An inhibitor of idiopathic pulmonary fibrosis and uses thereof

Abstract

The present application relates to the technical field of idiopathic pulmonary fibrosis inhibitor, and specifically discloses an idiopathic pulmonary fibrosis inhibitor, and the molecular inhibitor comprises compound HO11553 and / or compound HO11552.The molecular inhibitor of the present application targets G protein-coupled receptor CCR2, and the molecular inhibitor is a dual-pocket inhibitor capable of being combined with the orthosteric binding site and the allosite binding site of CCR2 respectively, the molecular inhibitor slows down the progress of pulmonary fibrosis by inhibiting CCR2, provides an effective means for the treatment of IPF, and has good application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to an inhibitor for idiopathic pulmonary fibrosis and application thereof. BACKGROUND

[0002] Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, fibrotic interstitial pneumonia, which is the most common idiopathic interstitial pneumonia in clinic, and its incidence is showing an upward trend. IPF poses a serious threat to human health. At present, IPF cannot be cured, and the treatment goal is to slow down the progression of the disease, improve the quality of life, and prolong the survival period. The main methods include anti-fibrosis drug treatment, non-drug treatment, complication treatment, palliative treatment, disease monitoring, patient education and self-management, etc. The main drugs currently used for idiopathic pulmonary fibrosis include pifenidone, nintedanib and high-dose acetylcysteine, among which pifenidone and nintedanib treatment can slow down the decline of IPF lung function, and N-acetylcysteine has antioxidant and anti-fibrosis effects at high doses (1800mg / d), which is useful for some IPF patients. These drugs can slow down the decline of lung function and have good clinical value. However, the long-term efficacy of IPF drugs and drug tolerance problems still exist, and the development of new drugs is urgent. In the prior art, a lot of research has been conducted on this.

[0003] Chinese Patent No. CN117902998A discloses an inhibitor for idiopathic pulmonary fibrosis and a preparation method thereof. The compound inhibitor mentioned therein can selectively target the bromodomain BD1 of BET protein, and has higher inhibitory activity on BRD4-BD1 than on BRD4-BD2, thereby providing diversified options for the treatment of IPF. Chinese Patent No. CN111961715B discloses the application of Mincle inhibitor in the treatment of idiopathic pulmonary fibrosis. It uses Mincle gene knockout mice as experimental objects to study the function of Mincle gene in idiopathic pulmonary fibrosis. The results show that Mincle gene deletion can alleviate bleomycin-induced idiopathic pulmonary fibrosis, thereby considering that Mincle can be used as a therapeutic target for idiopathic pulmonary fibrosis. In addition, Patent No. CN113631179A discloses a method for treating idiopathic pulmonary fibrosis, which uses a drug that reduces or eliminates the kinase activity of checkpoint kinase 1 (Chk1) to treat idiopathic pulmonary fibrosis (IPF). Therefore, the development of drugs for the treatment of idiopathic pulmonary fibrosis with better clinical value is still a difficult and important point in research and development.

[0004] Chemokines are small proteins that regulate the migration and activation of immune cells by binding to receptors, which can be divided into CC (CC Chemokines), CXC (CXC Chemokines), CX3C (CX3C Chemokines), C (C Chemokines) and the like. The chemokine receptor family includes CC chemokine receptors (CCR), CXC chemokine receptors (CXCR), CX3C chemokine receptors (CX3CR) and C chemokine receptors (XCR). Studies have shown that chemokine receptors are closely related to idiopathic pulmonary fibrosis, among which CCR2 is a G protein-coupled receptor that plays a key role in the recruitment of lung fibroblasts, cell migration, tissue remodeling and fibrosis, and is extremely important for the treatment and prognosis of idiopathic pulmonary fibrosis. In addition, existing public literature shows that CCR2 has two different characteristic binding pockets, namely the orthogonal site located on the extracellular side of the membrane and the isomeric site located in the cell, and thus has good binding activity. However, in the prior art, there is no drug research for treating idiopathic pulmonary fibrosis by targeting CCR2, and therefore the present application aims to develop an inhibitor of idiopathic pulmonary fibrosis to better meet the actual needs. SUMMARY

[0005] The technical problem solved by the present application is to provide an inhibitor of idiopathic pulmonary fibrosis and an application to solve the problems in the above background art.

[0006] The technical problem solved by the present application is solved by the following technical solution:

[0007] An inhibitor of idiopathic pulmonary fibrosis, the molecular inhibitor comprising a compound HO11553 and / or a compound HO11552;

[0008] The molecular structure of the compound HO11553 is:

[0009]

[0010]

[0011] The molecular structure of the compound HO11552 is:

[0012]

[0013] Further, the molecular inhibitor comprises a compound HO11553-TM and / or a compound HO11552; the compound HO11553-TM is a hydrochloride of the compound HO11553;

[0014] The molecular structure of the compound HO11553-TM is:

[0015]

[0016] Further, the molecular inhibitor targets the G protein-coupled receptor CCR2.

[0017] Further, the molecular inhibitor inhibits the G protein-coupled receptor CCR2 through the PI3K Calss IB pathway.

[0018] Further, the G protein-coupled receptor CCR2 has an orthosteric binding site located on the extracellular side of the membrane and an allosteric binding site located on the intracellular side of the membrane; in the molecular inhibitor, the compound HO11553 and the compound HO11552 are combined with the orthosteric binding site and the allosteric binding site of CCR2, respectively.

[0019] Further, it also comprises a pharmaceutically acceptable carrier and adjuvant.

[0020] The application further discloses an application of the molecular inhibitor of idiopathic pulmonary fibrosis in the preparation of a drug for treating idiopathic pulmonary fibrosis.

[0021] Beneficial effects: the molecular inhibitor of idiopathic pulmonary fibrosis targets the G protein-coupled receptor CCR2, and the molecular inhibitor is a dual-pocket inhibitor capable of being combined with the orthosteric binding site and the allosteric binding site of CCR2, respectively; the molecular inhibitor slows down the progress of pulmonary fibrosis by inhibiting CCR2, thereby providing an effective means for the treatment of IPF and having a good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 It is a spectrum analysis diagram of the compound HO11553-TM.

[0023] Figure 2 It is a spectrum analysis diagram of the compound HO11552.

[0024] Figure 3 It is a result diagram of an idiopathic pulmonary fibrosis model, wherein A is the expression level of CCR2 genes in a normal control group and an IPF (GSE70866) group; B is a survival analysis diagram showing the survival probability of groups with different CCR2 expression levels over time; C is a representative image of H&E and Masson's three-color staining of lung tissues after the mice are injected with BLM for four weeks; D is a result of pathological scoring of lung tissues stained by H&E at the fourth week; E is the area of collagen in lung tissues at the fourth week; F is an RT-gPCR analysis of the expression level of CCR2 in a BLM-induced idiopathic pulmonary fibrosis model (*P<0.05); G, H and I are Western blotting analysis of the expression level of CCR2 in lung tissues of each group.

[0025] Figure 4Optimized three-dimensional plot of CCR2 protein.

[0026] Figure 5 RMSD analysis plot of compound HO11553, compound HO11552 and other molecules systems (black represents molecule 17 and yellow represents molecule 67).

[0027] Figure 6 RMSF analysis plot of compound HO11553, compound HO11552 and other molecules systems (black represents molecule 17 and yellow represents molecule 67).

[0028] Figure 7 Rg and SASA analysis plot of compound HO11553, compound HO11552 and other molecules systems (black represents molecule 17 and yellow represents molecule 67).

[0029] Figure 8 Hydrogen bond analysis of compound HO11553, compound HO11552 and other molecules systems (left represents molecule 17 and right represents molecule 67).

[0030] Figure 9 Free energy distribution of compound HO11553, compound HO11552 and other molecules systems (left represents molecule 17 and right represents molecule 67).

[0031] Figure 10 Two-dimensional binding mode plot of compound HO11553, compound HO11552 and other molecules systems under optimal restraint (left represents molecule 17 and right represents molecule 67).

[0032] Figure 11 Coupling sensor plot of mouse CCR2 protein.

[0033] Figure 12 Interaction test plot of mouse CCR2 protein and drug 17 (compound HO11553).

[0034] Figure 13 Plot of mouse CCR2 protein alone, with drug 17 (compound HO11553), drug 67 (compound HO11552), and with both drugs.

[0035] Figure 14 Plot of drug 17 (compound HO11553) inhibiting TGF-β induced lung fibrosis cell proliferation.

[0036] Figure 15 Plot of drug 67 (compound HO11552) inhibiting TGF-β induced lung fibrosis cell proliferation. DETAILED DESCRIPTION

[0037] In order to make the technical means, creative features, purposes and effects of the present application easy to understand, the present application is further described below in combination with specific embodiments.

[0038] (I) The molecular structure formula of the compound HO11553 is:

[0039]

[0040] The molecular structure formula of the compound HO11552 is:

[0041]

[0042] The compound HO11553 is further converted into the compound HO11553-TM, which is a hydrochloride form of the compound HO11553. The solubility of the compound HO11553 is limited, while the solubility of the compound HO11553-TM in different solvents can be significantly improved, and the application effect is better.

[0043] The molecular structure formula of the compound HO11553-TM is:

[0044]

[0045] The solubility of the compound HO11552 in different solvents is better, and it does not need to be further converted.

[0046] In the present application, the spectral analysis diagram of the compound HO11553-TM is as shown in Figure 1 The spectral analysis diagram and the liquid chromatogram of the compound HO11552 are as shown in Figure 2

[0047] The molecular inhibitor described in the present application targets the G protein-coupled receptor CCR2, and the molecular inhibitor inhibits the G protein-coupled receptor CCR2 through the PI3K CalssIB pathway.

[0048] The G protein-coupled receptor CCR2 has an orthosteric binding site located on the extracellular side of the membrane and an allosteric binding site located on the intracellular side of the membrane; in the molecular inhibitor, the compound HO11553 or HO11553-TM is mainly combined with the orthosteric binding site of CCR2, and the compound HO11552 is mainly combined with the allosteric binding site of CCR2.

[0049] As an improvement of the present application, the molecular inhibitor can also include a pharmaceutically acceptable carrier, adjuvant, and can be prepared into any acceptable pharmaceutical dosage form.

[0050] ​The idiopathic pulmonary fibrosis inhibitor provided by the application can be applied to preparation of a drug for treating idiopathic pulmonary fibrosis.

[0051] (II) Effect verification

[0052] 2.1 Establishment of an idiopathic pulmonary fibrosis model

[0053] This study was approved by the Animal Ethics Committee of Hunan Normal University. The idiopathic pulmonary fibrosis model was established using C57BL / 6J mice (6-8 weeks, 18-22 grams). Healthy mice were used as experimental subjects, and the mice were randomly divided into a control group and an experimental group. The mice in the experimental group were anesthetized with 1% sodium pentobarbital (50 mg / kg), and a single dose of 5 mg / kg bleomycin (BLM) solution was intratracheally injected. The BLM solution was prepared using normal saline (1 mg / ml).

[0054] After 4 weeks of feeding, the mice were sacrificed, and lung tissue was extracted. After collection, hematoxylin and eosin (H&E) staining and Masson's trichrome staining (Servicebio, China) were performed to evaluate the establishment effect.

[0055] H&E staining was used for histopathological examination. The sections were scored according to the degree of alveolar congestion, hemorrhage, and infiltration (4: extremely severe, 3: severe, 2: moderate, 1: mild, and 0: normal). Masson's trichrome staining was used to evaluate the deposition of collagen fibers. Tissue section images were taken at a magnification of 200x, and Immage-Pro Plus 6.0 software was used as the standard for identifying positive collagen areas.

[0056] The collagen pixel area and the corresponding tissue pixel area image of each tissue were measured, and the collagen area percentage (collagen pixel area / tissue pixel area x 100) was calculated.

[0057] 2.2 CCR2 protein detection

[0058] A. RT-qPCR detection of CCR2 mRNA

[0059] Total RNA was extracted from the tissue using Trizo1 reagent (Invitrogen, USA), and reverse transcription was performed according to the manufacturer's instructions using the mRNA reverse transcription kit. RT-qPCR was performed using the SYBR Green method for amplification and analysis. GAPDH mRNA was used as an endogenous control. The primer sequences (purchased from Qingke Biotechnology Co., Ltd., Beijing, China) were as follows:

[0060] M-CCR2: forward TGTGATGACAAGCACTTAGACC

[0061] reverse tggagataccttcggaactt

[0062] M-GAPDH forward GCGACTTCAACAGCAACTCCC

[0063] Reverse caccctgttgctgtagccgta

[0064] B. Western Blot for CCR2 protein

[0065] Tissue samples were lysed using RIPA lysis buffer and proteins were analyzed. The concentration of proteins was measured using BCA protein assay kit. Membranes were incubated with CCR2 antibody (4°C overnight) after soaking in 5% milk for 2 hours at room temperature, washed three times with TBST and incubated with secondary antibody for 1 hour at room temperature. B was used as an endogenous control and detection was performed on a shaker. Finally, the signal was developed using a chemiluminescence imaging system and quantified.

[0066] 2.3. Data analysis

[0067] All data were analyzed using GraphPad Prism 9 software. Independent sample t-test was used for comparison between groups, with significance P < 0.05.

[0068] References Figure 3 A-D, H&E staining of lung tissue shows severe hyperemia and exudation of alveoli, local alveolar wall hyperplasia into connective tissue, accompanied by alveolar bone collapse and loss of alveolar bone structure. Inflammatory cell infiltration was observed in the alveolar space and around. Partial bronchus, total inflammatory score 10. In contrast, the control group showed clear alveolar structure and intact alveolar wall, with no obvious inflammatory cell infiltration or fibrosis, with a total inflammatory score of 2.

[0069] Masson's trichrome staining showed prominent collagen fibers, alveolar wall hyperplasia in the BLM group, and fibrous mass formation in some areas, indicating severe fibrosis of the alveolar wall. The average collagen area percentage calculated for the BLM group was 21.13%, which was based on the ratio of collagen to tissue pixel area. In the control group, no obvious blue staining was observed. Collagen fibers were observed, with minimal collagen hyperplasia or fibrosis, resulting in an average collagen area percentage of 6.13%, as shown in E. These research results confirm that intratracheal instillation of BLM successfully induced idiopathic pulmonary fibrosis in mice. Figure 3

[0070] ​To clarify the expression of CCR2 in idiopathic pulmonary fibrosis, the inventors detected the mRNA and protein levels of CCR2 in the lung tissues of male and female animals. The control group and BLM-induced idiopathic pulmonary fibrosis mice were detected by RT-qPCR and Western blot, and the results showed that the mRNA and protein of CCR2 in the BLM group were significantly higher than those in the control group.

[0071] (III) Construction of CCR2 membrane protein structure and molecular screening

[0072] 3.1 Preliminary construction of CCR2 membrane protein

[0073] The three-dimensional structure of CCR2 was referenced from the protein database (https: / / www.rcsb.org / ). The preparation of CCR2 membrane protein includes amino acid residue repair, hydrogen addition and dehydration, which creates conditions for the formation of receptor drug layers.

[0074] The extracted CCR2 structure is subjected to amino acid repair, hydrogen atom addition and energy minimization, and the resulting structure is saved in pdb format using the Charmm-gui tool for further use. This process also includes importing optimized protein structures, adjusting the direction of the phospholipid membrane, and assembling the membrane with DOPC as the membrane component. Na+ and Cl- ions are used to maintain charge balance in the system. Finally, in a format compatible with GROMACS, and applying appropriate force fields, including AMBER19SB for proteins, Lipid17 for phospholipids, and GAFF2 for ligands.

[0075] 3.2 Small molecule data collection

[0076] SMILES strings and corresponding IC50 values were downloaded from the BindingDB (https: / / www.bindingdb.org / bind / index.jsp) database of molecules targeting CCR2. The classification of molecules is based on their activity level, ensuring that IC50 values span four concentration levels.

[0077] 3.3 Structure-based pharmacophore (SBP) modeling

[0078] The optimized protein structure and reference molecules were used for SBP modeling. According to the IC50 values, small molecules were divided into active and inactive categories, and the pharmacophore was evaluated based on sensitivity and specificity, and used as a test set for pharmacophore validation. SBP models were created for the internal and external binding pockets of CCR2, named SBPi and SBPo, respectively.

[0079] 3.4 Further drug optimization design

[0080] 3D-QSAR modeling: The collected small molecule data was used for feature extraction and evaluation.

[0081] Generation and evaluation of 3D-OSAR pharmacophores was based on maximum fit, total cost, effective value and correlation. The best 3D-OSAR model was selected after comprehensive evaluation.

[0082] Common pharmacophore (CFP) modeling: CCR2 inhibitors in clinical I, I and III phases were collected and common structural features were identified. These features were used to generate CFP pharmacology, input active and inactive molecules for validation, and the best CFP model was selected according to score, sensitivity, specificity and quality.

[0083] Pharmacology-based virtual screening (PBVS): Small molecule compounds were collected, including anti-infective drug library, anti-inflammatory drug library, anti-tumor drug library, anti-tumor drug library, anti-tumor drug library, anti-tumor drug library and anti-tumor drug library, anti-viral concentric library, anti-viral library, chemokine receptor targeting library, GPCR targeting library, immune library and hGPCR complete, a total of 152 406 molecules. The generated SBPo, SBPi, 3D-OSAR and CFP pharmacophores were used for screening. Molecules that meet the pharmacokinetics criteria are retained when further AMET analysis is performed.

[0084] The specific process is as follows: SBPo screening: screening was performed using the SBPo pharmacophore, and 1.722 pharmacological libraries including compound HO11553 and compound HO11552 were screened out as the remaining candidate molecules; SBPi screening: candidate molecules were further screened using the SBPi pharmacology library, and 69 small molecules were reduced; 3D-QSAR screening: 69 small molecules were screened using the three-dimensional-OSAR pharmacology base, and all 69 molecules were retained; CFP screening: 69 molecules were screened using the CFP pharmacophore, and the final result of the virtual screening process was to retain some small molecules. This multi-pharmacophore virtual screening method ensures a comprehensive evaluation of potential candidate drugs, making full use of the advantages of each drug source model.

[0085] ADMET screening: 69 small molecules screened by virtual screening were evaluated by ADME and toxicity module, and their ADME properties were analyzed, including absorption level, BBB level, solubility, CYP2D6, liver toxicity, PPB, AlogP98 and PSA2D, in addition, their toxicity characteristics were also evaluated, including mouse female NTP probability, male mouse NTP probability, female rat NTP, male rat NTP probability, WOE probability, Ames probability and oxygen-demanding biodegradability probability, wherein molecules with toxicity, carcinogenicity or other adverse properties were excluded. Among them, small molecule 17 (representing compound HO11553) docks CCR2 ortho binding site in the application, 67 (compound HO11552) docks CCR2 para binding site in the application, and the ADME analysis results of the molecules docking CCR2 of the two are shown in Table 1, and the toxicity probability analysis of the two is shown in Table 2, it can be seen that the compound HO11553, the compound HO11552 does not have toxicity, carcinogenicity or other adverse properties. The molecules verified by ADMET continue to carry out molecular docking and MM / PBSA scoring.

[0086] Table 1 ADME analysis results of molecules docking CCR2

[0087]

[0088] Among them: solubility level a : 0 (very low), 1 (very low), 2 (low), 3 (good), 4 (best);

[0089] BBB level b : 0 (very high), 1 (high), 2 (medium), 3 (low), 4 (very low);

[0090] Solubility c : The greater the negative value, the lower the solubility;

[0091] CYP2D6 d , liver toxicity e : The greater the negative value (the greater the absolute value), the weaker the inhibitory activity in general.

[0092] PPB f : The higher the value, the stronger the plasma protein binding.

[0093] AlogP98 g : The greater the value, the stronger the hydrophobicity.

[0094] PSA_2D h : The greater the value, the greater the polar surface area.

[0095] Table 2 analysis of toxicity probability results of molecules docking CCR2

[0096]

[0097] Batch molecular docking and MMPBSA scoring: The inventors performed batch molecular docking and MM / PBSA binding energy calculation of CCR2 two pockets using the GPU-accelerated molecular docking and binding free energy calculation capability of the Hermite platform (https: / / hermite.dp.tech, DP Technology). The optimized three-dimensional results of CCR2 are shown in FIG. 17, in which the binding site is represented by the green pocket (external) and the purple pocket (internal) using the Hermite software. The results of molecular binding energy analysis are shown in Table 3. It can be seen that the orthosteric binding site 17 (representing the compound HO11553) and the allosteric binding site 67 (representing the compound HO11552) of the CCR2 of the present application both exhibit excellent binding energy. Figure 4

[0098] Table 3 Binding energy analysis of molecules docked to CCR2 (kcal / mol)

[0099]

[0100] (iv) Comprehensive verification and further multi-level analysis

[0101] 4.1 Molecular dynamics (MD) simulation

[0102] ​The molecules selected after the above screening, including compound HO11553 and compound HO11552, were hydrogenated using UCSF Chimera (https: / / www.cgl.ucsf.edu / chimera / ) and saved in mol2 format, at B97-3c level using ORCA (Neese, Wennmohs. Becker and Riplinger. 2020), followed by single-point energies and molecular surface electrostatic potentials calculations at B3LYP-D3 (BD / def2-TZVP level. RESP2 charges and topology files were calculated using Multiwfn (13) and sobtop (Tian Lu, Sobtop, Version 1.0 (dev3.1), http: / / sobereva.com / sobtop). The CCR2 protein structure was prepared using Charmm-gui, including membrane addition, water molecules addition, and charge equilibration with Na* and Cr / AMBER forcefield phospholipids, and ligands. Energy minimization specific settings, system equilibration, and long-range interaction handling were performed using Gromacs 2022.1 (Bauer, P.. B. Hess and E. Lindahl. GROMACS 2022.1 Manual 2022. doi:10.5281 / zenodo.6637571). The minimum distance for the TIP3P water model was 1 A, with periodic box edges. The steepest descent method was used for energy minimization, with a maximum force of 1000.0 kJ / mol nm-1. System equilibration was performed by three-step restrained dynamics for 125 ps and 500 ps, with time steps of 1 fs and 2 fs, respectively. The temperature and pressure were controlled by a velocity-scale thermostat and a Berendsen barostat, with a temperature of 298.5 K and a pressure of 1.01325 bar. Long-range interactions were handled using the Particle Mesh Ewald (PME) method, with a van der Waals cutoff of 10. The ligand and protein were restrained in a temperature-controlled group and a single group of translation and rotation motion elimination. Molecular dynamics simulations were performed with a time step of 2 fs, with a time span of 100 ns. The best binding mode was initially determined by the results and post-analysis. Two consecutive 500 ns molecular dynamics simulations were performed in this way.

[0103] 4.2 Stability and conformational analysis

[0104] RMSD, RMSF, Radius of RMSD and RMSF were used to analyze the stability and conformational flexibility (Rg) and the solvable surface area (SASA) of CCR2 protein. After simulation, periodic correction and trajectory stability analysis, the RMSD average and standard deviation evaluated the system stability. Rg and SASA evaluated the stability and conformational changes of the enzyme. Principal component analysis (PCA) determined the lowest potential energy and the best system conformation. The RMSD and Rg values were fitted and plotted into free energy landscape to extract the most stable conformation. Hydrogen bond (H-bond) analysis was performed using gromacs by gmxhbond command. This analysis was to quantify the protein and ligand during the molecular dynamics (MD) simulation.

[0105] 4.3 Results statistics:

[0106] ① Root mean square deviation (RMSD)

[0107] RMSD is a key indicator to evaluate the stability of the system, and is also the basis for further analysis of small molecule binding. By analyzing the RMSD of 500 ns, the results are shown in Figure 5 , which shows that both compound HO11553 and compound HO11552 exhibit good stability, with an average RMSD value of 4 to 4.5 mm. The RMSD values of molecules 17 (compound HO11553) and 67 (compound HO11552) are 0.639 and 0.565, respectively. According to the RMSD analysis, molecule 17 (compound HO11553) is more stable.

[0108] ② Root mean square fluctuation (RMSF)

[0109] RMSF can measure the fluctuation of each atom within 100 ns of simulation time Figure 6 , identify active residues, binding pockets and detailed interaction relationships. RMSF analysis shows that the average effective value of molecules 17 (compound HO11553) and 67 (compound HO11552) is 0.125 and 0.118, respectively. These regions may indicate changes in structural conformation and suggest potential active pockets.

[0110] Further analysis found and recorded amino acids with fluctuation values greater than 0.5 nm:

[0111] Molecule 17 (compound HO11553): residues 182-185

[0112] Molecule 67 (compound HO11552): residues 9, 19, 233

[0113] These amino acid residues around play an important role in the interaction with drug molecules, which have important effects on drug targeting, safety and drug resistance, etc.

[0114] ③Rotational coefficient (Rg) and soluble surface area (SASA) analysis:

[0115] In MD simulation and structural biology, Rg and SASA are very important parameters reflecting the structure of molecules and their interaction with the environment. Referring to Figure 7 As shown in the figure, Rg is used to represent the tightness of the molecule, the smaller the Rg value, the tighter the molecule, the average Rg values of molecules 17 (compound HO11553) and 67 (compound HO11552) are 2.411 and 2.352 nm respectively; SASA (surface area) mainly reflects the surface area of the molecule that can be contacted by the solvent, and a larger SASA value is a typical value of unfolded or partially folded protein. The results show that molecules 17 (compound HO11553) and 67 (compound HO11552) both show stable SASA fluctuations around 185 mm, and the SASA values of molecules 17 and 67 are 185.135 and 184.744 nm 2 .

[0116] ④Hydrogen bond analysis

[0117] The hbnum.xvg file shows the number of hydrogen bonds over time during the entire simulation, which reflects the dynamic nature of hydrogen bond formation and breaking. The higher the count, the stronger the interaction between the ligand and the protein, and the fluctuations indicate the existence of transient binding. In addition, the analysis also considers the formation of hydrogen bonds within a range of 0.35 nm, reflecting the geometric criteria for standard H-bond detection between donor atoms and acceptor atoms. This threshold ensures that classical hydrogen bonds and atom pairs with close interactions are identified. Figure 8 As shown in the figure, the average number of hydrogen bonds of molecules 17 (compound HO11553) and 67 (compound HO11552) is 0.388 and 2.153, and the diameter of molecules 17 (compound HO11553) and 67 (compound HO11552) at 0.35 nm is 0.373 and 1.687 respectively. These results show that molecules 17 (compound HO11553) and 67 (compound HO11552) have a closer relationship with the amino acids in the CCR2 pocket, and molecule 67 (compound HO11552) has a closer relationship with the amino acids in the CCR2 pocket.

[0118] ⑤Principal component analysis (PCA)

[0119] PCA is a dimension reduction technique used to find the lowest energy state of the system. The lowest point on the free energy profile represents the most likely stable conformation. During the course of the experiment, periodic boundary conditions were first removed, RMSD and Rg values were extracted on the same time scale, and the Gibbs free energy was obtained. As shown in Figure 9 Figure 3, it is shown that molecules 17 (compound HO11553) and 67 (compound HO11552) and other molecules all have their lowest potential energy.

[0120] ⑥Optimal molecular docking

[0121] In combination with the PCA technique to find the complex conformation corresponding to the lowest potential energy, the interaction between the protein and the ligand was analyzed, and it is shown in Figure 10 Figure 4 that the analysis shows that molecule 67 (compound HO11552) interacts with the following amino acids: val63, leu67, leu81, ala141, arg237, glu238, tyr305, lys311, phe312, ARG138, ALA241, VAL244 and TYR315. Molecule 17 (compound HO11553) interacts with the following amino acids: LY38, ALA42, LEU45, Ty49, TRP98, ALA102, Tyr120, HID121, VAL187, PRO192, GLN288, GLU291 and THR292.

[0122] In summary, based on molecular docking, MMPBSA, RMSD, RMSF, Rg, SASA and PCA analysis, it can be seen that molecule 17 (compound HO11553) in the inhibitor of the present application is associated with the external pocket of the CCR2 protein, and molecule 67 (compound HO11552) is associated with the internal pocket of the CCR2 protein, and the connection is tight. Therefore, the binding of molecule 17 (compound HO11553), molecule 67 (compound HO11552) and CCR2 protein is verified from the molecular level.

[0123] (5) Surface plasmon resonance (SPR test)

[0124] 5.1 Test principle: Surface plasmon resonance (SPR) can be used to detect molecular interactions based on the principle of physical optics. This method can detect molecular interactions with high sensitivity without the need for labeling. SPR uses light to mark the resonance wave generated by the plasma, and the evaporation wave in different media can be used to construct a biosensor to analyze the interaction between biological molecules and detect the interaction between ligands and analytes. Biosensor chip. In the experiment, one of the molecules to be measured is fixed on the surface of the chip, while the other molecule flows through the chip surface. The analyte interacts with the ligand, and when the molecules bind and dissociate, the resonance angle changes due to the interaction between the molecules. The mass of the chip surface, while the sensorgram records the signal value under the chip surface, and according to this change curve, the information of the intermolecular interaction. The experiment simulates the interaction between mouse CCR2 protein and substances, and detects the substances using surface plasmon resonance technology.

[0125] 5.2 Test process:

[0126] 5.2.1 Test samples are shown in Table 4.

[0127] Table 4 SPR test samples

[0128]

[0129] 5.2.2 Test method: Use amino coupling method for protein fixation, protein coupling: 1.0x PBS-P+ (pH 7.4); interaction: 1.x PBS-P+ (pH 7.4), 5% (vv) dimethyl sulfoxide.

[0130] a. Protein coupling: (1) Place the running buffer (200 microliters of 1x PBS buffer), water bottle, and waste bottle into the left and right trays, respectively, and then insert them into the corresponding paper feeders.

[0131] (2) Hold the CM5 chip with the letters facing up. Push the chip into the slot in the direction of the arrow on the chip, then take the chip out, and finally close the hatch of the chip compartment.

[0132] (3) The chip channel is activated with 1-ethy1-3-(3-dimethylaminopropy1) carbodiimide (EDC, GE Healthcare) and N-hydroxysuccinimide (NHS, GE Healthcare) at a flow rate of 10 microliters per minute.

[0133] (4) Dilute the ligand protein with sodium acetate to 50 pg / m1 protein and fix it on the chip in 4 channels at a flow rate of 10 microliters per minute to generate a coupling graph.

[0134] (5) Block the channel with ethanolamine at a flow rate of 10 uL / min.

[0135] (6) Repeat steps (3) to (5) with the exception that in step (4) a protein-free acetate buffer is used.

[0136] b. Protein interaction test with the substance to be tested

[0137] The 5% DMSO concentration calibration curve was configured and calibrated using the 4.5% and 5.8% stock batches in Table 5.

[0138] Table 5 Solution calibration solution configuration table

[0139]

[0140] c. Determine the substance to be measured

[0141] (1) Dilute each substance to be tested into several concentrations in a 96-well plate and couple the target protein from low to high concentration by microarray. The flow rate is 30 microliters / min, and the duration is 150 seconds.

[0142] (2) After each concentration point flows, the chip is washed with 10 mM glycine hydrochloride (pH 2.0) solution for 5 minutes, and then the process is repeated until all the corresponding concentrations of the substances to be tested have been measured.

[0143] (3) The association constant and dissociation constant are obtained by globally fitting the data using Biacore Insight Evaluation software (Cytiva, Marlborough, MA, USA) to convert them into a 1:1 Langmuir binding model.

[0144] 5.3 Results analysis

[0145] 5.3.1 Mouse CCR2 protein coupling

[0146] The mouse CCR2 protein coupling graph is shown in Figure 11 , which shows that the mouse CCR2 protein reaches a total of 5890 RU.

[0147] 5.3.2 Affinity determination results

[0148] The purpose of this experiment is to determine the affinity of the substance to be tested. The CM5 chip is used to couple the protein to detect the substance that interacts with the mouse CCR2 protein. The detection results are shown in Table 6:

[0149] Table 6 Results of detecting mouse CCR2 protein

[0150]

[0151]

[0152] Wherein: KD: dissociation constant (dissociation), reflects the affinity of the chemical, the smaller the affinity value, the stronger the affinity; Ka: association rate constant (association rate constant), indicates the intermolecular binding, the larger the value, the faster the binding; Kd: dissociation rate constant (dissociation rate constant), the value is larger, the faster the dissociation speed.

[0153] When the mouse was injected with drug 17 (compound HO11553) alone, the interaction test results of mouse CCR2 protein and drug 17 (compound HO11553) were as shown in Figure 12 The results showed that CCR2 had strong affinity for small molecule 17, and increased with the increase of concentration. When the mouse was injected with drug 17 (compound HO11553) alone, drug 67 (compound HO11552) alone, and drug 17 (compound HO11553) and drug 67 (compound HO11552) at the same time, the results showed that the affinity of combined injection of drug 17 (compound HO11553) and drug 67 (compound HO11552) was better than that of injection of drug 17 (compound HO11553) or drug 67 (compound HO11552) alone.

[0154] (VI) Cell experiment

[0155] Experimental method: 2000 cells were seeded in a 96-well plate, and TGF-β (10 ng / ml) was used to induce lung cancer A549 cells for 48 hours to construct a lung fibrosis cell model; then, drug 17 (compound HO11553) and 67 (compound HO11552) were added to the lung fibrosis cells; the drugs were dissolved in DMSO, diluted in 1640 medium, and administered at concentrations of 0, 1, 1.25, 2.5, 5, 10, 25, 50, and 100 umol). After 48 hours of drug treatment, 10% volume (10 ul) of CCK8 reagent was added to each well, and the 96-well plate was incubated in the dark for 3 hours in the incubator. Finally, the absorbance was measured at 450 nm wavelength using a microplate reader to determine the cell viability.

[0156] The results are shown in Figure 14 and Figure 15 Drug 17 (compound HO11553) and drug 67 (compound HO11552) can inhibit TGF-β-induced lung fibrosis cell proliferation, and the 48-hour cell inhibition rate is higher with the increase of drug concentration.

[0157] The above illustrates the idiopathic pulmonary fibrosis molecular inhibitor of the present application, which targets G protein-coupled receptor CCR2, and the molecular inhibitor is a dual-pocket inhibitor capable of binding to the orthosteric binding site and the allosteric binding site of CCR2, respectively, and the molecular inhibitor is capable of slowing the progression of pulmonary fibrosis by inhibiting CCR2.

[0158] The above shows and describes the basic principles, main features and advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above-mentioned embodiments, and the above-mentioned embodiments and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.

Claims

1. The use of compounds HO11553 and / or HO11552 in the preparation of inhibitors for idiopathic pulmonary fibrosis, wherein the molecular structural formula of compound HO11553 is: Formula I; The molecular structural formula of the compound HO11552 is: Formula II.

2. Use according to claim 1, wherein The compound HO11553 is replaced with compound HO11553-TM; compound HO11553-TM is a hydrochloride salt of compound HO11553; The molecular structural formula of compound HO11553-TM is: Formula III.

3. The use according to claim 1, wherein the compound is ###0002### The inhibitor also includes a pharmaceutically acceptable carrier, adjuvant.

4. The use according to claim 1, wherein The inhibitor targets a G protein-coupled receptor CCR2.

5. The use according to claim 4, wherein the compound is ###0002### The inhibitor inhibits a G protein-coupled receptor CCR2 through a PI3K Calss IB pathway. The inhibitor inhibits a G protein-coupled receptor CCR2 through a PI3K Calss IB pathway.

Images