, 8, or 9 HRE enhancer elements in series.

[0105] In some embodiments of the present disclosure, the regulatory sequence comprises an NRS element (neuron restrictive silencer) from the human synapsin gene (human synapsin gene). In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element. In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element in series. To enhance the regulatory effect, the NRS element and the HRE enhancer element in series can be repeated multiple times. In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element in series that are repeated at least 2 times, at least 3 times, at least 4 times, at least 5 times or at least 6 times. In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element in series that are repeated 2 times, 3 times, 4 times, 5 times or 6 times.

[0106] In some embodiments of the present disclosure, the HRE enhancer element sequence is TGTCACGTCCTGCACGACGTA (SEQ ID NO: 233) or its reverse complementary sequence.

[0107] In some embodiments of the present disclosure, the NRS element sequence is TTCAGCACCGCGGACAGTGCC (SEQ ID NO: 234) or its reverse complement sequence.

[0108] In some embodiments of the present disclosure, the regulatory sequence comprises repeats of TGTCACGTCCTGCACGACGTA (SEQ ID NO: 233) or its reverse complement.

[0109] In some embodiments of the present disclosure, the regulatory sequence comprises a tandem sequence of TTCAGCACCGCGGACAGTGCCTGTCACGTCCTGCACGACGTA (SEQ ID NO: 235) or a reverse complement thereof.

[0110] In some embodiments of the present disclosure, the gene editing system is a CRISPR-Cas system.

[0111] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas protein.

[0112] In some embodiments of the present disclosure, the guide RNA is capable of forming a CRISPR complex with the Cas protein and guiding the sequence-specific binding of the CRISPR complex to the target RNA.

[0113] In some embodiments of the present disclosure, the guide RNA is capable of forming a CRISPR complex with the Cas protein and guiding the CRISPR complex to bind to and cleave the target RNA.

[0114] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas13 protein.

[0115] In some embodiments of the present disclosure, the RNA-guided nuclease is Cas13a protein, Cas13b protein, Cas13c protein or Cas13d protein.

[0116] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas13d protein.

[0117] In some embodiments of the present disclosure, the Cas protein comprises an amino acid sequence that is ≥50% identical to the sequence shown in any one of SEQ ID NOs: 1-3. In some embodiments of the present disclosure, the Cas protein comprises an amino acid sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0118] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0119] In some embodiments of the present disclosure, the Cas protein comprises a sequence as shown in any one of SEQ ID NOs: 1-3.

[0120] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in SEQ ID NO: 3. In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in SEQ ID NO: 3.

[0121] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in SEQ ID NO:3.

[0122] In some embodiments of the present disclosure, the Cas protein comprises the sequence shown in SEQ ID NO:3.

[0123] In some embodiments of the present disclosure, the Cas protein comprises a sequence with a sequence identity of ≥50% to CasRx. In some embodiments of the present disclosure, the Cas protein comprises a sequence with an identity of ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99% or ≥99.5% to the sequence shown in any one of SEQ ID NOs: 1-3.

[0124] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to CasRx.

[0125] In some embodiments of the present disclosure, the Cas protein comprises the sequence of CasRx.

[0126] In some embodiments of the present disclosure, the gene editing system is a CRISPR-Cas system, which comprises:

[0127] (a) a guide RNA as disclosed herein, or a polynucleotide sequence encoding the guide RNA; and

[0128] (b) Cas protein, or a polynucleotide sequence encoding the Cas13 protein;

[0129] The guide RNA is capable of forming a complex with the Cas13 protein and guiding the sequence-specific binding of the complex to the target RNA.

[0130] In some embodiments of the present disclosure, the gene editing system comprises:

[0131] (a) a guide RNA as disclosed herein, or a polynucleotide sequence encoding the guide RNA; and

[0132] (b) Cas13 protein, or a polynucleotide sequence encoding the Cas13 protein;

[0133] The guide RNA is capable of forming a complex with the Cas13 protein and guiding the complex to bind to and cut the target RNA.

[0134] In some embodiments of the present disclosure, the polynucleotide sequence encoding the guide RNA is linked to a first regulatory sequence, and the first regulatory sequence is used to regulate the expression of the guide RNA; the polynucleotide sequence encoding the RNA-guided nuclease is linked to a second regulatory sequence, and the second regulatory sequence is used to regulate the expression of the RNA-guided nuclease.

[0135] In some embodiments of the present disclosure, the RNA-guided nuclease comprises a nuclease portion and a fused homologous or heterologous domain.

[0136] In some embodiments of the present disclosure, the RNA-guided nuclease comprises any one or more of the following: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter domain, a reporter tag, an affinity domain, and an affinity tag.

[0137] In some embodiments of the present disclosure, the Cas protein comprises any one or more of the following: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter domain, a reporter tag, an affinity domain, and an affinity tag.

[0138] In some embodiments of the present disclosure, the subcellular localization signal is selected from a nuclear localization signal and a nuclear export signal sequence.

[0139] The gene editing systems described herein can be introduced into cells (or cell-free systems) in a variety of non-limiting ways: (i) as mRNA encoding an RNA-guided nuclease and a guide RNA, (ii) as part of a single vector or plasmid, or divided into multiple vectors or plasmids, (iii) as separate RNA-guided nucleases and guide RNAs, or (iv) as an RNP complex of an RNA-guided nuclease and a guide RNA.

[0140] In some embodiments of the present disclosure, the target RNA is VEGFA RNA. In some embodiments of the present disclosure, the target RNA is VEGFA pre-mRNA. In some embodiments of the present disclosure, the target RNA is mature VEGFA mRNA.

[0141] In some embodiments of the disclosure, the complex reduces the level of the target RNA in an animal (eg, a human).

[0142] In some embodiments of the disclosure, the complex reduces the level of the target RNA in a cell, such as a cell expressing the target RNA.

[0143] In some embodiments of the present disclosure, the complex reduces the level of the target RNA in the cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. In other words, the editing efficiency of the gene editing system is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. The reduction in the target RNA level can be tested using conventional methods in the art, including but not limited to the qPCR method described in the Examples. Untreated cells or cells treated with a gene editing system targeting a non-mammalian genome can be used as negative controls to calculate the target RNA knockdown level in the experimental group compared to the negative control.

[0144] In some embodiments of the present disclosure, the number of off-target genes when the complex binds to and cuts the target RNA is less than 40, less than 35, less than 30, less than 25, less than 20, less than 19, less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2 or less than 1. The number of off-target genes can be determined by conventional methods in the art. In some embodiments, the number of off-target genes is determined by taking the intersection of the differentially expressed gene set determined by RNA sequencing and the off-target gene set predicted by the program. As a non-limiting example, the program predicts the target gene using the EMBOSS-water program in the whole genome and full cDNA sequence of the target species (Homo sapiens / Mus musculus), setting the parameters to gap_extend=0.5&gap_extend=10, using the forward and reverse strands of the gRNA guide sequence for alignment, filtering the prediction results, and obtaining predicted potential target genes (including on-target genes and off-target genes).

[0145] In some embodiments of the present disclosure, the complex reduces the level of the protein encoded by the target RNA in an animal (eg, a human).

[0146] In some embodiments of the present disclosure, the complex reduces the level of the target RNA-encoded protein in the cell. In some embodiments of the present disclosure, the target RNA-encoded protein is VEGFA protein. In some embodiments of the present disclosure, the complex reduces the level of VEGFA protein in the cell.

[0147] In some embodiments of the present disclosure, the complex reduces the level of VEGFA protein in the cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. The reduction in the level of the target RNA-encoded protein can be tested using conventional methods in the art; including but not limited to ELISA and Western Blotting. Untreated cells or cells treated with a gene editing system targeting a non-mammalian genome can be used as negative controls to calculate the knockdown level of the target RNA-encoded protein in the experimental group compared to the negative control.

[0148] The fifth aspect of the present disclosure provides a vector system comprising the gene editing system described in the present disclosure, wherein the vector system comprises a polynucleotide sequence encoding the guide RNA and a first regulatory sequence that regulates the expression of the guide RNA; and a polynucleotide sequence encoding the RNA-guided nuclease and a second regulatory sequence that regulates the expression of the RNA-guided nuclease.

[0149] In some embodiments of the present disclosure, the vector system comprises one or more vectors.

[0150] In some embodiments of the present disclosure, the vector system comprises only one vector.

[0151] In some embodiments of the present disclosure, the vector system comprises multiple vectors, the polynucleotide sequence encoding the guide RNA and the first regulatory sequence regulating the expression of the guide RNA are located on the first vector, and the polynucleotide sequence encoding the RNA-guided nuclease and the second regulatory sequence regulating the expression of the RNA-guided nuclease are located on the second vector.

[0152] In some embodiments of the present disclosure, the first regulatory sequence and / or the second regulatory sequence is a promoter and / or enhancer sequence. In some embodiments of the present disclosure, the first regulatory sequence or the second regulatory sequence is a promoter sequence. In some embodiments of the present disclosure, the first regulatory sequence and the second regulatory sequence are a promoter and enhancer sequence.

[0153] The sixth aspect of the present disclosure provides an adeno-associated viral vector comprising the gene editing system described in the present disclosure, wherein the adeno-associated viral vector comprises DNA encoding the RNA-guided nuclease and guide RNA described in the present disclosure.

[0154] A seventh aspect of the present disclosure provides a lipid nanoparticle comprising the gene editing system described in the present disclosure, wherein the lipid nanoparticle comprises the guide RNA described in the present disclosure and an mRNA encoding the RNA-guided nuclease.

[0155] An eighth aspect of the present disclosure provides a lentiviral vector comprising the gene editing system described in the present disclosure, wherein the lentiviral vector comprises the guide RNA described in the present disclosure and an mRNA encoding the RNA-guided nuclease; optionally, the lentiviral vector is pseudotyped with an envelope protein; optionally, the mRNA encoding the RNA-guided nuclease is linked to an aptamer sequence.

[0156] A ninth aspect of the present disclosure provides a ribonucleoprotein complex comprising the gene editing system described in the present disclosure, wherein the ribonucleoprotein complex is formed by the guide RNA described in the present disclosure and the nuclease guided by the RNA.

[0157] The tenth aspect of the present disclosure provides a virus-like particle comprising the gene editing system described in the present disclosure, wherein the virus-like particle comprises a ribonucleoprotein complex formed by the guide RNA described in the present disclosure and the RNA-guided nuclease; optionally, the RNA-guided nuclease is fused to the gag protein.

[0158] The eleventh aspect of the present disclosure provides a eukaryotic cell comprising the gene editing system described in the present disclosure; optionally, the eukaryotic cell is a mammalian cell.

[0159] The twelfth aspect of the present disclosure provides a pharmaceutical composition, which comprises the gene editing system described in the present disclosure, the vector system described in the present disclosure, the adeno-associated virus vector described in the present disclosure, the lipid nanoparticles described in the present disclosure, the lentiviral vector described in the present disclosure, the ribonucleoprotein complex described in the present disclosure, the virus-like particles described in the present disclosure, or the eukaryotic cells described in the present disclosure.

[0160] In some embodiments of the present disclosure, the pharmaceutical composition comprises a pharmaceutically acceptable excipient.

[0161] A thirteenth aspect of the present disclosure provides use of the guide RNA, the isolated nucleic acid, the vector, the gene editing system, the vector system, the adeno-associated virus vector, the lipid nanoparticle, the lentiviral vector, the ribonucleoprotein complex, the eukaryotic cell, the pharmaceutical composition, and / or the virus-like particle according to the present disclosure in any of the following or in the preparation of a reagent for implementing any of the following schemes:

[0162] Cleave or nick one or more target RNA molecules, activate or upregulate one or more target RNA molecules, activate or inhibit translation of one or more target RNA molecules, inactivate one or more target RNA molecules, visualize, label or detect one or more target RNA molecules, bind one or more target RNA molecules, transport one or more target RNA molecules, and mask one or more target RNA molecules.

[0163] In some embodiments of the present disclosure, there is provided use of the guide RNA, the isolated nucleic acid, the vector, the gene editing system, the vector system, the adeno-associated virus vector, the lipid nanoparticle, the lentiviral vector, the ribonucleoprotein complex, and the virus-like particle described herein in any of the following or in the preparation of a reagent for achieving any of the following:

[0164] Cleave one or more target RNA molecules, bind one or more target RNA molecules.

[0165] In some embodiments of the present disclosure, the target RNA is VEGFA RNA.

[0166] For example, it will be appreciated by those skilled in the art that the nuclease guided by RNA can be fused or associated with one or more homologous or heterologous domains (e.g., by fusion proteins, linker peptides, etc.). For example, Cas13 mutants that have completely or partially lost nuclease activity are fused with homologous or heterologous domains. These homologous or heterologous domains can have various activities, such as methylase activity, demethylase activity, deaminase activity, translation activation activity, translation inhibition activity, RNA cutting activity, nucleic acid binding activity, base editing activity, and switching activity (e.g., light induction). The homologous or heterologous domain includes, but is not limited to, a positioning signal (e.g., nuclear localization signal NLS, nuclear export signal NES), a label or detection label (e.g., a fluorescent dye such as FITC or DAPI), a targeting moiety, an antigenic determinant tag (e.g., Hismyc, V5, FLAG, HA, VSV-G, Trx, etc.), a deaminase or a deamination domain (e.g., ADAR1, ADAR2, APOBEC, AID, or TAD), a methylase, a demethylase, an ssRNA cleavage activity domain, a dsRNA cleavage activity domain, a DNA or RNA ligase, or any combination thereof. For example, the Cas13 protein can be fused to a deaminase and combined with a gRNA to target the target RNA to achieve single-base editing of the target RNA molecule. For example, the homologous or heterologous domain can be a detectable label, and when the CRISPR-CAS complex contacts or binds to the target nucleic acid, the conjugate containing the Cas13 nuclease cuts or modifies the target nucleic acid, and the presence of the target nucleic acid in the sample to be tested is analyzed by observing the presence of the detectable label. The detectable label may be a fluorescent group, a color developing agent, an imaging agent or a radioactive isotope.

[0167] The fourteenth aspect of the present disclosure provides a method for diagnosing, treating or preventing a disease or condition associated with a target RNA, comprising administering an effective amount of the guide RNA described in the present disclosure, the isolated nucleic acid described in the present disclosure, the vector described in the present disclosure, the gene editing system described in the present disclosure, the vector system described in the present disclosure, the adeno-associated virus vector described in the present disclosure, the lipid nanoparticles described in the present disclosure, the lentiviral vector described in the present disclosure, the ribonucleoprotein complex described in the present disclosure, the virus-like particle described in the present disclosure, or the pharmaceutical composition described in the present disclosure to a sample of a subject in need or to a subject in need.

[0168] In some embodiments of the present disclosure, the disease or disorder associated with the target RNA refers to a disease or disorder caused by abnormal expression of the target RNA.

[0169] In some embodiments of the present disclosure, the disease or disorder associated with the target RNA includes but is not limited to age-related macular degeneration.

[0170] In some embodiments of the present disclosure, the disease or condition associated with the target RNA includes but is not limited to dry age-related macular degeneration. In some embodiments of the present disclosure, the disease or condition associated with the target RNA includes but is not limited to wet age-related macular degeneration.

[0171] In some embodiments of the present disclosure, the target RNA is VEGFA RNA.

[0172] The fifteenth aspect of the present disclosure provides the use of the guide RNA described in the present disclosure, the isolated nucleic acid described in the present disclosure, the vector described in the present disclosure, the gene editing system described in the present disclosure, the vector system described in the present disclosure, the adeno-associated virus vector described in the present disclosure, the lipid nanoparticles described in the present disclosure, the lentiviral vector described in the present disclosure, the ribonucleoprotein complex described in the present disclosure and the virus-like particle described in the present disclosure in the preparation of a medicament for diagnosing, treating or preventing a disease or condition associated with the target RNA.

[0173] In some embodiments of the present disclosure, the disease or disorder associated with the target RNA refers to a disease or disorder caused by abnormal expression of the target RNA.

[0174] In some embodiments of the present disclosure, the disease or disorder associated with the target RNA includes but is not limited to age-related macular degeneration.

[0175] In some embodiments of the present disclosure, the disease or condition associated with the target RNA includes but is not limited to dry age-related macular degeneration. In some embodiments of the present disclosure, the disease or condition associated with the target RNA includes but is not limited to wet age-related macular degeneration.

[0176] In some embodiments of the present disclosure, the target RNA is VEGFA RNA.

[0177] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0178] Figure 1 is a schematic diagram of the editing efficiency results of different Cas13 and gRNA combinations in cells.

[0179] FIG2 is a schematic diagram of the relative expression results of VEGFA RNA.

[0180] Figure 3 is a schematic diagram of the editing efficiency results of different tool combinations.

[0181] Figure 4A is a schematic diagram showing the comparison of the editing efficiency of gRNA-5 and gRNA-6 at the RNA level.

[0182] Figure 4B is a schematic diagram showing the comparison of the editing efficiency of gRNA-4 and gRNA-6 at the RNA level.

[0183] FIG4C is a schematic diagram showing the comparison results of the knockdown efficiency at the protein level.

[0184] FIG5 is a schematic diagram of the editing efficiency results in mice.

[0185] Figure 6 is a schematic diagram of the editing efficiency results of some gRNAs from gRNA-11 to gRNA-32 at the RNA level.

[0186] Figure 7 is a schematic diagram of the editing efficiency results of gRNA-11 to gRNA-32 at the protein level.

[0187] FIG8 is a schematic diagram showing the editing efficiency results of the region near the splicing site of VEGFA RNA.

[0188] Figures 9A and 9B show the editing effects of adjacent regions targeting the gRNA-30 target sequence. Figure 9A shows the specific location of each target sequence and the corresponding editing efficiency, and Figure 9B shows the editing efficiency presented in the form of mean + standard deviation.

[0189] Figure 10 shows the genome-wide read distribution of the target VEGFA gene using IGV software after editing cells with C13-2-gRNA5 and CasRx-X-dual. The figure shows the results of three experimental batches.

[0190] FIG11 shows the design principles of gRNA-5-2 to gRNA-5-5.

[0191] Figure 12 shows the genome-wide read distribution of the target VEGFA as displayed by IGV software after C13-2-gRNA edited cells.

[0192] Figure 13 shows that gRNA-4 and gRNA-5 significantly inhibited neovascularization. The white dashed circular selection boxes in the figure indicate laser photocoagulation sites. Seven days after modeling, the neovascularization sites were stained with IB4-488. Ten mice were included in each group. AAV was delivered via subretinal injection into both eyes. All eyes successfully treated three weeks after drug administration were selected for laser modeling. Seven days after modeling, samples were harvested, fixed, stained, and photographed for statistical analysis. Bar = 200 μm.

[0193] Figure 14 shows that the combination of CasRx in Example 12 and the gRNA disclosed herein also has a higher editing efficiency.

[0194] Figure 15 shows the effect of inhibiting angiogenesis in non-human primates (NHP) cynomolgus monkeys. The drug groups C13-2-gRNA-30 and C13-2-gRNA-5 can significantly inhibit the formation of grade IV spots, that is, significantly inhibit the development of new blood vessels, and the effect is sustained over a long period of time. DETAILED DESCRIPTION

[0195] The terms "guide sequence" and "targeting domain" are used interchangeably.

[0196] When referring to a "guide sequence," "t" is used interchangeably with "u" in the sequence.

[0197] When referring to RNA sequences, "t" is used interchangeably with "u" in the sequence.

[0198] When referring to a "direct repeat sequence," "t" is used interchangeably with "u" in the sequence.

[0199] Definition section:

[0200] As used herein, the term gene editing system guide RNA, guide RNA, guide RNA and gRNA are used interchangeably. The term guide RNA is used to refer to a molecule in a gene editing system that forms a complex with the RNA-guided nuclease and guides the sequence-specific binding of the complex to the target sequence. The guide RNA comprises a guide sequence that can hybridize with the target sequence. When the RNA-guided nuclease is a Cas protein, especially a Cas13 protein, the guide RNA typically comprises a co-directional repeat sequence connected to the guide sequence.

[0201] As used herein, the terms "guide sequence" and "targeting domain" are used interchangeably and refer to a contiguous nucleotide sequence in a gRNA that has partial or full complementarity with a target sequence in a target RNA and can hybridize to the target sequence in the target RNA through base pairing promoted by an RNA-guided nuclease. Full complementarity between the guide sequence and the target sequence described in the present disclosure is not required, as long as there is sufficient complementarity to cause hybridization and promote the formation of a gene editing complex.

[0202] Suitable direct repeat (DR) sequences may be present in the CRISPR locus structure of prokaryotes (such as bacteria and archaea) and obtained through experimental screening; they may also be obtained through sequence modification or optimization on this basis, non-limiting examples of which include the deletion, replacement or addition of 1, 2, 3, 4 or more complementary base pairs in the complementary double-stranded region of the secondary structure of the DR sequence, and the deletion, replacement or addition of nucleotides on the loop of the stem-loop structure of the secondary structure of the DR sequence (for example, an aptamer sequence may be inserted into the loop). The size of the direct repeat sequence is usually tens of nucleotides, and some of its fragments are reverse complementary to each other, which means that a secondary structure is formed inside the RNA molecule, such as a stem-loop structure (often called a hairpin structure), and other fragments are unstructured. When the RNA-guided nuclease is a Cas protein, the direct repeat sequence is a constant part of the gRNA molecule, which contains a strong secondary structure, which is conducive to the interaction between the Cas protein and the gRNA molecule.

[0203] The term "hybridization" or "hybridization" refers to the process in which fully or partially complementary polynucleotide chains come together to form a double-stranded structure or region under suitable hybridization conditions, including the association between the nucleic acids caused by hydrogen bonds. As used herein, the term hybridization includes situations in which double-stranded structures or regions contain one or more protrusions or mispairings. The intensity of hybridization and hybridization (that is, the intensity of association between nucleic acids) is affected by factors such as the degree of complementarity between the nucleic acids, the stringency of the conditions involved, and the Tm of the formed hybrid. Although hydrogen bonds are generally formed between adenine and thymine, adenine and uracil, or between cytosine and guanine, other non-classical base pairs can also form hydrogen bonds. It is contemplated that the modified nucleotides can form hydrogen bonds that allow or promote hybridization using non-classical approaches.

[0204] As used herein, the term target RNA refers to a polynucleotide containing a target sequence, indicating a specific sequence or its reverse complement that one wishes to bind, target, or modify using a gene editing system. For example, it can be a complete mature mRNA molecule or a pre-mRNA molecule.

[0205] As used herein, the term target sequence refers to a short sequence in a target RNA molecule that is complementary (completely complementary or partially complementary) to the guide sequence of the gRNA molecule. The gene editing complex is specifically located at the target sequence by the guide sequence sequence and performs the corresponding function at or near this position. The length of the target sequence is often tens of nt (nucleotides), for example, about 10nt, about 20nt, about 30nt, about 40nt, about 50nt, about 60nt.

[0206] As used herein, the terms cleavage and cleaving refer to breaking covalent bonds (eg, covalent phosphodiester bonds) in the ribosyl phosphodiester backbone of a polynucleotide.

[0207] The ability of a guide RNA to direct sequence-specific binding of a gene editing complex to a target RNA can be assessed by any suitable assay. For example, components of a gene editing system sufficient to form a CRISPR complex, including the guide RNA to be tested, can be provided to a host cell having a corresponding target RNA molecule, such as by transfection of a vector encoding the components of the CRISPR complex, and then preferential cleavage within the target sequence can be assessed. Similarly, cleavage of a target RNA sequence can be assessed in a test tube by providing a target RNA, components of a CRISPR complex, including the guide RNA to be tested and a control guide RNA that is different from the test guide RNA, and comparing the ability to bind to the target RNA or the rate at which the target RNA is cut between the guide RNA to be tested and the control guide RNA. The ability of a guide RNA to direct a complex to cut a target RNA can also be assessed by the assays described above.

[0208] The term RNA-guided nuclease refers to a polypeptide that binds to a specific target RNA sequence in a sequence-specific manner, and the polypeptide is guided to the target RNA by a guide RNA that is complexed with the polypeptide and hybridized to the target sequence on the target RNA. The cleavage of the target sequence by the RNA-guided nuclease can result in chain breaks. Although RNA-guided nucleases can cut the target sequence when bound, the term RNA-guided nuclease also includes RNA-guided nucleases that are capable of binding but not cutting the target sequence. The RNA-guided nucleases described in the present disclosure include, but are not limited to, wild-type RNA-guided nucleases (e.g., C13-2, CasRx, etc.), variants thereof (e.g., mutants with complete loss of cleavage activity, mutants with partial loss of cleavage activity, mutants with increased cleavage activity, mutants with reduced off-target effects, mutants with reduced side-cutting effects), and functional fragments or fusion proteins thereof.

[0209] As used herein, the term Cas protein is a CRISPR-related (Cas) polypeptide or protein that, when compounded or functionally combined with one or more guide RNAs, can be guided to a target sequence in a target RNA, and sometimes can subsequently bind to or cut the target RNA. The term Cas protein also includes nuclease-inactivated Cas proteins that can bind but not cut a target sequence. The Cas protein described in the present disclosure includes but is not limited to wild-type Cas proteins (e.g., C13-2, CasRx, etc.), variants thereof (e.g., mutants with complete loss of cleavage activity, mutants with partial loss of cleavage activity, mutants with increased cleavage activity, mutants with reduced off-target effects, mutants with reduced side-cutting effects), and functional fragments or fusion proteins thereof.

[0210] As used herein, when referring to a nucleotide sequence / DNA / RNA encoding a protein, RNA, or CRISPR complex, the coding sequence may be codon-optimized, for example, codon-optimized for expression in a eukaryotic cell environment, codon-optimized for expression in a mammalian cell environment, or codon-optimized for expression in a human cell environment.

[0211] As used herein, the term "sequence identity" (identity or percent identity) is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a certain position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (for example, a certain position in each of the two DNA molecules is occupied by adenine, or a certain position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percent sequence identity" (percent identity) between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100%. For example, if 6 out of 10 positions in two sequences match, then the two sequences have 60% sequence identity. Typically, comparisons are made when two sequences are aligned to produce maximum sequence identity. Such comparisons can be performed using published and commercially available alignment algorithms and programs, such as, but not limited to, ClustalΩ, MAFFT, Probcons, T-Coffee, Probalign, BLAST, which can be reasonably selected by one of ordinary skill in the art. Those skilled in the art can determine appropriate parameters for aligning sequences, including, for example, any algorithm required for achieving optimal alignment or optimal comparison over the full length of the compared sequences, and any algorithm required for achieving optimal alignment or optimal comparison over a portion of the compared sequences. When the Cas13 protein described in the present disclosure is fused with other domains, the sequence identity of the Cas13 protein portion is compared.

[0212] As used herein, the term regulatory sequence is intended to include promoters, enhancers, internal ribosome entry sites (IRES) and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences). Regulatory sequences include those elements that direct the continuous expression of nucleotide sequences in many types of host cells and those elements that direct the expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can guide expression primarily in desired tissues of interest such as muscle, neurons, bones, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., neuronal cells, lymphocytes). Regulatory sequences can also guide expression in a time-dependent manner such as cell cycle dependency or developmental stage dependency, which may or may not be tissue-specific or cell type-specific. The term regulatory sequence also encompasses enhancer elements such as WPRE, CMV enhancer, SV40 enhancer, HRE enhancer element, and the intron sequence between exon 2 and 3 of rabbit beta-globulin.

[0213] As used herein, the term promoter has the meaning commonly recognized in the art.

[0214] As used herein, the term enhancer has the meaning commonly recognized in the art.

[0215] Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of the host cell to be transformed, the desired expression level, etc. The vector can be introduced into a host cell to produce the RNA-guided nuclease and / or guide RNA described herein.

[0216] As used herein, the term pharmaceutically acceptable excipient refers to a diluent, adjuvant, pharmaceutical carrier or other excipient administered together with the active ingredient. Its selection depends on the method of administration of purposes and expectation. Excipient should not be incompatible with the active ingredient, for example, producing any undesirable biological effect or interacting with any other component of the pharmaceutical composition in a harmful manner. Pharmaceutical composition can be prepared by known methods in the field of pharmaceutical preparation.

[0217] guide RNA

[0218] In some embodiments of the present disclosure, the guide RNA is capable of forming a complex with an RNA-guided nuclease (also referred to as a gene editing complex) and guiding the sequence-specific binding of the complex to the target RNA.

[0219] In some embodiments of the present disclosure, the guide RNA is capable of forming a complex with an RNA-guided nuclease and directing the complex to bind to and cleave the target RNA.

[0220] In some embodiments of the disclosure, the complex reduces the level of the target RNA in an animal (eg, a human).

[0221] In some embodiments of the disclosure, the complex reduces the level of the target RNA in a cell, such as a cell expressing the target RNA.

[0222] In some embodiments of the present disclosure, the complex reduces the level of the target RNA in the cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. The reduction in the level of the target RNA can be tested using conventional methods in the art; including but not limited to the qPCR method described in the Examples, untreated cells or cells treated with a gene editing system targeting a non-mammalian genome can be used as negative controls to calculate the target RNA knockdown level of the experimental group compared to the negative control.

[0223] In some embodiments of the present disclosure, the number of off-target genes when the complex binds to and cuts the target RNA is less than 40, less than 35, less than 30, less than 25, less than 20, less than 19, less than 18, less than 17, less than 16, less than 15, less than 14, less than 13, less than 12, less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, less than 3, less than 2 or less than 1. The number of off-target genes can be determined by conventional methods in the art. In some embodiments, the number of off-target genes is determined by taking the intersection of the differentially expressed gene set determined by RNA sequencing and the off-target gene set predicted by the program. As a non-limiting example, the program prediction method is as follows: using the EMBOSS-water program to predict in the whole genome and full cDNA sequence of the target species (Homo sapiens / Mus musculus), setting the parameters to gap_extend=0.5&gap_extend=10, using the forward and reverse strands of the gRNA guide sequence for comparison, filtering the prediction results to obtain predicted potential target genes (including on-target genes and off-target genes), from which the off-target gene set is removed after the on-target gene.

[0224] In some embodiments of the present disclosure, the complex reduces the level of the protein encoded by the target RNA in an animal (eg, a human).

[0225] In some embodiments of the present disclosure, the complex reduces the level of the target RNA-encoded protein in the cell. In some embodiments of the present disclosure, the target RNA-encoded protein is VEGFA protein. In some embodiments of the present disclosure, the complex reduces the level of VEGFA protein in the cell.

[0226] In some embodiments of the present disclosure, the complex reduces the level of VEGFA protein in the cell by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. The reduction in the level of the target RNA-encoded protein can be tested using conventional methods in the art; including but not limited to ELISA and Western Blotting. Untreated cells or cells treated with a gene editing system targeting a non-mammalian genome can be used as negative controls to calculate the knockdown level of the target RNA-encoded protein in the experimental group compared to the negative control.

[0227] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas protein. In some embodiments, the cleavage activity of the RNA-guided nuclease is completely or partially lost.

[0228] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas protein, and the guide RNA comprises a guide sequence and a direct repeat sequence.

[0229] In some embodiments of the present disclosure, the Cas protein is a Cas13 protein.

[0230] In some embodiments of the present disclosure, the Cas protein is Cas13a protein, Cas13b protein, Cas13c protein or Cas13d protein. In some embodiments of the present disclosure, the Cas protein is a Cas13a protein, Cas13b protein, Cas13c protein or Cas13d protein in which the catalytic center RxxxxH motif of two HEPN domains carries a mutation, and the cleavage activity of these Cas proteins is completely or partially lost. In some embodiments, the Cas protein is a CasRx protein. In some embodiments, the Cas protein is a dCasRx in which two HEPN domains carry mutations (R239A, H244A of HEPN-1 and R858A, H863A of HEPN-2).

[0231] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in any one of SEQ ID NOs: 1-3. In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0232] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0233] In some embodiments of the present disclosure, the Cas protein comprises a sequence as shown in any one of SEQ ID NOs: 1-3.

[0234] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in SEQ ID NO: 3. In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in SEQ ID NO: 3.

[0235] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in SEQ ID NO:3.

[0236] In some embodiments of the present disclosure, the Cas protein comprises the sequence shown in SEQ ID NO:3.

[0237] In some embodiments of the present disclosure, the Cas protein comprises a sequence with a sequence identity of ≥50% to CasRx. In some embodiments of the present disclosure, the Cas protein comprises a sequence with an identity of ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% to the sequence shown in any one of SEQ ID NOs: 1-3.

[0238] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to CasRx.

[0239] In some embodiments of the present disclosure, the Cas protein comprises the sequence of CasRx.

[0240] In some embodiments of the present disclosure, the RNA-guided nuclease comprises a nuclease portion and a fused homologous or heterologous domain.

[0241] In some embodiments of the present disclosure, the RNA-guided nuclease comprises any one or more of the following: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter domain, a reporter tag, an affinity domain, and an affinity tag.

[0242] In some embodiments of the disclosure, the guide sequence comprises 20-40, 20-35, 20-30, or 25-30 nucleotides.

[0243] In some embodiments of the present disclosure, the guide sequence hybridizes to the target RNA with no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 mismatch.

[0244] In some embodiments of the present disclosure, the guide sequence has 100% sequence identity with the target RNA, i.e., is fully complementary.

[0245] In some embodiments of the present disclosure, the guide RNA comprises a guide sequence and a direct repeat sequence. In some embodiments of the present disclosure, the guide RNA comprises a guide sequence and a direct repeat sequence, and the direct repeat sequence interacts with the RNA-guided nuclease.

[0246] In some embodiments of the present disclosure, the guide sequence is located at the 3' end or 5' end of the direct repeat sequence. In some embodiments of the present disclosure, the guide sequence is located at the 3' end of the direct repeat sequence. In some embodiments of the present disclosure, the guide sequence is located at the 5' end of the direct repeat sequence.

[0247] In some embodiments of the present disclosure, the direct repeat sequence comprises a sequence that is ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97% or ≥98% identical to the sequence shown in any one of SEQ ID NOs: 19-21.

[0248] In some embodiments of the present disclosure, the direct repeat sequence comprises a sequence that is 100% identical to the sequence shown in any one of SEQ ID NOs: 19-21.

[0249] In some embodiments of the present disclosure, the direct repeat sequence comprises a sequence as shown in any one of SEQ ID NOs: 19-21. In some embodiments of the present disclosure, the direct repeat sequence consists of a sequence as shown in any one of SEQ ID NOs: 19-21. In some embodiments of the present disclosure, the direct repeat sequence consists of a sequence as shown in SEQ ID NO: 21.

[0250] In some embodiments of the present disclosure, the direct repeat sequence comprises a sequence having a sequence identity of ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97% or ≥98% to the direct repeat sequence corresponding to CasRx in the embodiments of the present disclosure.

[0251] In some embodiments of the present disclosure, the direct repeat sequence comprises a sequence that has 100% sequence identity with the direct repeat sequence corresponding to CasRx in the examples of the present disclosure.

[0252] In some embodiments of the present disclosure, the direct repeat sequence comprises the direct repeat sequence corresponding to CasRx in the examples of the present disclosure.

[0253] In some embodiments of the present disclosure, the guide RNA comprises an aptamer sequence.

[0254] In some embodiments of the present disclosure, the aptamer sequence is inserted into the loop of the stem-loop structure of the direct repeat sequence secondary structure of the guide RNA.

[0255] In some embodiments of the present disclosure, the guide RNA comprises modified nucleotides. The modifications include, but are not limited to, 2'-O-methyl, 2'-O-methyl-3'-phosphorothioate or 2'-O-methyl-3'-thio PACE modifications. In some embodiments of the present disclosure, the guide RNA comprises modified nucleotides selected from deoxyribonucleotides and locked nucleic acids (LNA). In some embodiments, the guide RNA comprises at least one chemically modified nucleotide. In some embodiments, the guide RNA is a hybrid RNA-DNA guide, i.e., some RNA nucleotides in the guide RNA are replaced by DNA nucleotides. In some embodiments, the guide RNA is a hybrid RNA-LNA (locked nucleic acid) guide, i.e., some RNA nucleotides in the guide RNA are replaced by LNA nucleotides.

[0256] In some embodiments of the present disclosure, the target RNA is located in the nucleus and / or cytoplasm of a eukaryotic cell.

[0257] target RNA

[0258] The gene editing systems and compositions disclosed herein can be used to target one or more target RNA molecules, such as target RNA molecules present in a biological sample. In some embodiments, the target RNA is pre-mRNA or mRNA (mature mRNA).

[0259] In some embodiments of the present disclosure, the target RNA is VEGFA RNA. In some embodiments of the present disclosure, the target RNA is human VEGFA RNA.

[0260] In some embodiments of the present disclosure, the target RNA is VEGFA RNA or a fragment thereof; optionally, the VEGFA RNA is derived from humans.

[0261] In some embodiments of the present disclosure, the target RNA is VEGFA mRNA or a fragment thereof; optionally, the VEGFA mRNA is derived from human.

[0262] In some embodiments of the present disclosure, the target RNA is VEGFA pre-mRNA or a fragment thereof; optionally, the VEGFA pre-mRNA is derived from human.

[0263] In some embodiments of the present disclosure, the target RNA is located in the nucleus or cytoplasm of the cell.

[0264] In some embodiments of the present disclosure, the gene editing systems described herein can be used to increase the expression level of VEGFA RNA; for example, using an RNA-guided nuclease fused to a translation activation domain, under the guidance of a gRNA, to contact VEGFA RNA and increase its translation level. In some embodiments, the gene editing systems described herein can be used to decrease the expression level of VEGFA RNA; for example, using an RNA-guided nuclease, under the guidance of a gRNA, to contact VEGFA RNA and cleave it. In some embodiments, the gene editing systems described herein can be used to decrease the expression level of VEGFA RNA in a cell.

[0265] RNA-guided nucleases

[0266] In some embodiments of the present disclosure, the RNA-guided nuclease is a Cas protein.

[0267] In some embodiments of the present disclosure, the RNA-guided nuclease is selected from wild-type RNA-guided nucleases (including but not limited to CasRx, C13-2, etc.), variants thereof (including but not limited to mutants with complete loss of cleavage activity, mutants with partial loss of cleavage activity, mutants with increased cleavage activity, mutants with reduced off-target / bypass effects), or functional fragments thereof (such as fragments that only retain the RNA binding domain, fragments that delete the HEPN domain, etc.) or fusion proteins.

[0268] In some embodiments of the present disclosure, the RNA-guided nuclease comprises a nuclease portion and a fused homologous or heterologous domain.

[0269] In some embodiments of the present disclosure, the RNA-guided nuclease comprises any one or more of the following fusion domains: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter tag, and an affinity tag.

[0270] In some embodiments of the present disclosure, the RNA-guided nuclease comprises a subcellular localization signal.

[0271] In some embodiments of the present disclosure, the RNA-guided nuclease comprises a subcellular localization signal and a deaminase domain.

[0272] In some embodiments of the present disclosure, the subcellular localization signal is selected from a nuclear localization signal and a nuclear export signal.

[0273] In some embodiments of the present disclosure, the deaminase domain is selected from the group consisting of: cytidine deaminase, adenosine deaminase.

[0274] In some embodiments of the present disclosure, the deaminase domain is selected from the group consisting of: PPR proteins (Pentatricopeptide repeat), ADAR family proteins, and APOBEC family proteins.

[0275] In some embodiments of the present disclosure, the translation activation domain is selected from the group consisting of: eIF4E and other translation initiation factors, yeast poly(A)-binding protein, or a domain of GLD2.

[0276] In some embodiments of the present disclosure, the translation repression domain is selected from the group consisting of: Pumilio protein, deadenylase (eg, deadenylase CAF1), and Argonaute protein.

[0277] In some embodiments of the present disclosure, the nuclease domain is selected from the group consisting of: Fok I, a PIN endonuclease domain, a NYN domain, an SMR domain from SOT1, and an RNase domain from Staphylococcal nuclease.

[0278] In some embodiments of the present disclosure, the methylase domain is selected from: m6A methyltransferase.

[0279] In some embodiments of the present disclosure, the demethylation domain is selected from: RNA demethylase ALKBH5.

[0280] In some embodiments of the present disclosure, the regulatory splicing domain is selected from: SRSF1, hnRNP A1, and RBM4.

[0281] In some embodiments of the present disclosure, the RNA-guided nuclease is covalently linked to the fusion domain with or without a linker sequence; that is, the RNA-guided nuclease is directly covalently linked to the fusion domain (without a linker sequence) or covalently linked via a linker sequence. Typically, the linker sequence consists of 1-100, 1-50, 1-30, 1-20, 1-10, or 1-5 amino acids.

[0282] Cas proteins

[0283] In some embodiments of the present disclosure, the Cas protein is a Cas13 protein.

[0284] In some embodiments of the present disclosure, the Cas protein is Cas13a protein, Cas13b protein, Cas13c protein or Cas13d protein. In some embodiments of the present disclosure, the nuclease guided by the RNA is Cas13d protein.

[0285] In some embodiments of the present disclosure, the Cas protein is a Cas13a protein, a Cas13b protein, a Cas13c or a Cas13d protein in which both HEPN domains carry mutations, and the cleavage activity of these Cas proteins is completely or partially lost. In some embodiments, the Cas protein comprises the amino acid sequence of a CasRx protein. In some embodiments, the Cas protein is a CasRx protein. In some embodiments, the Cas protein is a dCasRx in which both HEPN domains carry mutations (R239A, H244A of HEPN-1 and R858A, H863A of HEPN-2).

[0286] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in any one of SEQ ID NOs: 1-3. In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0287] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in any one of SEQ ID NOs: 1-3.

[0288] In some embodiments of the present disclosure, the Cas protein comprises a sequence as shown in any one of SEQ ID NOs: 1-3.

[0289] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in SEQ ID NO: 3. In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in SEQ ID NO: 3.

[0290] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50%, ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in SEQ ID NO: 3, and the Cas protein

[0291] (a) the positions corresponding to residues R210 and H215 of the sequence shown in SEQ ID NO: 3 are mutated to other residues;

[0292] (b) the positions corresponding to residues R785 and H790 of the sequence shown in SEQ ID NO: 3 are mutated to other residues;

[0293] (c) mutations at positions corresponding to residues R210, H215, R785, and H790 of the sequence shown in SEQ ID NO: 3 to other residues; or

[0294] (d) The positions corresponding to residues R210, H215, R750A, H755A, R785 and H790 of the sequence shown in SEQ ID NO: 3 are mutated to other residues.

[0295] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is ≥50%, ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, ≥99.1%, ≥99.2%, ≥99.3%, ≥99.4%, ≥99.5%, ≥99.6%, ≥99.7% or ≥99.8% identical to the sequence shown in SEQ ID NO: 3, and the Cas protein

[0296] (a) the residues R210 and H215 of SEQ ID NO: 3 are mutated to A;

[0297] (b) mutations to A at positions corresponding to residues R785 and H790 of the sequence shown in SEQ ID NO: 3;

[0298] (c) mutations to A at the positions corresponding to residues R210, H215, R785, and H790 of the sequence shown in SEQ ID NO: 3; or

[0299] (d) The residues R210, H215, R750A, H755A, R785 and H790 of SEQ ID NO: 3 were mutated to A.

[0300] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to the sequence shown in SEQ ID NO:3.

[0301] In some embodiments of the present disclosure, the Cas protein comprises the sequence shown in SEQ ID NO:3.

[0302] In some embodiments of the present disclosure, the Cas protein comprises a sequence with a sequence identity of ≥50% to CasRx. In some embodiments of the present disclosure, the Cas protein comprises a sequence with an identity of ≥60%, ≥65%, ≥70%, ≥75%, ≥80%, ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99% or ≥99.5% to the sequence shown in any one of SEQ ID NOs: 1-3.

[0303] In some embodiments of the present disclosure, the Cas protein comprises a sequence that is 100% identical to CasRx.

[0304] In some embodiments of the present disclosure, the Cas protein comprises the sequence of CasRx.

[0305] In some embodiments of the present disclosure, the Cas protein is Cas13b protein. In some embodiments of the present disclosure, the Cas13b protein is Cas13X (also known as Cas13e) or Cas13Y (also known as Cas13f). In some embodiments of the present disclosure, the Cas13 protein has ≥80%, ≥85%, ≥90%, ≥95%, ≥98%, ≥99% or 100% sequence identity with any one of Cas13e.1-Cas13e.8. In some embodiments of the present disclosure, the Cas13 protein has ≥80%, ≥85%, ≥90%, ≥95%, ≥98%, ≥99% or 100% sequence identity with any one of Cas13f.1-Cas13f.7.

[0306] In some embodiments of the present disclosure, the Cas protein comprises a Cas protein portion and a fused homologous or heterologous domain.

[0307] In some embodiments of the present disclosure, the Cas protein comprises any one or more of the following fusion domains: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter domain, a reporter tag, an affinity domain, and an affinity tag.

[0308] In some embodiments of the present disclosure, the Cas protein comprises a subcellular localization signal.

[0309] In some embodiments of the present disclosure, the Cas protein comprises a subcellular localization signal and a deaminase domain.

[0310] In some embodiments of the present disclosure, the subcellular localization signal is selected from a nuclear localization signal and a nuclear export signal.

[0311] In some embodiments of the present disclosure, the Cas protein is covalently linked to the fusion domain with or without a linker sequence; that is, the Cas protein is directly covalently linked to the fusion domain (without a linker sequence) or covalently linked via a linker sequence. Typically, the linker sequence consists of 1-100, 1-50, 1-30, 1-20, 1-10, or 1-5 amino acids.

[0312] Nucleotide sequence encoding guide RNA or RNA-guided nuclease

[0313] In some embodiments, the nucleotide sequence encoding the RNA-guided nuclease is a plasmid. In some embodiments, the nucleotide sequence encoding the RNA-guided nuclease is part of a viral vector genome, such as the DNA genome of an AAV vector flanked by ITRs. In some embodiments, the nucleotide sequence encoding the RNA-guided nuclease is an mRNA.

[0314] In some embodiments of the present disclosure, the nucleotide sequence encoding the guide RNA or RNA-guided nuclease is codon-optimized.

[0315] In some embodiments of the present disclosure, the nucleotide sequence encoding the guide RNA is DNA. In some embodiments, the sequence of the DNA is codon optimized.

[0316] In some embodiments of the present disclosure, the nucleotide sequence encoding the RNA-guided nuclease is DNA or mRNA. In some embodiments, the sequence of the DNA is codon-optimized. In some embodiments, the sequence of the mRNA is codon-optimized.

[0317] In some embodiments of the present disclosure, codon optimization is performed for expression in a desired cell type. In some embodiments, codon optimization is performed for expression in a eukaryotic cell environment. In some embodiments, codon optimization is performed for expression in a mammalian cell environment. In some embodiments, codon optimization is performed for expression in a human cell environment.

[0318] Generally, codon optimization refers to the modification of nucleic acid sequences to enhance expression in the host cell of interest by replacing at least one codon (e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) of the original sequence with a codon that is more frequently used in the genes of the host cell and simultaneously maintains the original amino acid sequence. Computer programs or algorithms for codon optimization are also available, such as those available using the following tools or algorithms: ExpOptimizer, Codon OptimWiz, NGTM Codon, Codon optimization, Synthetic Gene Designer, and DNAWorks, etc.

[0319] Vector or vector system

[0320] Vectors can comprise any type of nucleotides, including but not limited to DNA and RNA, which can be single-stranded or double-stranded, can be partially obtained from natural sources, and can comprise natural, non-natural or altered nucleotides. Suitable vectors include those designed for expression, such as plasmids and viruses.

[0321] In some embodiments, recombinant vectors contain regulatory sequences, such as transcriptional and translational start and stop codons, that are specific for the type of host cell into which the vector is to be introduced (eg, bacteria, fungi, plants, or animals, as appropriate).

[0322] In some embodiments, the recombinant vector optionally includes a gene carrier element (nucleic acid), such as a selectable marker region, a lactose operon, a CMV promoter, a CAG promoter, a tac promoter, a T7 RNA polymerase promoter, an SP6 RNA polymerase promoter, an SV40 promoter, an IRES sequence, a WPRE element, an ITR sequence, a FLAG tag coding region, a c-myc tag coding region, a polyHis tag coding region, an HA tag coding region, an MBP tag coding region, a GST tag coding region, a ployA coding region, an SV40 polyadenylation signal, an SV40 replication origin, a Col E1 replication origin, a loxP site, or a Cre recombinase coding region.

[0323] Regulatory sequences

[0324] In some embodiments of the present disclosure, the regulatory sequence comprises one or more pol III promoters (e.g., 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g., 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g., 1, 2, 3, 4, 5, or more pol I promoters), or a combination thereof.

[0325] In some embodiments of the present disclosure, the regulatory sequence comprises an HRE enhancer element (hypoxia response element). In some embodiments, the regulatory sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 HRE enhancer elements in series. In some embodiments, the regulatory sequence comprises 2, 3, 4, 5, 6, 7, 8, or 9 HRE enhancer elements in series.

[0326] In some embodiments of the present disclosure, the regulatory sequence comprises an NRS element (neuron restrictive silencer) from the human synapsin gene (human synapsin gene). In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element. In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element in series. To enhance the regulatory effect, the NRS element and the HRE enhancer element in series can be repeated multiple times. In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element in series that are repeated at least 2 times, at least 3 times, at least 4 times, at least 5 times or at least 6 times. In some embodiments, the regulatory sequence comprises an NRS element and an HRE enhancer element in series that are repeated 2 times, 3 times, 4 times, 5 times or 6 times.

[0327] In some embodiments of the present disclosure, the HRE enhancer element sequence is TGTCACGTCCTGCACGACGTA (SEQ ID NO: 233) or its reverse complementary sequence.

[0328] In some embodiments of the present disclosure, the NRS element sequence is TTCAGCACCGCGGACAGTGCC (SEQ ID NO: 234) or its reverse complement sequence.

[0329] In some embodiments of the present disclosure, the regulatory sequence comprises repeats of TGTCACGTCCTGCACGACGTA (SEQ ID NO: 233) or its reverse complement.

[0330] In some embodiments of the present disclosure, the regulatory sequence comprises a tandem sequence of TTCAGCACCGCGGACAGTGCCTGTCACGTCCTGCACGACGTA (SEQ ID NO: 235) or a reverse complement thereof.

[0331] promoter

[0332] In some embodiments of the present disclosure, the vector comprises a pol III promoter (e.g., U6 and H1 promoters), a pol II promoter (e.g., retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with RSV enhancer), cytomegalovirus (CMV) promoter (optionally with CMV enhancer), SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerol kinase (PGK) promoter, or EF1α promoter), or a pol III promoter and a pol II promoter.

[0333] In some embodiments of the present disclosure, the promoter is a constitutive promoter, which is continuously active and not regulated by external signals or molecules. Suitable constitutive promoters include, but are not limited to, CMV, RSV, SV40, EF1α, CAG, CBh, and β-actin promoters. In some embodiments, the promoter is an inducible promoter regulated by external signals or molecules (e.g., transcription factors).

[0334] In some embodiments of the present disclosure, the promoter is selected from the group consisting of: RPE65, VDM2, Mlc1, GFAP, and ICAM-2 promoters.

[0335] In some embodiments of the present disclosure, the promoter is a tissue-specific promoter, which can be used to drive tissue-specific expression of the guide RNA or gene editing system described in the present disclosure.

[0336] In some embodiments of the present disclosure, the promoter is an eye-specific promoter.

[0337] In some embodiments of the present disclosure, the eye-specific promoter is selected from the group consisting of: a retinoschisis protein promoter, a K12 promoter, a rhodopsin promoter, a rod-specific promoter, a cone-specific promoter, a rhodopsin kinase promoter, a GRK1 promoter, an interphotoreceptor retinoid-binding protein proximal (IRBP) promoter, and an opsin promoter (e.g., a red opsin promoter, a blue opsin promoter, etc.).

[0338] In some embodiments of the present disclosure, the promoter is a chicken β-actin (CB) promoter. The chicken β-actin promoter can be a short chicken β-actin promoter or a long chicken β-actin promoter. In some embodiments, the promoter (e.g., chicken β-actin promoter) comprises an enhancer sequence, such as a cytomegalovirus (CMV) enhancer sequence. The CMV enhancer sequence can be a short CMV enhancer sequence or a long CMV enhancer sequence. In some embodiments, the promoter comprises a long CMV enhancer sequence and a long chicken β-actin promoter. In some embodiments, the promoter comprises a short CMV enhancer sequence and a short chicken β-actin promoter. However, those skilled in the art will appreciate that a short CMV enhancer can be used together with a long CB promoter, and a long CMV enhancer can be used together with a short CB promoter. In some embodiments of the present disclosure, the promoter is a CBh promoter.

[0339] Suitable muscle-specific promoters include, but are not limited to, CK8, MHCK7, myoglobin promoter (Mb), desmin promoter, muscle creatine kinase promoter (MCK) and variants thereof, and SPc5-12 synthetic promoters. Suitable immune cell-specific promoters include, but are not limited to, B29 promoter (B cells), CD14 promoter (monocytes), CD43 promoter (leukocytes and platelets), CD68 (macrophages), and SV40 / CD43 promoter (leukocytes and platelets). Suitable blood cell-specific promoters include, but are not limited to, CD43 promoter (leukocytes and platelets), CD45 promoter (hematopoietic cells), INF-β (hematopoietic cells), WASP promoter (hematopoietic cells), SV40 / CD43 promoter (leukocytes and platelets), and SV40 / CD45 promoter (hematopoietic cells). Suitable pancreas-specific promoters include, but are not limited to, elastase-1 promoter. Suitable endothelial cell-specific promoters include, but are not limited to, Fit-1 promoter and ICAM-2 promoter. Suitable neuronal tissue / cell-specific promoters include, but are not limited to, the GFAP promoter (astroglial cells), the SYN1 promoter (neurons), and the NSE / RU5' promoter (mature neurons). Neuronal tissue / cell-specific promoters can be the GFAP promoter and the SYN1 promoter. Suitable kidney-specific promoters include, but are not limited to, the NphsI promoter (podocytes). Suitable bone-specific promoters include, but are not limited to, the OG-2 promoter (osteoblasts, odontoblasts). Suitable lung-specific promoters include, but are not limited to, the SP-B promoter (lungs). Suitable liver-specific promoters include, but are not limited to, the SV40 / Alb promoter. Suitable heart-specific promoters include, but are not limited to, α-MHC.

[0340] enhancer

[0341] In some embodiments of the present disclosure, the enhancer is selected from the group consisting of WPRE, CMV enhancer, SV40 enhancer, HRE enhancer element, and the intron sequence between exons 2 and 3 of rabbit β-globin.

[0342] In some embodiments of the present disclosure, the enhancer is located upstream of the promoter element; however, it can also be located downstream or within the coding sequence regulated by the promoter and maintain function. Therefore, the enhancer or a portion thereof can be present in the RNA sequence transcribed from the coding sequence.

[0343] In some embodiments of the present disclosure, the enhancer may be located within 100, 200, 300, 400, 500 or more base pairs upstream or downstream of the coding sequence regulated by the promoter.

[0344] In some embodiments of the disclosure, an enhancer increases expression of a coding sequence above that provided by a promoter.

[0345] Adeno-associated virus vector (AAV vector)

[0346] In some embodiments of the present disclosure, the AAV vector comprises a ssDNA genome comprising coding sequences for an RNA-guided nuclease and a guide RNA flanked by ITRs.

[0347] In some embodiments of the present disclosure, the guide RNA or gene editing system described herein is packaged in an AAV vector, for example, packaged into an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP.B, AAV PHP.B2, AAV PHP.B3, AAV PHP.A, AAV PHP.eB, AAV PHP.eS, AAV2.7m8, AAV8.7m8, AAV ShH10, AAVrh10, or AAVrh74 capsid.

[0348] In some embodiments of the present disclosure, the guide RNA or gene editing system described herein is packaged into an AAV2, AAV5, AAV6, AAV8, or AAV9 capsid.

[0349] In some embodiments of the present disclosure, the AAV vector described herein is optionally selected from: AAV2 / 2, AAV2 / 3, AAV2 / 4, AAV2 / 5, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2 / 10, AAV2 / 11, AAV2 / 12, AAV2 / 13, AAV2 / PHP.B, AAV2 / PHP.B2, AAV2 / PHP.B3, AAV2 / PHP.A, AAV2 / PHP.eB, AAV2 / PHP.eS, AAV2 / 2.7m8, AAV2 / 8.7m8, AAV2 / ShH10, AAV2 / rh10 and AAV2 / rh74.

[0350] In some embodiments of the present disclosure, the AAV vector described herein is selected from the group consisting of: AAV2 / 2, AAV2 / 5, AAV2 / 6, AAV2 / 8, and AAV2 / 9.

[0351] In some embodiments, the gene editing system described herein is packaged in an AAV vector comprising an engineered capsid with tissue tropism, such as an engineered ocular tissue-tropic capsid.

[0352] lipid nanoparticles

[0353] In some embodiments of the present disclosure, in addition to RNA payload (mRNA and guide RNA encoding the nuclease guided by RNA), lipid nanoparticles (LNPs) also include four components: cations or ionizable lipids, cholesterol, helper lipids, and PEG-lipids. In some embodiments, the cations or ionizable lipids include cKK-E12, C12-200, ALC-0315, DLin-MC3-DMA, DLin-KC2-DMA, FTT5, Moderna SM-102, and Intellia LP01. In some embodiments, the PEG-lipid includes PEG-2000-C-DMG, PEG-2000-DMG, or ALC-0159. In some embodiments, the helper lipid includes DSPC.

[0354] Lentiviral vectors

[0355] In some embodiments of the present disclosure, the lentiviral vector is pseudotyped with a homologous or heterologous envelope protein, such as VSV-G. In some embodiments, the mRNA encoding the RNA-guided nuclease is linked to an aptamer sequence.

[0356] Aptamer / aptamer sequence

[0357] In some embodiments, the guide polynucleotide further comprises an aptamer sequence. In some embodiments, the aptamer sequence is inserted into a loop of the guide polynucleotide. In some embodiments, the aptamer sequence is attached to the end of the guide polynucleotide.

[0358] In some embodiments, the aptamer sequence comprises an MS2 aptamer sequence, a PP7 aptamer sequence, or a Qβ aptamer sequence.

[0359] Adaptor protein

[0360] In some embodiments, the gene editing system further comprises a fusion protein comprising an adaptor protein and a fusion domain, or a nucleic acid encoding the fusion protein, wherein the adaptor protein is capable of binding to an aptamer sequence.

[0361] In some embodiments, the linker protein comprises an MS2 phage coat protein (MCP), a PP7 phage coat protein (PCP), or a Qβ phage coat protein (QCP). In some embodiments, the fusion domain comprises a cytosine deaminase domain, an adenosine deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, or an affinity or reporter tag or domain.

[0362] RNP complex (ribonucleoprotein complex)

[0363] In some embodiments of the present disclosure, the RNP complex (ribonucleoprotein complex) can be delivered to eukaryotic cells, mammalian cells or human cells by microinjection or electroporation. In some embodiments, the ribonucleoprotein complex can be packaged in virus-like particles and delivered to mammals or human subjects in vivo.

[0364] virus-like particles

[0365] In some embodiments of the present disclosure, engineered virus-like particles (VLPs) are pseudotyped with homologous or heterologous envelope proteins such as VSV-G. In some embodiments, the RNA-guided nuclease is fused to a gag protein (e.g., MLVgag) via a cleavable linker, wherein the cleavage of the linker in the target cell exposes an NLS between the linker and the RNA-guided nuclease. In some embodiments, the fusion protein comprises (e.g., from 5' to 3') a gag protein (e.g., MLVgag), one or more NESs, a cleavable linker, one or more NLSs, and an RNA-guided nuclease. In some embodiments, the RNA-guided nuclease is fused to a first dimerization domain capable of dimerizing or heterodimerizing with a second dimerization domain fused to a membrane protein, wherein the presence of a ligand promotes the dimerization and enriches the RNA-guided nuclease or fusion protein into the VLP.

[0366] eukaryotic cells

[0367] In some embodiments of the present disclosure, the eukaryotic cell is a mammalian cell or a human cell. In some embodiments, the eukaryotic cell is a primary eukaryotic cell, a stem cell, a tumor / cancer cell, a circulating tumor cell (CTC), a blood cell (for example, a T cell, a B cell, a NK cell, a Tregs cell, etc.), a hematopoietic stem cell, a specialized immune cell (such as a tumor infiltrating lymphocyte or a tumor suppressor lymphocyte), a stromal cell (such as a cancer-associated fibroblast, etc.) in a tumor microenvironment. In some embodiments, the cell is a brain or neuronal cell (for example, a neuron, astrocyte, microglia, retinal ganglion cell, a rod / cone cell, etc.) of a central or peripheral nervous system.

[0368] Diseases or conditions associated with target RNA

[0369] In some embodiments of the present disclosure, the disease or condition associated with the target RNA refers to a disease or condition caused by abnormal expression of the target RNA. In some embodiments of the present disclosure, the disease or condition associated with the target RNA refers to a disease or condition caused by abnormally high expression of the target RNA. In some embodiments of the present disclosure, the disease or condition associated with the target RNA refers to a disease or condition caused by abnormally low expression of the target RNA.

[0370] In some embodiments of the present disclosure, the disease or disorder associated with the target RNA includes but is not limited to age-related macular degeneration.

[0371] In some embodiments of the present disclosure, the disease or condition associated with the target RNA includes but is not limited to dry age-related macular degeneration. In some embodiments of the present disclosure, the disease or condition associated with the target RNA includes but is not limited to wet age-related macular degeneration.

[0372] In some embodiments of the present disclosure, the target RNA is VEGFA RNA.

[0373] In some embodiments of the present disclosure, the target RNA is mammalian VEGFA RNA.

[0374] In some embodiments of the present disclosure, the target RNA is VEGFA RNA of a non-human primate.

[0375] In some embodiments of the present disclosure, the target RNA is human VEGFA RNA.

[0376] In some embodiments, the pharmaceutical composition is delivered to a human subject in vivo. The pharmaceutical composition can be delivered by any effective route, and a therapeutically effective amount of the pharmaceutical composition can be delivered to a subject in need thereof. Exemplary routes of administration include, but are not limited to, intravenous infusion, intravenous injection, intraperitoneal injection, intramuscular injection, intratumoral injection, subcutaneous injection, intradermal injection, intraventricular injection, intravascular injection, intracerebellar injection, intraocular injection, subretinal injection, intravitreal injection, intracameral injection, intratympanic injection, intranasal administration, and inhalation.

[0377] In some embodiments of the present disclosure, using the delivery method of the present disclosure to deliver a therapeutically effective amount of the gene editing system or pharmaceutical composition described herein to a subject in need thereof can inhibit the expression or activity of VEGFA RNA or its encoded protein in ocular tissue cells and reduce the formation of new blood vessels, thereby diagnosing, preventing and / or treating macular degeneration diseases, such as neovascular age-related macular degeneration.

[0378] The present disclosure is further illustrated below by way of specific examples, but the present disclosure is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.

[0379] Example

[0380] Example 1: CRISPR gene editing method downregulates VEGFA gene transcription level

[0381] The restriction endonucleases used in this example were purchased from New England Biolabs. A small-scale plasmid DNA extraction kit and 2× Accurate Taq Master Mix, as well as a genomic DNA extraction kit, were purchased from Accurate Biotech. OPTI-MEM, T4 DNA ligase, and Lipofectamine 2000 transfection reagent were purchased from Thermo Fisher Scientific. gRNA, PCR, and sequencing primers were synthesized using conventional methods.

[0382] 1. Cas13 protein source and plasmid acquisition

[0383] This example involves a variety of Cas13 proteins to verify the effect of targeting VEGFA, including Cas13m.3 (not belonging to the Cas13d subtype), Cas13m.6 (not belonging to the Cas13d subtype), and C13-2 (also known as CasRfg.4, belonging to the Cas13d subtype) recently discovered by the applicant. These three Cas13 proteins have amino acid sequences of Cas13m.3 (SEQ ID NO: 1), Cas13m.6 (SEQ ID NO: 2), and C13-2 (SEQ ID NO: 3), respectively.

[0384] Cas13m.3-BsaI plasmid (sequence as shown in SEQ ID NO: 4), Cas13m.6-BsaI plasmid (sequence as shown in SEQ ID NO: 5), and C13-2-BsaI plasmid (sequence as shown in SEQ ID NO: 6) were prepared at an experimental outsourcing service company. They contain the coding sequence of different Cas13 proteins optimized by codons (CMV drives expression) and the coding sequence of the direct repeat (direct epeat) sequence (U6 drives expression).

[0385] 2. Construction of recombinant plasmid

[0386] 1. gRNA design

[0387] First, the gRNA guide sequence is determined, which targets the RNA sequence (target RNA) transcribed from the VEGFA gene. The guide sequence of the gRNA is the reverse complementary sequence of the target sequence on the target RNA molecule, and the gRNA with a guide sequence length of 21-29 nt is designed, as shown in Table 1 below, and Cas13m.3-BsaI (also known as Cas13m.3-V), Cas13m.6-BsaI (also known as Cas13m.6-V), and C13-2-BsaI (also known as C13-2-V) vectors are used as negative controls (Cas13m.3-BsaI and Cas13m.6-BsaI vectors contain gRNA coding sequences, and their guide sequences are ggagaccacggcaggtctca (SEQ ID NO: 7), which are theoretically disordered sequences and will not target the mammalian genome; the C13-2-BsaI vector contains gRNA coding sequences, and its guide sequence is ggagaccacggcaggtctca (SEQ ID NO: 7), which theoretically will not target the mammalian genome).

[0388] Table 1. Guide sequences of gRNA

[0389] 2. Construction of plasmid

[0390] All gRNA recombinant plasmids were annealed with gRNA forward and reverse primers, and the Cas13m.3-BsaI, Cas13m.6-BsaI, and C13-2-BsaⅠ plasmids were digested with BsaⅠ. Then, the positive and antisense strands of the DNA sequences corresponding to the gRNA guide sequences were annealed and ligated into the Cas13m.3-BsaI, Cas13m.6-BsaI, and C13-2-BsaⅠ vectors respectively using T4 ligase. The direct repeat sequences of the gRNAs encoded by the Cas13m.3, Cas13m.6, and C13-2 vectors are as follows:

[0391] 5'-GTTGTAGAAGCCGTTCATTCGGGACGGTATGACAAC-3' (SEQ ID NO: 19),

[0392] 5'-GTTGTAGAAGCCTATCGTTAGGATAGGTATGACAAC-3' (SEQ ID NO: 20),

[0393] 5'-GGAAGATAACTCTACAAACCTGTAGGGTTCTGAGAC-3' (SEQ ID NO: 21).

[0394] The sense and antisense DNA sequences corresponding to the gRNA guide sequence were synthesized using conventional methods. For Cas13m.3-BsaI and Cas13m.6-BsaI vectors, cacc was added to the 5'-end of the sense strand (if the 5' end of the guide sequence is not g, caccg was added), and caac was added to the 5'-end of the antisense strand (if the 5' end of the guide sequence is not g, cac was added to the 3'-end of the antisense strand). For C13-2-BsaⅠ vectors, agac was added to the 5'-end of the sense strand, and aaaa was added to the 5'-end of the antisense strand.

[0395] According to the following reaction system, 2 μl of the sense and antisense strands of the DNA sequence corresponding to the gRNA target sequence were mixed, 2 μl of NEB 10x cuttersmart buffer and 14 μl of H2O were added, and the mixture was incubated at 95°C in a PCR instrument for 5 minutes. Then, the mixture was immediately removed and incubated on ice for 5 minutes to anneal and form double-stranded DNA with sticky ends.

[0396] According to the reaction system in Table 2, the digested plasmid and annealing primer were added in sequence, and the DNA Ligation Kit Ver.2.1 (TAKARA, 6022Q) was incubated in a PCR instrument at 16 ° C for 1 hour to complete the connection between the annealing product and the linearized backbone to obtain Cas13m.3, Cas13m.6, and C13-2 plasmids targeting VEGFA RNA (Cas13m.3-gRNA-n, Cas13m.6-gRNA-n, C13-2-gRNA-n, n is numbered and corresponds to different guide sequences), which can express Cas13 protein and gRNA targeting VEGFA RNA (including a specific guide sequence and a direct repeat sequence corresponding to the Cas13 protein).

[0397] Table 2 Reaction system

[0398] 3. Plasmid transformation

[0399] In a cleanroom, quickly add all T4 ligation reaction products to one tube (50 μl) of E. coli Stbl3 competent cells, then incubate on ice for 30 minutes. Heat shock the competent cells in a 42°C water bath for 90 seconds, then return them to ice and incubate for 2 minutes. In a cleanroom, add 400 μl of antibiotic-free LB medium, then place the culture in a bacterial shaker at 37°C, 200 rpm, and incubate for 45 minutes. During the recovery period, open the biochemical incubator and place an LB agar plate containing an appropriate amount of ampicillin to dry. Centrifuge the culture at 12,000 rpm for 1 minute at room temperature, remove most of the supernatant, and retain approximately 50 μl to thoroughly resuspend the pellet. Pipette the culture solution onto the edge of the LB agar plate containing ampicillin and streak the plate with a pipette tip. Then, invert the plate and place it in the biochemical incubator and continue incubating for 16 hours.

[0400] 4. Identification of positive clones

[0401] In a clean bench, use a 1-10 μL pipette tip to pick seven individual clones and transfer them to 50 μL of LB medium containing ampicillin. Pipet and swirl several times to mix the cells and LB medium. Pipette 2 μL of the bacterial solution and add it to the colony PCR reaction solution. Mix thoroughly, then centrifuge briefly to allow the liquid to accumulate at the bottom of the tube. PCR reaction is then performed. The remaining bacterial solution is placed in a biochemical incubator for further incubation. After PCR amplification, agarose gel electrophoresis is performed. Clones with a single, uniform electrophoresis band of the correct size and normal brightness are considered positive clones. 10 μL of the bacterial solution is sent for Sanger sequencing. The remaining bacterial solution is used for plasmid extraction according to the instructions of the Accurate Plasmid Extraction Kit (Accurate Biotech, AG21001). Finally, elution is performed with 50 μL of Elution Buffer. The plasmid DNA concentration is determined according to the Nanodrop double-stranded DNA assay protocol. One positive clone for each plasmid is selected and 5-10 μL is provided for Sanger sequencing to screen for plasmids that have been sequenced correctly.

[0402] 3. Testing Editing Efficiency

[0403] 1. Detection of editing efficiency at the mRNA level

[0404] HEK293T cells were transfected strictly according to the Lipofectamine 2000 reagent (Thermo Fisher 11668019) from Life Tech. One day before transfection, 293T cells in good condition were plated at 1×10 5 / well inoculated into a 24-well plate. On the day of transfection, 500 ng of the recombinant Cas13 targeting VEGFA RNA plasmid of the corresponding volume was taken and added to 50 μl OPTI-MEM (Thermo, 2120588). At the same time, 1 μl Lipofactamine 2000 was taken and added to 50 μl OPTI-MEM culture medium. After mixing, let it stand at room temperature for 5 minutes. After that, the diluted plasmid DNA was mixed with Lipofactamine 2000 and let it stand at room temperature for 15 minutes. Then, 100 μl of plasmid DNA complex was added to each well of the 24-well plate, and the culture plate was gently shaken to mix (the negative control group was transfected with Cas13m.3-BsaI, Cas13m.6-BsaI, and C13-2-BsaI plasmids). Place at 37 ° C and culture for 72 hours.

[0405] Cells were harvested 72 hours after transfection, and total RNA was extracted using the Accurate SteadyPure Universal RNA Extraction Kit (AG21017). mRNA concentration was measured using a Nanodrop. mRNA products were reverse transcribed using the Evo M-MLV Mix Kit with gDNA Clean for qPCR (AG11728) and detected using the SYBR Green Premix Pro Taq HS qPCR Kit (Low Rox Plus) (AG11720).

[0406] The primers used for qPCR are shown in Table 3 below, where gVegfa-F1 / Vegfa-R1 is used to detect the editing efficiency of gRNA-5, and qVegfa-F2 / qVegfa-R2 is used to test the editing efficiency of all other gRNAs, including gRNA-4 and gRNA-7.

[0407] Table 3 qPCR primer sequences

[0408] The reaction system was prepared according to the instructions of SYBR Green Premix Pro Taq HS qPCR Kit (Low Rox Plus) AG11720 and the quantification was performed using QuantStudio TM 5 Real-Time PCR System, 96-well was used for detection.

[0409] 2. Calculation method

[0410] This experiment used the relative quantification method, 2 -△△CtThe change of target RNA was calculated by the following method: ΔCt = Ct(Vegfa) - Ct(GAPDH);

[0411] △△Ct=△Ct(to be verified group)-△Ct(each negative control group); 2 -△△Ct =2^(-△△Ct).

[0412] The experiment in this example was repeated three times independently. The relative expression of Vegfa RNA was calculated according to the above calculation method. The result data was the average of the three tests, as shown in Table 4 and Figure 1 below.

[0413] Table 4 Editing efficiency of different Cas13 and gRNA combinations

[0414] Note: “**” indicates p < 0.01 compared with the corresponding negative control group, and “*” indicates p < 0.05 compared with the corresponding negative control group.

[0415] As can be seen from the table above, gRNAs 2 to 10 designed by the inventors can edit VEGFA RNA. Compared with gRNA-1, gRNAs 2 to 10 have improved editing efficiency. Among them, gRNAs 4, 5, 6, and 7 have the highest editing efficiency, followed by gRNAs 9 and 10.

[0416] Example 2: Gene editing using different combinations of Cas13 proteins and gRNA-5

[0417] Construction of overexpression vector

[0418] Plasmids Cas13m.3-gRNA-5, Cas13m.6-gRNA-5, and C13-2-gRNA-5 targeting VEGFA RNA were constructed using the method of Example 1, which can express Cas13 protein and gRNA-5 targeting VEGFA RNA (comprising the guide sequence shown in SEQ ID NO: 13, and the direct repeat sequence corresponding to the Cas13 protein). The Cas13m.3-BsaI, Cas13m.6-BsaI, and C13-2-BsaI vectors of Example 1 were used as negative controls.

[0419] Prior art (CN112143701A, CN112430597A) reports CasRx + gRNA combinations targeting VEGFA RNA (gRNAs containing different guide sequences or their tandem combinations: X-1, X-2, X-dual [i.e., X-1 + X-2], RJ-2, RJ-5, RJ-8, RJ-5 + RJ-8 [i.e., RJ-5 + 8]). The guide sequences are shown in Table 5.

[0420] We ordered CasRx and its corresponding gRNA plasmids (purchased from Miaoling, pXR001: EF1a-CasRx-2A-EGFP and pXR004: CasRx pre-gRNA cloning backbone), and transformed them into pAAV-CasRx-gRNA plasmid (also known as CasRx-V, SEQ ID NO: 28). Then, as in Example 1, the annealed products of the forward and reverse primers corresponding to the guide sequences of the above-mentioned prior art control gRNA and the gRNA-5 disclosed herein (primers with restriction sites, i.e., adding AAAC to the 5' end of the sequence in Table 5 below to become the forward primer, and adding cttg to the 5' end of the reverse complementary sequence of the sequence in Table 5 to become the reverse primer) were ligated into the BpiI restriction enzyme backbone of the pAAV-CasRx-gRNA plasmid. After transformation into competent Escherichia coli, the cells were cultured in a medium containing the corresponding antibiotics, colony PCR reaction was performed, positive clones were screened by electrophoresis, plasmids were extracted, and Sanger sequencing was performed to obtain CasRx targeting VEGFA. RNA plasmid, which can be used to express CasRx and gRNA (such as X-1gRNA and / or X-2gRNA).

[0421] Table 5. gRNA related sequences

[0422] The plasmid was transfected into HEK293T cells using the same method as in Example 1. The negative control group was transfected with the CasRx-V plasmid.

[0423] Total RNA was extracted 72 h after transfection and reverse transcribed into cDNA, and the editing efficiency at the mRNA level was detected by qPCR technology. The method was the same as in Example 1, and the primers involved were shown in Table 6 below. The experiment in this example was repeated three times independently, and the test results are shown in Figure 2 and Tables 7 to 8 below. The result data are the average of the three tests. It can be seen that the editing efficiency of the combination of different Cas13 proteins and gRNA-5 is higher than that of the control group CasRx-X-dual (dual gRNA).

[0424] Table 6 qPCR primer sequences

[0425] Table 7 Editing efficiency of different tools combined with gRNA-5

[0426] Note: "**" indicates p < 0.01 compared with the corresponding negative control group.

[0427] Table 8 Difference test P value (t test) between different Cas13 and gRNA combinations in this example

[0428] Example 3: Gene editing using different combinations of Cas13 proteins and gRNA-4, gRNA-6, and gRNA-7

[0429] The plasmids of the combination of gRNA-4, gRNA-6 and gRNA-7 with different Cas13 proteins Cas13m.6 and C13-2 were prepared using the method of Example 1 (which can express Cas13 and gRNA [containing a specific guide sequence, and the same repeat sequence corresponding to the Cas13 protein]). The CasRx-V plasmid and CasRx-X-2 plasmid (which can be used to express CasRx and X-2gRNA) were prepared using the method of Example 2. Plasmids were transfected into 293T cells, and the total RNA of the cells was extracted after 72 hours of transfection, reverse transcribed into cDNA, and the qPCR detection method was the same as that in Example 1. The primer sequences used in this example are shown in Table 9, and the experimental biology was independently repeated 3 times. The test results are shown in Figure 3 and Tables 10 to 11, and the result data are the average of 3 tests. The combination of gRNA-4 and gRNA-7 with different Cas13 proteins can significantly reduce the level of VEGFA RNA, and the editing efficiency is significantly better than that of the control CasRx-X-2.

[0430] Table 9 Primer sequences

[0431] Table 10 Editing efficiency of different tool combinations

[0432] Note: “**” indicates p < 0.01 compared with the corresponding negative control group, and “*” indicates p < 0.05 compared with the corresponding negative control group.

[0433] Table 11. P values ​​for the difference test between different Cas13 and gRNA combinations in this example (t test)

[0434] Example 4: Comparison of editing efficiency at the RNA and protein levels with existing technologies

[0435] The Cas13-gRNA plasmid designed by the inventor was transfected in the same batch as the CasRx-gRNA plasmid of the prior art to compare the editing efficiency. The plasmid used in this embodiment (for expressing Cas13 protein and gRNA [single or paired gRNA]) was prepared using the method of Example 1 and Example 2. Plasmid transfection of 293T cells, extraction of total RNA of cells after 72 hours of transfection, and reverse transcription to obtain cDNA and qPCR detection methods were the same as those in Example 1, and primers are shown in Table 12. The test results of biological independent repetitions 3 times are shown in Figures 4A-4B and Tables 13 to 16, and the result data are the average of 3 tests. The primers used in Table 13 and Figure 4A are qGAPDHF1 / qGAPDHR1, qVegfa-F1 / qVegfa-R1, and the P values ​​of the inter-group difference test are shown in Table 14; the primers used in Table 15 and Figure 4B are qGAPDHF1 / qGAPDHR1, qVegfa-F2 / qVegfa-R2, and the P values ​​of the inter-group difference test are shown in Table 16. The prior art CasRx and double gRNA combination has a higher editing efficiency than the CasRx and single gRNA combination. The combination of C13-2 with gRNA-4, gRNA-5, and gRNA-7 significantly improves the editing efficiency of VEGFA RNA levels compared to the prior art CasRx and single gRNA combination and CasRx and double gRNA combination.

[0436] While collecting cell pellets to extract total RNA, we collected cell supernatants for ELISA detection of changes in the level of natural VEGFA protein. Using Elascience's Human VEGF-A (Vascular Endothelial Cell Growth Factor A) ELISA Kit, strictly follow the kit operating procedures, set different concentrations of standards and process samples, and read the final data using a microplate reader (Thermo Fisher's MultiskanFC) at 450nm. The formula corresponding to the sample concentration and OD value was calculated based on the OD value of the standard. Repeat the experiment twice. The results are shown in Table 17 and Figure 4C. Compared with the prior art (such as CasRx-RJ-5, CasRx-RJ-8, CasRx-RJ-5+8), the downregulation level of VEGFA protein after C13-2 was edited in combination with gRNA-4, gRNA-5, and gRNA-7 was significantly increased.

[0437] Table 12 Primer sequences

[0438] Table 13. Comparison of editing efficiency at the RNA level (Figure 4A)

[0439] Note: “**” indicates p < 0.01 compared with the corresponding negative control group, and “*” indicates p < 0.05 compared with the corresponding negative control group.

[0440] Table 14. P values ​​for mRNA level differences between different Cas13 and gRNA combinations (t test)

[0441] Table 15 Comparison of editing efficiency at the RNA level (Figure 4B)

[0442] Note: “**” indicates p < 0.01 compared with the corresponding negative control group, and “*” indicates p < 0.05 compared with the corresponding negative control group.

[0443] Table 16. P values ​​for mRNA level differences between different Cas13 and gRNA combinations (t test)

[0444] Table 17 Comparison of knockdown efficiency at the protein level (Figure 4C)

[0445] Note: The VEGFA protein levels in the negative control groups C13-2-V and CasRx-V were set at 100%. Data in other groups were calculated based on their respective negative controls. "**" indicates p < 0.01 compared to the corresponding negative control group.

[0446] Example 5: Editing in mice using AAV vectors

[0447] The C13-2-gRNA-4 plasmid constructed in Example 1 was used to outsource the packaging of AAV8WT virus (for expressing C13-2 and gRNA-4). The three plasmids were transfected into 293T cells to produce AAV, and AAV was obtained by gradient centrifugation purification. Mice were anesthetized by intraperitoneal injection of 2.5% tribromoethanol (100μl-200μl / 10g), and the eyes were instilled with the compound tropicamide eye drops of Meiliduo to dilate the pupils. After the pupils of the mice were dilated, Alcon's pramipaine hydrochloride eye drops were instilled for local anesthesia. After 1 minute of anesthesia, the eye drops were wiped off, and Yishukang's medical sodium hyaluronate gel was evenly applied to the eyes of the mice. Under an ophthalmic microscope, a hole was first made in the sclera near the edge of the cornea with a 30G sharp needle, followed by a WPI connected to a 35G flat needle and still containing drugs. A 10 μl injection system (Nanofil-10 μl) was used to inject AAV8-C13-2-gRNA-4 into the mouse eye through the subretinal space (the negative control group was injected with WT serotype virus AAV8-C13-2-V, which was packaged by the aforementioned C13-2-BsaI plasmid and can express C13-2 and gRNA that does not target the mammalian genome). Finally, tobramycin dexamethasone eye ointment was applied to the eye and kept warm at 37 ° C. After the mouse woke up, it was returned to the mouse cage for further observation. Four weeks after the injection, the mouse was killed by dislocation of the neck, the mouse eyeball was peeled off, and the retina was quickly and gently separated. The retina was immediately immersed in Trizol and the total RNA extraction steps of Trizol (Thermo Fisher) were strictly followed to complete RNA extraction. The cDNA was obtained by reverse transcription using the same method as in Example 1. The expression changes and editing efficiency of VEGFA in the mouse were detected by qPCR using mouse VEGFA-specific primers. The results are shown in Figure 5 and Table 19 below. Four weeks after AAV8-C13-2-gRNA-4 injection, VEGFA transcription levels were significantly downregulated, with an editing efficiency as high as 84.5%. The primers required for qPCR are shown in Table 18 below.

[0448] Table 18 qPCR primers

[0449] Table 19 C13-2-gRNA4 editing efficiency in mice

[0450] Example 6: Off-target detection

[0451] A total of 7 plasmids, including C13-2-V, C13-2-gRNA-4, C13-2-gRNA-5, C13-2-gRNA-6, C13-2-gRNA-7, CasRx-V, and CasRx-X-dual, were constructed according to the methods of Examples 1 and 2, and 293T cells were transfected separately, with each plasmid transfected into 3 replicate wells.

[0452] 72 hours after transfection, total RNA was extracted from cells and sent to a sequencing company. 1 μg of RNA was used for ribosomal RNA removal from all samples. cDNA was synthesized by reverse transcription and random fragmentation, followed by end-repair and A-tailing. The library was amplified by PCR and quality-controlled before sequencing on the BGI DNBSEQ platform with a read length of PE150. After quality control filtering, the data were aligned to the human reference genome using STAR software. StringTie2 was used to quantify gene expression, and DESeq2 software was used for differential significance analysis (relative to the respective negative control groups). Significant differences were identified as differentially expressed genes (DEGs) when padj (corrected P value) ≤ 0.05 and expression fold ratio ≥ 2 (log2 (foldchange) > 1).

[0453] The number of differentially expressed genes (DEGs) in each group of samples is shown in Table 20 below. The number of differentially expressed genes in each C13-2 experimental group was significantly less than that in the CasRx-X-dual group. Compared with the CasRx-X-dual group, the combined editing of C13-2 and each gRNA in the table caused less perturbation to the transcriptome, and therefore was safer.

[0454] Table 20 Differentially expressed genes

[0455] Next, we intersected the differentially expressed genes with the predicted target gene set.

[0456] Off-target prediction method: The EMBOSS-water program was used to predict the whole genome and full cDNA sequence of the target species (Homo sapiens). The parameters gap_open = 10.0 and gap_extend = 0.5 were set. The forward and reverse strands of the gRNA guide sequence were used for alignment. The genes corresponding to the transcripts with a minimum matching base of no less than 18 and a mismatch + gap of no more than 6 bases after alignment were taken as the predicted target genes.

[0457] As can be seen from the number of intersections in Table 21 below, compared with CasRx-X-dual, the number of off-target genes in the combination of C13-2 and each gRNA in the table is significantly reduced, so the off-target safety is higher.

[0458] Table 21 Predicted target genes and their intersection with differentially expressed genes

[0459] Note: * indicates that the target gene VEGFA has been deleted.

[0460] It can be seen from the above examples that gRNA-4, gRNA-5 and gRNA-7 are superior to the existing technology in terms of editing efficiency and off-target safety, thus achieving unexpected technical effects.

[0461] Example 7: Editing efficiency of some gRNAs at the RNA and protein levels

[0462] The sense and antisense strands of the DNA sequences corresponding to the guide sequences of gRNA-11 to gRNA-45 were synthesized using the method of Example 1 (the sense strand was agac added to the 5'-end of the guide sequence, and the antisense strand was aaaa added to the 5'-end of the reverse complementary sequence of the guide sequence). The annealed products were ligated with the linearized products of the C13-2-BsaI plasmid by T4 ligase; after plasmid transformation and positive clone identification, C13-2 and plasmid vectors targeting VEGFA of each gRNA were obtained; the plasmids were transfected into HEK293T cells, and total RNA was extracted 72 h after transfection and reverse transcribed into cDNA, and the editing efficiency was detected by qPCR.

[0463] The primers used for qPCR are shown in Table 22 below, where qVegfa-F1 / qVegfa-R1 is used to detect the editing efficiency of gRNA-5, 17, 20, 21, 22, and 23; qVegfa-F2 / qVegfa-R2 is used to test the editing efficiency of gRNA-25, 26, 27, 28, 29, 30, 31, and 32.

[0464] Table 22. qPCR primer sequences

[0465] Using relative quantification method 2 -△△Ct The changes in target RNA were calculated using the method, and the biological experiments were repeated three times independently. The results were averaged over the three tests, as shown in Table 23 and Figure 6.

[0466] Table 23. Editing efficiency of different gRNAs

[0467] After 72 hours of transfection of the above-mentioned plasmid into the cells, the cell pellet was used for RNA extraction and qPCR detection of RNA levels, and the cell supernatant was used to detect changes in protein levels. It was observed that the cell growth was relatively uniform and the cell density was relatively consistent. Then, equal volumes of cell culture fluid were collected, centrifuged at 4°C 14000rpm for 15mins to remove dead cells and cell debris, and finally equal volumes of cell supernatant were taken for Elisa detection. Strictly follow the steps of the Elabscience, Human VEGFA ELISA kit (E-EL-H0111c) kit, and two replicates were set for each sample. Different concentrations of standard substances and processed samples were set, and the final data were read at 450nm using an enzyme marker (MultiskanFC of Thermo Fisher). A standard curve was made according to the concentration and OD value of the standard substance, and the concentration of the corresponding OD value of each sample was calculated according to the corresponding formula. The test results are shown in Table 24 and Figure 7 below. As can be seen from Table 24, compared with the negative control C13-2-V group, the VEGFA protein level was significantly downregulated after gRNA-30 editing. The VEGFA protein level after gRNA-5, 11, 12, 14, 18, 24, 26, 27, 28, and 29 editing was also significantly downregulated, consistent with the downward trend of RNA levels. The VEGFA protein level after editing in the gRNA-30 group was significantly lower than that in the other groups (P < 0.01). The VEGFA protein level after editing in the gRNA-18 group was significantly lower than that in the gRNA-5 group (P < 0.01). Therefore, an unexpected technical effect was achieved.

[0468] Table 24. Protein downregulation after editing with different gRNAs

[0469] Example 8: Targeting the region near the VEGFA RNA splicing site

[0470] The vector was constructed using the method of Example 1 and edited in HEK293T cells. The results are shown in Figures 8 and Table 25.

[0471] As shown in the figure, gRNA-30 still has the highest editing efficiency; the editing efficiency of gRNA-35, gRNA-36 and gRNA-44 targeting the splicing sites is relatively high, and the editing efficiency of other gRNAs is low.

[0472] Table 25. RNA downregulation after editing with different gRNAs

[0473] Example 9: Targeted editing of adjacent regions of the gRNA-30 target sequence

[0474] We selected multiple gRNAs whose target sequences were adjacent to gRNA-30 to test the editing efficiency.

[0475] Using the method of Example 1, the sense and antisense DNA sequences corresponding to the guide sequences of gRNA-185 to gRNA-196 were synthesized. The annealed products were ligated with the linearized C13-2-BsaI vector using T4 ligase. After plasmid transformation and identification of positive clones, plasmid vectors expressing C13-2 and each gRNA were obtained. The plasmids were transfected into HEK293T cells. 72 hours after transfection, total RNA was extracted and reverse transcribed into cDNA. Editing efficiency was measured by qPCR.

[0476] The following primers were used:

[0477] qGAPDHF1: TCCAAATCAAGTGGGGCGA (SEQ ID NO: 231)

[0478] qGAPDHR1:TGATGACCCTTTTGGCTCCC (SEQ ID NO:232)

[0479] qVEGFA-F2:CAATGACGAGGGCCTGGAGT (SEQ ID NO: 26)

[0480] qVEGFA-R2:TCTTTGGTCTGCATTCACAT(SEQ ID NO:27)

[0481] The results are shown in Figures 9A, 9B, and Table 26. The editing efficiency of gRNA-30 targeting the VEGFA exon 4 region was the highest, and its editing efficiency was significantly higher than that of all experimental groups from gRNA-185 to gRNA-196 (P<0.01). Although the editing efficiency of gRNA-187, which is only one base different from gRNA-187, is also high, it is significantly lower than that of gRNA-30 (P<0.01); the editing efficiency of gRNA-186, which is only one base different from gRNA-187, is even only 12%; although the editing efficiency of gRNA-190, gRNA-191, and gRNA-194 is higher than 70%, it is also significantly lower than that of gRNA-30 (P<0.01). Therefore, gRNA-30 achieved unexpected technical effects.

[0482] Table 26. Editing efficiency of gRNA-30 and nearby gRNAs

[0483] Example 10: Reducing intron enrichment

[0484] Whether the CRISPR-Cas13 system targeting the VEGFA RNA exon region generates new transcripts, thereby affecting the safety of in vivo treatment, is a question that warrants further investigation. Therefore, we transfected HEK293T cells with plasmids expressing the CRISPR-Cas13 system (Cas13 and gRNA) and performed RNA-seq to analyze transcriptome-wide changes.

[0485] Plasmids were constructed and transfected into HEK293T cells using the same methods as in Examples 1 and 2. Total RNA was extracted and a gene sequencing company was commissioned to construct an RNA-seq library using a ribosomal RNA-depleted method. Sequencing was performed on a BGI DNBSEQ-T7 sequencer and analyzed using STAR and Kallisto. The RNA-seq data were mapped to the human reference genome using software, and the genome-wide read distribution of the target VEGFA was analyzed using IGV software.

[0486] As shown in Figure 10, after editing with the C13-2-gRNA-5 and CasRx-X-dual groups, a large number of reads were enriched in introns, and long sequences (containing multiple exon and intron sequences) suspected of being novel transcripts were obtained by splicing. Although these intron reads did not generate new transcripts that could encode functional proteins, they may regulate growth and development in vivo in the form of long non-coding RNAs, posing certain safety risks.

[0487] It is speculated that because gRNA-5 has a 21-nt continuous nucleotide sequence complementary to the VEGFA pre-mRNA, the C13-2-gRNA-5 complex can still bind to the pre-mRNA, subsequently triggering a new splicing pattern of the pre-mRNA and leading to intron enrichment. To address this issue, we designed multiple gRNAs near gRNA-5, with their guide sequences evenly distributed across two exon sequences, hoping to reduce binding of the C13-2-gRNA complex to the pre-mRNA. These gRNAs were then generated, along with gRNA-5-2, gRNA-5-3, gRNA-5-5, and gRNA-5-4 as a control. This is shown in Figure 11. The designed gRNAs were combined with C13-2 for editing. The RNA-seq results, shown in Figure 12, show that gRNA-5-2, gRNA-5-3, and gRNA-5-5 did not induce enrichment of reads in introns. Furthermore, gRNA-29 and gRNA-30 did not induce enrichment of reads in introns. gRNA-5-4 caused intron enrichment. The degree of intron enrichment caused by gRNA-18 was lower. These results revealed that gRNA-30, gRNA-29, gRNA-5-2, gRNA-5-3, and gRNA-5-5 were safer than gRNA-5. The safety of the combination of gRNA-30, gRNA-29, gRNA-5-2, gRNA-5-3, and gRNA-5-5 with C13-2 was superior to the existing CasRx-X-dual. Therefore, gRNA-30, gRNA-29, gRNA-5-2, gRNA-5-3, gRNA-5-5, and gRNA-18 achieved unexpected technical effects.

[0488] In addition, plasmids were prepared, cells were transfected, and qPCR was performed using the methods of Example 1. The primer sequences used are shown in Table 27. The experiment was repeated three times independently. The test results showed that the editing efficiency of the combination of gRNA-5-2, gRNA-5-3, gRNA-5-4, gRNA-5-5 and C13-2 was greater than 50%.

[0489] Table 27. qPCR primer sequences

[0490] Example 11: Targeting VEGFA significantly inhibits neovascularization in mice

[0491] We used the two plasmids C13-2-gRNA-4 and C13-2-gRNA-5 constructed in Example 1 and commissioned an outsourcing company to package the AAV8wt virus. The three plasmids were transfected into 293T cells to produce AAV, which was purified by gradient centrifugation. The titer was 1E13vg / ml by qPCR. We anesthetized the mice intraperitoneally with 200μl / 20g 2.5% tribromoethanol anesthetic solution, dilated the pupils, and applied local anesthesia. We first punctured the corneal edge with a 30G sharp needle, and then injected 1μl AAV into the subretinal space using the WPI nanofil RPE kit. The successful administration of the drug was confirmed by the retinal blister observed under the microscope. After that, the ocular surface was coated with tobramycin antibiotics, and the mice were placed in cages after waking up. Three weeks after administration, laser modeling was performed. Mice were anesthetized intraperitoneally with 380 μl / 20 g of 2.5% tribromoethanol anesthetic solution. After mydriasis and local anesthesia, the fundus of the mice was observed using a Lumenis Nova Spectra 532 nm laser therapy device. Laser photocoagulation was performed in four directions evenly distributed around the optic disc, 2-3 optic disc diameters away from the optic disc, using a power of 100 mW, 100 ms, and 100 μm. Mice with poor vision, such as hemorrhage or cataracts, were removed. Seven days after modeling, samples were collected to observe choroidal neovascularization (CNV) area. Retinal pigment epithelial (RPE) / choroid / sclera complexes were isolated and perfused with 4% paraformaldehyde (PFA). Neovascularization was stained with IB4-488 nm (Thermo Fisher I21411). Images were taken using a Lecia inverted fluorescence high-magnification microscope. CNV area was statistically analyzed using ImagJ 1.52 v software. The results are shown in Figure 13. The CNV area after editing by C13-2-gRNA-4 and C13-2-gRNA-5 was significantly reduced, proving that both can significantly inhibit the development of new blood vessels.

[0492] Example 12

[0493] The plasmid was constructed in the same way as in Example 2. We selected the forward and reverse primers corresponding to the guide sequences such as gRNA-4, gRNA-5, gRNA-5-3, gRNA-6, gRNA-7, gRNA-29, gRNA-30, gRNA-RJ-8, and gRNA-X-1 in Table 28 (primers plus enzyme cutting sites, that is, the 5' end of the sequence in Table 28 was added with AAAC to become a forward primer, and the 5' end of the reverse complementary sequence of the sequence in Table 28 was added with cttg to become a reverse primer) and the annealed products were connected to the BpiI enzyme-cut backbone of the pAAV-CasRx-gRNA plasmid (also known as CasRx-V, SEQ ID NO: 28). After transformation of competent Escherichia coli, the cells were cultured in a medium containing the corresponding antibiotics, colony PCR reaction was performed, positive clones were screened by electrophoresis, plasmids were extracted, and Sanger sequencing was performed to obtain CasRx targeting VEGFA. RNA plasmid, which can be used to express CasRx and gRNA (such as gRNA-5, etc.); At the same time, for the disclosed tool Cas13X.1, a conventional method is used to prepare Cas13X.1-V vector (SEQ ID NO: 8); According to the Cas13X.1-dual sequence, the corresponding forward and reverse primers (5'-end of the sense chain plus cacc, 5'-end of the antisense chain plus cagc) are synthesized, and Cas13X.1-dual is constructed after connection with the BsaI enzyme backbone of the Cas13X.1-V vector, wherein Cas13X.1-V is used as a negative control. This embodiment also uses the C13-2-gRNA-5 constructed in Example 1 and the corresponding negative control C13-2-V. The plasmid was transfected into 293T cells using the same method as in Example 4, and the supernatant was collected after 72h of transfection for ELISA detection of VEGFA protein levels. Use the Human VEGF-A (Vascular Endothelial Cell Growth Factor A) ELISA Kit from Elascience. Strictly follow the kit's operating procedures to set different concentrations of standards and process samples. The final data is read using a microplate reader (Multiskan FC from Thermo Fisher) at 450 nm. The corresponding formula between sample concentration and OD value is calculated based on the OD value of the standard. Repeat the experiment twice.

[0494] Table 28. Primer related sequences of this embodiment

[0495] In this embodiment, we express 3 kinds of Cas13 in combination with different gRNAs by transfection in the same batch. As can be seen from the results of this embodiment and the aforementioned embodiment, several gRNAs disclosed herein, after being combined with C13-2 or CasRx, all show high editing efficiency, and are significantly better than the combination of Cas13X.1-dual in the disclosed patent. As shown in Table 29 and Figure 14, C13-2-gRNA-5 performs best after plasmid transfection, with a target protein downregulation rate of up to 97.4%, CasRx-gRNA-30 and CasRx-gRNA-5-3 respectively causing target protein downregulation by 85.4% and 82.2%, CasRx-gRNA-5 and CasRx-gRNA-29 respectively causing target protein downregulation by 75.7% and 71.8%, followed by CasRx-gRNA-4 and CasRx-gRNA-6 causing target protein downregulation by 61.0% and 69.7%. The protein downregulation efficiency of the above combinations was significantly better than that of CasRx-X-1, CasRx-RJ-8 and Cas13X.1-dual groups (P<0.01).

[0496] Table 29. Comparison of knockdown efficiency at the protein level

[0497] Note: VEGFA protein levels in the negative control CasRx-V, Cas13X.1-V, and C13-2-V groups were set at 100%. Data for other groups were calculated based on their respective negative controls. "***" indicates p < 0.001 compared to the corresponding negative control group.

[0498] Example 13

[0499] In order to compare the safety of the newly discovered high-editing efficiency gRNAs disclosed in this disclosure with the previously disclosed gRNAs, we designed an experiment using the C13-2 plasmids targeting VEGFA constructed in the previous examples. At the same time, the C13-2-RJ-2, C13-2-RJ-8, and C13-2-X-1 plasmids (expressing the corresponding gRNAs containing the RJ-2, RJ-8, and X-1 guide sequences, respectively) were constructed using the same method as in Example 7. gRNA-luc targeting the luciferase gene (guide sequence GAATGTAGCCATCCATCCTTGTCAA, SEQ ID NO: 237) was selected and constructed using the same method as C13-2-gRNA-luc as a control group for RNA-seq. The same method as in Example 1 was used to transfect 293T cells with the plasmid. 72 hours after transfection, cell pellets were collected, total RNA was extracted, and the RNA library was constructed by a third-party gene sequencing company. RNA-seq data was obtained on the BGI DNBSEQ-T7 sequencer. The data was quality controlled by fastqc and multiqc. We used fastq to remove low-quality reads and STAR software to remove rRNA sequence reads. StringTie2 software was then used to quantify gene expression levels, followed by DESeq2 software for differential expression analysis. Genes with |log2foldchange|>0.5, padj<0.05, and baseMean>2 were considered differentially expressed genes. We used EMBOSS water software to identify transcripts with a base number of ≥21 aligned with the guide sequence, a number of mismatched bases ≤6, and a minimum number of consecutive paired bases ≥8 as transcripts predicted to be targeted by gRNA, and the corresponding genes were considered predicted targeted genes. Finally, the intersection of the downregulated differentially expressed gene set and the predicted targeted gene set was taken to obtain the off-target genes (VEGFA is an on-target gene and has been excluded).

[0500] Specific results are shown in Table 30. Compared with the control group, gRNA-30 and gRNA-7 did not detect any gRNA-related differentially expressed genes, that is, no off-target genes were detected. However, gRNA-X-1, which is adjacent to its target sequence, had two off-target genes. For drug development, this is not just a quantitative difference, but a qualitative one.

[0501] In addition, it can be seen from the above examples that the editing efficiency of gRNA-30 is also significantly better than that of gRNA-X-1, that is, when used in combination with the same Cas13 protein, the editing efficiency and safety of gRNA-30 are significantly better than those of gRNA-X-1 adjacent to its target sequence, and the drugability is better, thus achieving unexpected technical effects.

[0502] gRNA-29 has only one gRNA-related off-target gene, so it also has certain advantages in terms of off-target safety.

[0503] The number of differentially expressed genes downregulated by editing with gRNA-29, gRNA-30, gRNA-7, gRNA-5-2, gRNA-5-3, and gRNA-5-5 was much smaller than that of gRNA-RJ-2, gRNA-RJ-8, and gRNA-X-1 in the prior art, indicating that the disturbance to the transcriptome was smaller.

[0504] gRNA-RJ-2 has as many as dozens of off-target genes, while gRNA-5-2, gRNA-5-3, and gRNA-5-5, which are adjacent to their target sequences, have far fewer off-target genes, making them safer in terms of off-target effects.

[0505] Table 30. Off-target analysis statistical results after editing with different gRNAs and C13-2

[0506] Example 14: Editing efficiency of C13-2 mutant combined with gRNA

[0507] The inventors designed the C13-2 mutant shown in Table 31 and combined it with gRNA-5 to test the editing efficiency.

[0508] Expression vectors for Cas13 (C13-2 and its mutants) and gRNA-5 were constructed and transfected into 293T cells according to the instructions of Lipofectamine 2000 (Thermo). A 293T cell control group was also set up without transfection of any plasmid.

[0509] qPCR detection of target RNA levels

[0510] 48 hours after transfection, RNA was extracted from cells using the SteadyPure Universal RNA Extraction Kit, and RNA concentration was determined using an ultra-micro-spectrophotometer. RNA products were reverse transcribed using the Evo M-MLV Mix Kit with gDNA Clean for qPCR Reverse Transcription Kit and detected using the SYBR Green Premix Pro Taq HS qPCR Kit (Low Rox Plus). The experiment was repeated three times, and the results were averaged.

[0511] The relative values ​​of VEGFA RNA levels after editing of the M01-M22 variants of C13-2 compared to the VEGFA RNA levels of the C13-2-BsaI control group were all lower than 0.04, that is, the editing efficiency was higher than 96%.

[0512] Table 31. C13-2 mutants

[0513] Example 15: Testing of C13-2 inactivation mutants in combination with gRNA

[0514] The inventors designed the inactivation mutants shown in Table 32 and tested the editing efficiency in combination with gRNA-5.

[0515] An expression vector for expressing the inactivated Cas13 mutant and gRNA-5 was constructed and transfected into a 293T cell line. Transfection was performed according to the instructions for Lipofectamine 2000 (Thermo). RNA was extracted 72 hours later using the SteadyPure Universal RNA Extraction Kit. RNA extracted from three batches of experiments was sent to a sequencing company for RNAseq sequencing. The amount of VEGFA RNA detected is shown in Table 32 below.

[0516] Table 32. VEGFA RNA amount determined by RNAseq sequencing

[0517] Experimental data showed that the editing activity remained high after the introduction of the R750A+H755A mutation, while weaker editing activity was retained after the introduction of the R210A+H215A and / or R785A+H790A mutations. Only after the simultaneous introduction of the R210A+H215A, R750A+H755A and R785A+H790A mutations did the editing activity almost completely disappear.

[0518] Example 16

[0519] Based on the efficacy results in mice, C13-2-V, C13-2-gRNA-30, and C13-2-gRNA-5 were packaged into three AAV2 / 8s using AAV capsid plasmids and Helper plasmids to test the effectiveness of these three AAV2 / 8s in inhibiting neovascularization in laser-induced non-human primate (NHP) crab macaques. Equal volumes and doses of the three AAVs were injected subretinal into the eyes of NHP animals. The animals were first anesthetized, mydriatic, and anesthetized on the surface of the eyes. The subretinal injection was then followed by antibiotic application to the surface of the eyes to keep them warm. After the animals woke up, they were raised normally. Three animals were administered to each group. Four weeks after administration, the Iridex laser therapy device was used to irradiate the macula of the animals with the same parameters to produce 6-10 photocoagulation points. Eyes with bleeding areas greater than 2 photocoagulation points were excluded. Fluorescein sodium was injected intraperitoneally at different time points at 6, 8, and 13 weeks of administration, and the fluorescence leakage at different time points was tracked and photographed. Finally, the spot grading was evaluated by three different technicians. The proportion of grade IV spots is shown in Figure 15. The drug groups C13-2-gRNA-30 and C13-2-gRNA-5 significantly inhibited the formation of grade IV spots at different administration time points, that is, significantly inhibited the development of new blood vessels, and the effect was sustained for a long time.

[0520] Based on the above examples, it can be seen that the gRNA with a guide sequence of SEQ ID NO: 12, 13, 15, 40-43, 45-47, 52-60, 64, 65, 73, 216, 219, 220, 223, 227, 228, 229, and 230 has a high editing efficiency; the gRNA with a guide sequence of SEQ ID NO: 12-15 has a significantly reduced off-target risk, and the risk of off-target is lower; the gRNA with a guide sequence of SEQ ID NO: 58, 59, 227, 228, and 230 basically does not cause intron enrichment, and the safety risk associated therewith is lower.

[0521] Although specific embodiments of the present disclosure have been described above, those skilled in the art will appreciate that these are merely illustrative and that various changes or modifications may be made to these embodiments without departing from the principles and essence of the present disclosure. Therefore, the scope of protection of the present disclosure is defined by the appended claims.

[0522] Some of the sequences used in this disclosure are as follows:

[0523] Cas13m.3 (SEQ ID NO: 1):

[0524] Cas13m.6 (SEQ ID NO: 2):

[0525] C13-2 (SEQ ID NO: 3):

[0526] Cas13m.3-BsaI plasmid (SEQ ID NO: 4):

[0527] Cas13m.6-BsaI plasmid (SEQ ID NO: 5):

[0528] C13-2-BsaI plasmid (SEQ ID NO: 6):

[0529] Unordered sequence (SEQ ID NO: 7):

[0530] Guide sequence of gRNA-1 (SEQ ID NO: 9):

[0531] Guide sequence of gRNA-2 (SEQ ID NO: 10):

[0532] Guide sequence of gRNA-3 (SEQ ID NO: 11):

[0533] Guide sequence of gRNA-4 (SEQ ID NO: 12):

[0534] Guide sequence of gRNA-5 (SEQ ID NO: 13):

[0535] Guide sequence of gRNA-6 (SEQ ID NO: 14):

[0536] Guide sequence of gRNA-7 (SEQ ID NO: 15):

[0537] Guide sequence of gRNA-8 (SEQ ID NO: 16):

[0538] Guide sequence of gRNA-9 (SEQ ID NO: 17):

[0539] Guide sequence of gRNA-10 (SEQ ID NO: 18):

[0540] Direct repeat sequence of gRNA encoded by Cas13m.3 vector (SEQ ID NO: 19):

[0541] Direct repeat sequence of gRNA encoded by Cas13m.6 vector (SEQ ID NO: 20):

[0542] Direct repeat sequence of gRNA encoded by C13-2 vector (SEQ ID NO: 21):

[0543] qGAPDHF1 primer (SEQ ID NO: 22):

[0544] qGAPDHR1 primer (SEQ ID NO: 23):

[0545] qVegfa-F1 primer (SEQ ID NO: 24):

[0546] qVegfa-R1 primer (SEQ ID NO: 25):

[0547] qVegfa-F2 primer (SEQ ID NO: 26):

[0548] qVegfa-R2 primer (SEQ ID NO: 27):

[0549] pAAV-CasRx-gRNA plasmid (SEQ ID NO: 28):

[0550] RJ-2 guide sequence (SEQ ID NO: 29):

[0551] RJ-5 guide sequence (SEQ ID NO: 30):

[0552] RJ-8 guide sequence (SEQ ID NO: 31):

[0553] Tandem RJ-5+RJ-8 (SEQ ID NO: 32):

[0554] X-1 guide sequence (SEQ ID NO: 33):

[0555] X-2 guide sequence (SEQ ID NO: 34):

[0556] X-dual (tandem X-1 + X-2) (SEQ ID NO: 35):

[0557] qmVA-F primer (SEQ ID NO: 36):

[0558] qmVA-R primer (SEQ ID NO: 37):

[0559] mGAPDH-F primer (SEQ ID NO: 38):

[0560] mGAPDH-R primer (SEQ ID NO: 39):

[0561] The sequences of SEQ ID NO:40 to SEQ ID NO:235 are as described above.

[0562] Cas13X.1-dual related sequence (tandem X-1+X-2 guide sequence, used for Cas13X.1 related vector construction) (SEQ ID NO: 236):

[0563] Guide sequence of gRNA-luc targeting luciferase gene (SEQ ID NO: 237):

[0564] Cas13X.1-V vector (SEQ ID NO: 8):

Claims

1. A guide RNA for a gene editing system, characterized in that It comprises a guide sequence having at least 80% sequence identity to the sequence shown in any one of SEQ ID NOs: 10-18, 40-230; Optionally, the guide sequence has at least 80% sequence identity to any one of SEQ ID NOs: 12, 13, 15, 40-43, 45-47, 52-60, 64, 65, 73, 216, 219, 220, 223, 227, 228, 229, 230; Optionally, the guide sequence has at least 80% sequence identity to the sequence shown in any one of SEQ ID NOs: 12, 13, 15, 47, 58, 59, 227, 228, 230.

2. The guide RNA according to claim 1, wherein The guide sequence is engineered to hybridize to a target RNA; Optionally, the guide sequence is engineered to hybridize to the target RNA with no more than 6 nucleotide mismatches.

3. The guide RNA according to claim 1, wherein The guide RNA is capable of forming a complex with the RNA-guided nuclease and directing sequence-specific binding of the complex to the target RNA.

4. The guide RNA according to claim 1, wherein The guide RNA is capable of forming a complex with the RNA-guided nuclease and directing the complex to bind and cleave the target RNA.

5. The guide RNA according to claim 3 or 4, wherein The complex reduces the level of the target RNA in the cell.

6. The guide RNA according to claim 3 or 4, wherein The complex reduces the level of the target RNA in the cell by at least 5%.

7. The guide RNA according to claim 4, wherein The number of off-target genes when the complex binds to and cleaves the target RNA is less than 40.

8. The guide RNA according to claim 7, wherein The number of off-target genes is determined by taking the intersection of the differentially expressed gene set determined by RNA sequencing and the off-target gene set predicted by the program.

9. The guide RNA according to claim 3 or 4, wherein The complex reduces the level of protein encoded by the target RNA in the cell.

10. The guide RNA according to claim 3 or 4, wherein The complex reduces the level of the target RNA-encoded protein in the cell by at least 5%.

11. The guide RNA according to any one of claims 3 to 10, wherein The RNA-guided nuclease is a Cas protein; Optionally, the Cas protein is Cas13; Optionally, the Cas protein is Cas13a, Cas13b, Cas13c or Cas13d.

12. The guide RNA according to claim 11, wherein The Cas protein is Cas13, Optionally, the Cas protein comprises an amino acid sequence that is ≥50% identical to the sequence shown in any one of SEQ ID NOs: 1-3; Optionally, the Cas protein comprises an amino acid sequence that is ≥50% identical to the sequence shown in SEQ ID NO: 3, and the Cas protein (a) is mutated to other residues at positions corresponding to residues R210 and H215 of the sequence shown in SEQ ID NO: 3; (b) is mutated to other residues at positions corresponding to residues R785 and H790 of the sequence shown in SEQ ID NO: 3; (c) is mutated to other residues at positions corresponding to residues R210, H215, R785 and H790 of the sequence shown in SEQ ID NO: 3; or, (d) is mutated to other residues at positions corresponding to residues R210, H215, R750A, H755A, R785 and H790 of the sequence shown in SEQ ID NO: 3; Optionally, the Cas protein comprises a sequence that is ≥50% identical to CasRx.

13. The guide RNA according to any one of claims 3 to 12, wherein The RNA-guided nuclease comprises a nuclease portion and a fused homologous or heterologous domain; Optionally, the RNA-guided nuclease comprises any one or more of the following: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter tag, and an affinity tag.

14. The guide RNA according to any one of claims 1 to 13, wherein The guide sequence comprises 20-40 nucleotides.

15. The guide RNA according to any one of claims 1 to 14, wherein The guide RNA comprises a guide sequence and a direct repeat sequence that interacts with the RNA-guided nuclease.

16. The guide RNA according to claim 15, wherein The guide sequence is located at the 3' end or the 5' end of the direct repeat sequence.

17. The guide RNA according to any one of claims 15 to 16, wherein The directly repeated sequence comprises the sequence shown in any one of SEQ ID NOs: 19-21.

18. The guide RNA according to any one of claims 1 to 17, wherein The guide RNA comprises an aptamer sequence.

19. The guide RNA according to claim 18, wherein The aptamer sequence is inserted into the loop of the direct repeat secondary structure of the guide RNA.

20. The guide RNA according to any one of claims 1 to 19, wherein The guide RNA comprises modified nucleotides.

21. The guide RNA according to claim 20, wherein The modified nucleotides comprise 2'-O-methyl, 2'-O-methyl-3'-phosphorothioate or 2'-O-methyl-3'-thioPACE modifications.

22. The guide RNA according to claim 20, wherein The modified nucleotides are selected from deoxyribonucleotides and locked nucleic acids.

23. The guide RNA according to any one of claims 2 to 22, wherein The target RNA is VEGFA RNA; Optionally, the target RNA is human VEGFA RNA; Optionally, the target RNA is VEGFA pre-mRNA or mature VEGFA mRNA.

24. The guide RNA according to any one of claims 2 to 23, wherein The target RNA is located in the nucleus or cytoplasm of the cell.

25. An isolated nucleic acid, characterized in that It encodes the guide RNA according to any one of claims 1-24.

26. A carrier, characterized in that The vector comprises the nucleic acid of claim 25 and a regulatory sequence for regulating the expression of the guide RNA.

27. The vector according to claim 26, wherein The vector is an adeno-associated virus vector.

28. The vector according to claim 26, wherein The regulatory sequence is a promoter or an enhancer.

29. The vector according to claim 26, wherein The regulatory sequence is a U6 promoter, an eye-specific promoter or a CBh promoter.

30. A gene editing system, characterized in that It includes: (a) the guide RNA of any one of claims 1 to 24, or a polynucleotide encoding the guide RNA; and (b) an RNA-guided nuclease or a polynucleotide encoding the RNA-guided nuclease; The guide RNA is capable of forming a complex with the RNA-guided nuclease and directing sequence-specific binding of the complex to the target RNA.

31. The gene editing system according to claim 30, wherein The guide RNA is capable of forming a complex with an RNA-guided nuclease and directing the complex to bind to and cleave the target RNA.

32. The gene editing system according to claim 30, wherein The RNA-guided nuclease is a Cas protein; Optionally, the Cas protein is Cas13 protein; Optionally, the Cas protein is Cas13a protein, Cas13b protein, Cas13c protein or Cas13d protein.

33. The gene editing system according to claim 32, wherein The Cas protein is Cas13, Optionally, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in any one of SEQ ID NOs: 1-3; Optionally, the Cas protein comprises a sequence that is ≥50% identical to the sequence shown in SEQ ID NO: 3, and the Cas protein (a) is mutated to other residues at positions corresponding to residues R210 and H215 of the sequence shown in SEQ ID NO: 3; (b) is mutated to other residues at positions corresponding to residues R785 and H790 of the sequence shown in SEQ ID NO: 3; (c) is mutated to other residues at positions corresponding to residues R210, H215, R785 and H790 of the sequence shown in SEQ ID NO: 3; or, (d) is mutated to other residues at positions corresponding to residues R210, H215, R750A, H755A, R785 and H790 of the sequence shown in SEQ ID NO: 3; Optionally, the Cas protein comprises a sequence that is ≥50% identical to CasRx.

34. The gene editing system according to any one of claims 30 to 33, wherein: The RNA-guided nuclease comprises a nuclease portion and a fused homologous or heterologous domain; Optionally, the RNA-guided nuclease comprises any one or more of the following: a subcellular localization signal, a deaminase domain, a translation activation domain, a translation repression domain, an RNA methylation domain, an RNA demethylation domain, a nuclease domain, a splicing factor domain, a reporter tag, and an affinity tag; Optionally, the subcellular localization signal is selected from a nuclear localization signal and a nuclear export signal sequence.

35. The gene editing system according to claim 30, wherein The polynucleotide sequence encoding the guide RNA is linked to a first regulatory sequence, and the first regulatory sequence is used to regulate the expression of the guide RNA; The polynucleotide sequence encoding the RNA-guided nuclease is linked to a second regulatory sequence, which is used to regulate the expression of the RNA-guided nuclease.

36. A vector system comprising the gene editing system of any one of claims 30-35, wherein: The vector system comprises a polynucleotide sequence encoding the guide RNA and a first regulatory sequence that regulates the expression of the guide RNA; and a polynucleotide sequence encoding the RNA-guided nuclease and a second regulatory sequence that regulates the expression of the RNA-guided nuclease.

37. The vector system according to claim 36, wherein The first regulatory sequence and / or the second regulatory sequence is a promoter or an enhancer.

38. An adeno-associated virus vector comprising the gene editing system of any one of claims 30-35, wherein The adeno-associated viral vector comprises DNA encoding the RNA-guided nuclease and guide RNA.

39. A lipid nanoparticle comprising the gene editing system of any one of claims 30-35, wherein The lipid nanoparticle comprises the guide RNA and an mRNA encoding the RNA-guided nuclease.

40. A lentiviral vector comprising the gene editing system of any one of claims 30-35, wherein The lentiviral vector comprises the guide RNA and mRNA encoding the RNA-guided nuclease; optionally, the lentiviral vector is pseudotyped with an envelope protein; optionally, the mRNA encoding the RNA-guided nuclease is linked to an aptamer sequence.

41. A ribonucleoprotein complex comprising the gene editing system of any one of claims 30-35, wherein: The ribonucleoprotein complex is formed by the guide RNA and the RNA-guided nuclease.

42. A virus-like particle comprising the gene editing system of any one of claims 30-35, wherein The virus-like particle comprises a ribonucleoprotein complex formed by the guide RNA and the RNA-guided nuclease; optionally, the RNA-guided nuclease is fused to the gag protein.

43. A eukaryotic cell comprising the gene editing system of any one of claims 30-35.

44. A pharmaceutical composition, characterized in that It comprises the gene editing system according to any one of claims 30 to 35, the vector system according to claim 36 or 37, the adeno-associated virus vector according to claim 38, the lipid nanoparticle according to claim 39, the lentiviral vector according to claim 40, the ribonucleoprotein complex according to claim 41, the virus-like particle according to claim 42, or the eukaryotic cell according to claim 43.

45. The pharmaceutical composition of claim 44, comprising a pharmaceutically acceptable excipient.

46. ​​Use of the guide RNA of any one of claims 1-24, the isolated nucleic acid of claim 25, the vector of any one of claims 26-29, the gene editing system of any one of claims 30-35, the vector system of claim 36 or 37, the adeno-associated viral vector of claim 38, the lipid nanoparticle of claim 39, the lentiviral vector of claim 40, the ribonucleoprotein complex of claim 41, the virus-like particle of claim 42, the eukaryotic cell of claim 43, or the pharmaceutical composition of claim 44 or 45 in any of the following or in the preparation of an agent for achieving any of the following schemes: Cleave or nick one or more target RNA molecules, activate or upregulate one or more target RNA molecules, activate or inhibit translation of one or more target RNA molecules, inactivate one or more target RNA molecules, visualize, label or detect one or more target RNA molecules, bind one or more target RNA molecules, transport one or more target RNA molecules, and mask one or more target RNA molecules.

47. The method of claim 46, wherein the target RNA is VEGFA RNA; Optionally, the target RNA is human VEGFA RNA.

48. A method for diagnosing, treating or preventing a disease or condition associated with a target RNA, characterized in that: The method comprises administering to a sample of a subject in need thereof or to a subject in need thereof an effective amount of the guide RNA of any one of claims 1-24, the isolated nucleic acid of claim 25, the vector of any one of claims 26-29, the gene editing system of any one of claims 30-35, the vector system of any one of claims 36-37, the adeno-associated viral vector of claim 38, the lipid nanoparticle of claim 39, the lentiviral vector of claim 40, the ribonucleoprotein complex of claim 41, the virus-like particle of claim 42, or the pharmaceutical composition of claim 44 or 45.

49. The method of claim 48, wherein the disease or condition associated with the target RNA is a disease or condition caused by abnormal expression of the target RNA.

50. The method of claim 48, wherein the target RNA is VEGFA RNA; Optionally, the target RNA is human VEGFA RNA.

51. A use of the guide RNA according to any one of claims 1-24, the isolated nucleic acid according to claim 25, the vector according to any one of claims 26-29, the gene editing system according to any one of claims 30-35, the vector system according to any one of claims 36-37, the adeno-associated viral vector according to claim 38, the lipid nanoparticle according to claim 39, the lentiviral vector according to claim 40, the ribonucleoprotein complex according to claim 41 and the virus-like particle according to claim 42 in the preparation of a medicament for diagnosing, treating or preventing a disease or condition associated with a target RNA.

52. The method of claim 51, wherein the disease or condition associated with the target RNA is a disease or condition caused by abnormal expression of the target RNA.

53. The method of claim 51, wherein the target RNA is VEGFA RNA; Optionally, the target RNA is human VEGFA RNA.

Images