Application of OsbZIP40 protein or coding gene thereof in regulation and control of germination time of rice seeds

By knocking out the OsbZIP40 gene of rice and editing the gene sequence using CRISPR/Cas9 technology, it significantly promotes rice seed germination and improves seed emergence order, solving the problems of slow germination and uneven germination in rice live seeds, achieving faster germination rate and higher seed emergence order.

CN120118167AActive Publication Date: 2025-06-10YANGZHOU UNIV

Patent Information

Application Number
CN202510497158.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-21
Publication Date
2025-06-10
Estimated Expiration
2045-04-21

AI Technical Summary

Technical Problem

During the live rice seeds, the germination of seeds is slow and the germination is not neat, which limits the application of live streaming technology and the efficiency of mechanized production.

Method used

By knocking out the OsbZIP40 gene in rice, and using CRISPR/Cas9 technology to edit the gene sequence, it significantly promotes rice seed germination and improves seedling neatness.

Benefits of technology

The successfully obtained OsbZIP40 gene knockout mutant seeds have faster germination and high neatness of seed emergence, which solves the problems of slow germination and uneven germination in rice live sowing, and provides excellent genetic resources for rice live sowing production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118167A_ABST
    Figure CN120118167A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to application of OsbZIP40 protein or a coding gene thereof in regulation and control of rice seed germination time, rice osbzip40 mutants as shown in nucleotide sequences SEQ ID NO.8 and SEQ ID NO.9 are obtained by performing targeted editing on a target site sequence, as shown in SEQ ID NO.3, in an OsbZIP40 gene through a CRISPR / Cas9 technology, and the rice seed germination rate can be effectively and rapidly increased. According to the gene and the genetic engineering technical means provided by the invention, important gene resources are provided for solving the problems of slow seed germination, irregular germination and the like in the direct seeding process of rice, and the gene has a relatively wide application prospect in agricultural production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the application of OsbZIP40 protein or its coding gene in regulating the germination time of rice seeds, belonging to the technical fields of biotechnology and plant genetic engineering. Background Art

[0002] As one of the main food crops in China, rice supports the food needs of more than half of the population, and its yield is of strategic significance for national food security. Against the backdrop of economic transformation, the continuous rise in agricultural labor costs coupled with the intensification of population aging have led to severe challenges for traditional planting models, and there is an urgent need for mechanized production. The rice direct seeding technology has been rapidly promoted due to its simple operation and adaptability to mechanized operations. The germination ability and speed of seeds directly determine the uniformity and neatness of rice direct seeding emergence, becoming one of the key factors restricting the application of direct seeding technology. Therefore, exploring and utilizing key genes controlling rice seed germination has important scientific value and practical significance for improving the adaptability of varieties to direct seeding, reducing the intensity of manual input, and ensuring stable and high-yield rice production.

[0003] Transcription factors play important roles in the process of seed germination. Basic leucine zipper (bZIP) transcription factors are one of the most conserved and largest families in eukaryotes. Family members are widely involved in physiological processes such as plant growth and development, floral transition, environmental signal transduction, and stress response, and are closely related to seed germination. Rice OsbZIP40 has been confirmed to be involved in regulating rice flowering and drought resistance, but its function in seed germination has not been reported. Therefore, in-depth exploration of the effects of the OsbZIP40 gene and its encoded protein on seed germination helps to achieve precise regulation of rice seed germination and provides strong theoretical support and technical guarantee for rice direct seeding production. Summary of the Invention

[0004] Object of the Invention: The object of the present invention is to provide the application of OsbZIP40 protein or its coding gene in regulating the germination of rice seeds.

[0005] Technical Solution: The present invention provides the application of OsbZIP40 protein in regulating the germination of rice seeds, and the amino acid sequence of the rice OsbZIP40 protein is as shown in SEQ ID NO.2.

[0006] SEQ ID NO.2: MASSRVMAAAAASSSSSPPPPPPAAAAAGGAADLARFRSTSSGI GSMNMDDILRNIYGEAAPPPGAAGSAPAPPPAGEAAGAPVAEVAARRTAEEVWKEISSSGGLSAPAPAPAAGAAGRGGGPEMTLEDFLAREDDPRATAVEGNMVVGFPNVTEGVGTAGGGRGGGGGGRGRKRTLMDPADRAAMQRQKRMIKNRESAARSRERKQAYIAELEAQVAELEEEHAQLLREQEEKNQKRLKEIKEQAVAVVIRKKTQDLRRTNSMEW。

[0007] The present invention also provides the application of the gene encoding the above-mentioned OsbZIP40 protein in regulating rice seed germination, and the nucleotide sequence of the gene is as shown in SEQ ID NO.1.

[0008]

[0009] Furthermore, the application is to enhance the germination rate of rice seeds by knocking out the OsbZIP40 gene.

[0010] Furthermore, the application also includes improving the uniformity of rice seedling emergence.

[0011] A method for obtaining rice seeds with a fast germination rate, comprising: genetically transforming rice with the constructed OsbZIP40 gene knockout vector, and after obtaining the regenerated plants, identifying the successfully knocked-out OsbZIP40 homozygous lines by sequencing.

[0012] Furthermore, the OsbZIP40 gene knockout vector targets the nucleotide sequence shown in SEQ ID NO.3.

[0013] Furthermore, the primer sequences for target gene knockout are as shown in SEQ ID NO.4-5.

[0014] Furthermore, the primer sequences for identifying rice after genetic transformation are as shown in SEQ ID NO.6 and SEQ ID NO.7.

[0015] Furthermore, the two rice OsbZIP40 mutant lines obtained after genetic transformation showed a faster seed germination rate, and their gene nucleotide sequences are as shown in SEQ ID NO.8 or 9.

[0016]

[0017]

[0018] Furthermore, the rice variety used for genetic transformation is Nipponbare.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: The present application for the first time discloses that the rice OsbZIP40 gene plays an important role in regulating rice seed germination, and the OsbZIP40 gene and its encoded protein can regulate rice seed germination. By targeting and editing the gene sequence, the present invention can significantly promote rice seed germination and improve the uniformity of seedling emergence, providing excellent gene resources for solving problems such as slow seed germination and uneven germination during direct seeding of rice, and having a relatively broad application prospect in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a schematic diagram of the mutation types and amino acid changes of the osbzip40-1 and osbzip40-2 mutation types obtained by CRISPR / Cas9 editing of OsbZIP40 under the genetic background of Nipponbare;

[0021] Figure 2 It is a physical picture of the osbzip40-1 and osbzip40-2 mutants and their wild-type seeds at 84 h of germination under the genetic background of Nipponbare;

[0022] Figure 3 It is a statistical result chart of the germination rates of the osbzip40-1 and osbzip40-2 mutants and their wild-type seeds under the genetic background of Nipponbare. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0024] Example 1: Construction of an OsbZIP40 gene knockout vector and acquisition of rice gene knockout plants

[0025] Step 1. Design of target primers: The MSU_Locus of the OsbZIP40 gene was submitted to the CRISPR-GE online website. In the first exon region of this gene, a sequence with high knockout efficiency and good specificity (SEQ ID NO.3: GGCGTCGTCGAGGGTGATGG) was selected, and a pair of target primers was designed accordingly. Among them, the forward primer F1 and the reverse primer R1 form a pair of target primers, and their sequences are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively:

[0026] Forward primer F1: 5'ggcaGGCGTCGTCGAGGGTGATGG 3'

[0027] Reverse primer R1: 5' aaacCCATCACCCTCGACGACGCC 3'

[0028] Step 2, Primer annealing and adapter ligation: Take 20 μl each of forward primer F1 and reverse primer R1 with a concentration of 100 μM, add them to a centrifuge tube and mix well. Place them in an environment at 100 °C for 5 min for denaturation, and then cool naturally at room temperature to complete primer annealing.

[0029] As Figure 1 shown, ligate the above annealed targeting adapter to the intermediate vector SKm-gRNA digested with AarI (provided by Wang Kejian of China National Rice Research Institute) to obtain the ligation product SKm-gRNA-Target. PCR program: 22 °C for 30 min, 4 °C for 2 min; The PCR reaction system is as follows:

[0030]

[0031] Step 3, Transformation of Escherichia coli: Transform the ligation product into Escherichia coli DH5α competent cells. The specific operation steps are as follows:

[0032] (1) Add all the ligation products obtained in Step 2 to Escherichia coli DH5α competent cells. By gently flicking the bottom of the tube with fingers, make the ligation products and competent cells fully mixed, and then let them stand on ice for 5 min;

[0033] (2) Place the mixture in an environment at 42 °C for heat shock for 45 s. After the heat shock ends, quickly transfer it to ice and place it for 2 min;

[0034] (3) Add 500 μl of LB liquid medium to the mixture and incubate it at 37 °C and 220 rpm for 20 min;

[0035] (4) Uniformly spread the treated Escherichia coli on a solid LB medium containing 50 μg / ml ampicillin resistance.

[0036] Step 4, Screening of positive clones: Pick monoclonal colonies from the above solid LB medium and inoculate them into about 5 ml of LB liquid medium containing 50 μg / ml ampicillin. Incubate them at 37 °C and 220 rpm for about 12 h. After the incubation ends, extract the plasmid according to the operation method of Vazyme (DC201) plasmid extraction kit. Sequence the extracted plasmid using the universal primer M13R or T7, and select the plasmid with correct sequencing results for the construction of the subsequent final vector.

[0037] Step 5. Final vector construction and preservation: Digest the positive SKm-gRNA-Targe with correct sequencing alignment using KpnI / SalI, and at the same time digest the final vector pC1300-Cas9 (provided by Wang Kejian of China National Rice Research Institute) with KpnI / BamHI. After digestion, recover the digested fragments by gel extraction according to the method of Vazyme Gel Extraction Kit. Ligate the recovered SKm-gRNA-Target fragment to the digested final vector pC1300-Cas9, and then transform Escherichia coli DH5α competent cells again. Pick monoclonal colonies for plasmid extraction and sequence them using the universal primers M13R and M13F. Name the plasmid with correct sequencing as OsbZIP40-Cas9 and send it to Hangzhou Baige Biotechnology Co., Ltd. for genetic transformation (background of Nipponbare).

[0038] Example 2: Identification of OsbZIP40 homozygous mutant plants

[0039] In this example, the japonica rice variety Nipponbare was used as the experimental material.

[0040] Step 1. Genomic DNA extraction of T0 transgenic rice plants: Take the T0 transgenic rice plants obtained in Example 1 for genomic DNA extraction.

[0041] Step 2. Sequence detection of the target sequence of transgenic plants: Using the crude DNA as a template, refer to the product manual of Vazyme's 2XTaq Master Mix (P112-03-AA), and perform PCR amplification using the identification primers F2 and R2, whose sequences are shown in SEQ ID NO.6 and SEQ ID NO.7 respectively. Send the amplified PCR product to Tsingke Biotechnology Co., Ltd. for sequencing. The sequences of the identification primers are as follows:

[0042] F2: 5'CTCGCAAAAACACAAAAGCA 3'

[0043] R2: 5'TAGGGAACCCCACAACCATA3'

[0044] PCR program: 95℃ for 3 min, {95℃ for 30 s; 60℃ for 45 s, 72℃ for 30 s} - 35 cycles, 72℃ for 5 min, 4℃ for 2 min; and the amplification system is as follows:

[0045]

[0046]

[0047] After sequence alignment and screening, two homozygous mutants were successfully obtained, named osbzip40-1 and osbzip40-2, respectively. The nucleotide sequence of osbzip40-1 is shown in SEQ ID NO.8, with base A inserted at the target site, and the nucleotide sequence of osbzip40-2 is shown in SEQ ID NO.9, with base A deleted at the target site. Both homozygous mutant lines caused frameshift mutations, ultimately resulting in premature termination of the encoded protein (see Figure 1 ).

[0048] Example 3: Phenotypic analysis of OsbZIP40 homozygous mutants - transgenic plant seed germination analysis experiment

[0049] After dehulling the seeds of wild-type rice plants WT, OsbZIP40 gene knockout mutant plants osbzip40-1 and osbzip40-2, they were placed in a transparent round petri dish covered with two layers of wet filter paper and cultured in the dark in an incubator at 28°C. The experiment was set with 4 biological replicates, and 50 rice seeds were selected for each replicate. Every 12 hours, the seed germination was observed and counted based on the criterion that the plumule completely broke through the seed coat, and the germination rate was calculated according to the formula "germination rate = number of germinated seeds / total number × 100%". The experimental results at 84 h of seed germination (see Figure 2 ) showed that compared with the wild type, the seed germination rate of the OsbZIP40 gene knockout mutant lines was faster. In addition, the mutant seeds had a higher germination rate and a more uniform germination process in the early stage of germination (see Figure 3 ).

[0050] In this invention, by editing the OsbZIP40 gene in the rice variety Nipponbare, two homozygous mutants, osbzip40-1 and osbzip40-2, were successfully obtained. The investigation of the seed germination rate of the wild type and mutants showed that the mutant seeds had a fast germination rate and a high emergence uniformity, fully proving that the OsbZIP40 gene is involved in regulating the rice seed germination process and belongs to a rice germination-related gene. The results of this invention provide excellent gene resources for solving problems such as slow seed germination and uneven germination during the direct seeding of rice.

Claims

1. Application of OsbZIP40 protein in regulating rice seed germination, characterized in that: The amino acid sequence of the rice OsbZIP40 protein is shown in SEQ ID NO.

2.

2. Use of the gene encoding the OsbZIP40 protein according to claim 1 in regulating rice seed germination, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The use according to claim 1 or 2, characterized in that: The application is to improve the germination rate of rice seeds by targeted knockout of the OsbZIP40 gene.

4. The use according to claim 1 or 2, characterized in that: The application also includes improving the uniformity of rice seedling emergence.

5. A method for improving the germination rate of rice seeds, characterized in that: include: The constructed OsbZIP40 gene knockout vector was used for genetic transformation of rice, and after obtaining regenerated plants, homozygous strains with successful OsbZIP40 knockout were identified by sequencing.

6. The method according to claim 5, characterized in that The OsbZIP40 gene knockout vector takes the nucleotide sequence shown in SEQ ID NO.3 as a target.

7. The method according to claim 6, characterized in that The primer sequences used for target knockout are shown in SEQ ID NOs. 4-5.

8. The method according to claim 5, characterized in that The primer sequences used to identify genetically transformed rice are shown in SEQ ID NO.6 and SEQ ID NO.

7.

9. The method according to claim 5, characterized in that The two rice OsbZIP40 mutant lines obtained after genetic transformation showed a faster seed germination rate, and the gene nucleotide sequences thereof are shown in SEQ ID NO. 8 or 9.

10. The method according to any one of claims 5 to 9, characterized in that: The rice variety used for genetic transformation was Nipponbare.

Citation Information

Patent Citations

  • Application of OsABF1 gene in rice breeding regulation and / or rice seed viability mechanism research

    CN113699177A

  • Rice transcription factor OsbZIP13 and application of coding sequence thereof

    CN116590337A

  • Application of transcription factor OsbZIP05 in negative regulation of rice seed vigor

    CN118272423A

  • Overexpression of ABI5 in plants to prevent precocious seed germination and to confer resistance to drought and high salt

    US20020174454A1

  • AU2006308436A1

Cited By

  • Application of SG19 gene in regulation and control of rice seed germination

    CN121046443A

  • Application of sg19 gene in regulating rice seed germination

    CN121046443B