Spore-free oyster mushroom strain as well as breeding method and application thereof

Abstract

The invention discloses a spore-free oyster mushroom strain 3H02F79 and a breeding method thereof, and relates to the technical field of edible mushrooms and molecular marker-assisted breeding. The preservation number of the 3H02F79 strain provided by the invention is CCTCC NO: M 2025718, all agronomic trait indexes of the 3H02F79 strain are superior to those of a spore-free parent QHP315, the sporulation trait is spore-free, and the yield is improved by 18.18% compared with that of the spore-free parent QHP315; compared with a commercial spore parent P2101, the damage caused by spore release is solved, and no significant difference exists in the aspects of mycelial growth rate, yield and the like. Compared with two parents, the strain 3H02F79 has the lowest pollution rate and the shortest tide turning time. Meanwhile, plot and enlargement tests prove that the fruiting rate of the 3H02F79 strain is 100%, the 3H02F79 strain is stable in character, phenotypes are highly consistent in different plot tests, and the 3H02F79 strain is a factory-like spore-free cultivated variety with great potential.

Description

Technical Field

[0001] The present invention relates to the technical field of edible fungi and molecular marker-assisted breeding, and specifically relates to a sporeless Pleurotus ostreatus strain and its breeding method and application. Background Art

[0002] As one of the edible fungi widely cultivated globally, Pleurotus ostreatus occupies an important position in the agricultural industry by virtue of its unique biological characteristics and economic value: Pleurotus ostreatus has thick and tender flesh, is rich in nutrition and delicious in taste, and has important edible and medicinal values. Long-term consumption of Pleurotus ostreatus can enhance the body's defense ability and regulate metabolism, blood pressure, etc.

[0003] Despite the large scale of the Pleurotus ostreatus industry, its variety breeding still faces severe challenges: (1) Narrow genetic background: The genetic similarity of the main cultivated varieties is >80%, with serious homogenization and limited room for improvement in stress resistance and adaptability; (2) Hazard of spore release: Traditional varieties release a huge amount of spores (about 1.5 million spores are released per minute by a single fruiting body), resulting in health risks for mushroom farmers and production environment problems; (3) Currently, cultivated varieties face problems such as loss of genetic ability, strain degeneration, and weakened stress resistance; (4) The cost of imported strains is high.

[0004] The breeding of sporeless Pleurotus ostreatus varieties can reduce spore release, significantly reduce the incidence of occupational diseases and pests, improve the cultivation environment, and remove the erosion of spores on ventilation ducts and refrigeration equipment; moreover, the sporeless trait can reduce the risk of strain degeneration caused by spore contamination and adapt to the factoryized and intensive production mode. High-quality seed sources are the core restricting industrial development. In view of the problems in the Pleurotus ostreatus industry, it has become an urgent task to breed strain varieties with excellent quality characteristics, high productivity, and strong adaptability. Summary of the Invention

[0005] The present invention provides a sporeless Pleurotus ostreatus strain 3H02F79 and its breeding method and application.

[0006] The present invention adopts the following technical solutions:

[0007] A sporeless Pleurotus ostreatus strain 3H02F79, the Pleurotus ostreatus strain 3H02F79 was deposited at the China Center for Type Culture Collection on April 7, 2025. The deposit address is Wuhan, China, and the deposit number is CCTCC NO: M 2025718, and the taxonomic name is Pleurotus ostreatus 3H02F79.

[0008] Another object of the present invention is to provide a Pleurotus ostreatus mycelium and / or fruiting body, which is obtained by the growth and development of the above sporeless Pleurotus ostreatus strain 3H02F79.

[0009] Another object of the present invention is to provide an application of the above-mentioned sporeless Pleurotus ostreatus strain, or the above-mentioned mycelium and / or fruiting body, and the application is at least one of the following:

[0010] A. Application as a parent in cross-breeding;

[0011] B. Strain propagation;

[0012] C. Fruiting body production;

[0013] D. Food processing.

[0014] Another object of the present invention is to provide a primer combination for detecting different karyotypes of the protoplasts of the Pleurotus ostreatus strain, and the primer combination includes the sequences shown in SEQ ID NO.1-SEQ ID NO.4.

[0015] Another object of the present invention is to provide a primer combination for detecting the relative mating type of the Pleurotus ostreatus strain, and the primer combination includes the sequences shown in SEQ ID NO.7-SEQ ID NO.10.

[0016] Another object of the present invention is to provide an application of the above primer combination in Pleurotus ostreatus variety identification and / or Pleurotus ostreatus breeding.

[0017] Another object of the present invention is to provide a cultivation method for the above-mentioned sporeless Pleurotus ostreatus strain 3H02F79, including the following steps:

[0018] S1: Activate and culture the strain 3H02F79 on a PDA slant medium to prepare a PDA slant;

[0019] S2: Inoculate the PDA slant into the branch spawn culture medium to prepare branch spawn;

[0020] S3: Inoculate the branch spawn into the cultivation bag culture medium, place it in a room at 25°C in the dark for cultivation, with a relative air humidity of 60%-70% and a carbon dioxide concentration of less than 0.3%. After the mycelium fills the cultivation bag, fruiting occurs;

[0021] The fruiting temperature is 8-16°C, the relative air humidity is more than 95%, the light intensity is 100-300 lx, and the carbon dioxide concentration is less than 0.1%.

[0022] Preferably, the PDA slant medium is: 200 g of potato, 20 g of glucose, 1 L of water, and the pH is natural;

[0023] The branch spawn culture medium is: 89% of wood branches, 10% of wheat bran, 1% of gypsum, and the water content is 60%-65%;

[0024] The culture medium of the cultivation bag is as follows: cottonseed hull 30%, corncob 48%, wheat bran 18%, soybean meal 2%, gypsum 1%, lime 1%, and water content 63%.

[0025] Another object of the present invention is to provide a method for breeding the sporeless Pleurotus ostreatus strain, comprising the following steps:

[0026] S1: Prepare protoplast monokaryons from the spore-producing parent P2101 and the sporeless parent QHP315, and use the above primer combinations for detecting different karyotypes of Pleurotus ostreatus strain protoplasts to distinguish different karyotypes of the parent protoplasts, and obtain two protoplast monokaryons of each;

[0027] S2: Conduct a complete diallel cross with the obtained monokaryons, infer the relative mating types between the two parents according to whether they are compatible, and use the above primer combinations for detecting the relative mating types of Pleurotus ostreatus strain to distinguish the relative mating types between the two parents;

[0028] S3: Hybridize one of the monokaryons of the parent QHP315 that is compatible with both of the two protoplast monokaryons of the parent P2101 respectively to obtain two kinds of hybrids, cultivate the two kinds of hybrids to produce mushrooms, and collect spores;

[0029] S4: Conduct single spore isolation on the spores collected in step S3, remove the dikaryotic strains with clamp connections by microscopy, then remove the monokaryotic strains that do not carry the sporeless locus through the primer combinations shown in SEQ ID NO.13 - SEQ ID NO.15, and finally conduct mating type identification on all the monokaryotic strains carrying the sporeless locus through the primer combinations shown in SEQ ID NO.7 - SEQ ID NO.10, so as to obtain two spore monokaryon populations that carry the sporeless locus and have the same mating type as the P2101 protoplast;

[0030] S5: Conduct a second cross on the above two spore monokaryon populations to obtain a hybrid population that carries a homozygous sporeless locus and is closest to P2101, and screen the population for mushroom production to obtain a sporeless and high-yield Pleurotus ostreatus strain.

[0031] Beneficial effects:

[0032] Compared with traditional breeding methods, the breeding method of this sporeless Pleurotus ostreatus strain can early identify sporeless genotypes based on InDel markers, with the screening efficiency increased by at least 50%, avoiding the blindness of phenotypic screening. Through molecular marker-assisted hybridization, the period for introducing sporeless traits into excellent varieties is shortened from 4 - 6 years to 2 - 3 years. In addition, the identification of monokaryons usually relies on microscopic examination to confirm the presence of clamp connections, while identifying the mating type of monokaryons requires a large amount of pairing and microscopic examination work, and the workload increases with the increase in the number of monokaryotic populations. Multiple rounds of mating usually take about 2 months and are prone to misdetection due to human factors. However, mating type molecular markers have greatly accelerated this process, and multiple sporeless Pleurotus ostreatus strains with excellent agronomic traits can be bred.

[0033] The present invention provides a sporeless Pleurotus ostreatus strain 3H02F79 and its breeding method. All agronomic trait indicators of the 3H02F79 strain are superior to those of the sporeless parent QHP315. Its spore-producing trait shows sporelessness, and the yield is increased by 18.18% compared with the sporeless parent QHP315. Compared with the commercial spore-bearing parent P2101, it solves the harm of spore release, and there are no significant differences in terms of mycelial growth rate, yield, etc. Compared with the two parents, the 3H02F79 strain has the lowest contamination rate and the shortest turning period. At the same time, through plot and scale-up tests, it is proved that the fruiting rate of the 3H02F79 strain is 100%, the traits are stable, and the phenotypes in different plot tests are highly consistent. It is a highly potential strain for industrialized sporeless cultivation. The present invention is of great significance for enriching the categories in the edible mushroom market, improving the competitiveness of edible mushroom enterprises, and promoting the development of the edible mushroom industry. Brief Description of the Drawings

[0034] Figure 1 It is the breeding roadmap of the sporeless Pleurotus ostreatus strain 3H02F79.

[0035] Figure 2 It is the result of differentiating different karyotypes of parental protoplasts by molecular markers PO1A2 and PO1B2. Among them, A is the PCR amplification result of molecular marker PO1A2, B is the PCR amplification result of molecular marker PO1B2, M is the molecular weight Marker DL2000, and the molecular weights of the three bands shown in the figure are 100 bp, 250 bp, and 500 bp from bottom to top.

[0036] Figure 3The genotyping results of the parental strains P2101 and QHP315 using the molecular markers PO2A1 and PO2B1. Among them, A is the genotyping result of the parental strains P2101 and QHP315 using the molecular marker PO2A1 at the mating type A locus; B is the genotyping result of the parental strains P2101 and QHP315 using the molecular marker PO2B1 at the mating type B locus; M in the figure is the molecular weight Marker DL2000, and the molecular weights of the two bands shown in the figure are 100 bp and 250 bp from bottom to top.

[0037] Figure 4 Morphological diagram of the fruiting body of the non-sporulating strain 3H02F79.

[0038] Figure 5 Morphological diagram of the fruiting body of the spore-producing parent P2101.

[0039] Figure 6 Morphological diagram of the fruiting body of the non-sporulating parent QHP315. Detailed implementation manners

[0040] The technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0041] Example 1

[0042] Breeding of the non-sporulating Pleurotus ostreatus strain 3H02F79 (see Figure 1 )

[0043] (1) Parental strains: The spore-producing parent P2101 and the non-sporulating parent QHP315.

[0044] The strains 'P2101' and 'QHP315' are the strains that have been publicly preserved in the patent literature with the publication number CN118460784B and the invention name: A molecular marker-assisted breeding method for identifying non-sporulating loci of Pleurotus ostreatus.

[0045] (2) Breeding method:

[0046] It includes the following steps:

[0047] ① Protoplast mononucleation and mating type identification

[0048] The test strains P2101 and QHP315 were activated, and the strains were cultured by the 7-point inoculation method. They were enzymolyzed with 2% lysing enzyme for 30 min and made into a protoplast suspension with 0.6M mannitol. After gradient dilution, they were spread on the regeneration medium plate. After dark incubation at 25°C for a period of time, the protoplasts regenerated. Single colonies were isolated and transferred to the PDA solid medium plate and cultured under dark conditions at 25°C. Single colonies were picked out and purified.

[0049] The re-sequencing data of P2101 and QHP315 were aligned to the reference genome PC9.15 (GenBank: GCA_029852705.2). The mating type A locus was determined to be approximately located in the region of CM057205.1: 2530114-2544754 through the homologous domain genes hd1 and hd2 in the PC9.15 annotation information, as well as the positions of the closely related mip and beta-fg genes. The mating type B locus was determined to be approximately located in the region of CM057213.1: 1818424-1865476 through the positions of multiple pheromone receptor ste genes.

[0050] Variant sites obtained by aligning the two parents within 50 Kb upstream and downstream of the mating type A and B locus regions were screened. InDel variations among these variant sites were selected, and they were heterozygous in both strains P2101 and QHP315, with the inserted / deleted fragment being greater than or equal to 10 bp. Finally, one InDel variation at CM057205.1: 2587186 was selected for the mating type A locus, and one InDel variation at CM057213.1: 1852867 was selected for the mating type B locus. Primer3 was used for primer development upstream and downstream of these two variant sites, and two mating type molecular markers, PO1A2 and PO1B2, were obtained. Detection primers were designed respectively, PO1A2-F (5’-AATACTGCCCAGACGCTCAG-3’; SEQ ID NO.1) and PO1A2-R (5’-TCGAGCGGAGTCTTTGAGTC-3’; SEQID NO.2), PO1B2-F (5’-GCAGTCGGGTGGTCAAAT-3’; SEQ ID NO.3) and PO1B2-R (5’-AGTCGTTAAGCGCTCGTC-3’; SEQ ID NO.4). The predicted amplified fragment sizes of the two different genotypes of the molecular marker PO1A2 were 155 bp and 127 bp respectively; the predicted amplified fragment sizes of the two different genotypes of the molecular marker PO1B2 were 398 bp and 300 bp respectively.

[0051] The predicted amplified fragment sequence of PO1A2 is as follows:

[0052] AATACTGCCCAGACGCTCAGTCAGGACTCCGCAGACTGTCTGCGTTGAAGAGGACCAAAGAAAG AGGA ATGACCAAATTGCTCTTCAGTCTG GATGCCTCCTGGCTTCAGTCACGTGGTCTGTGGAGCCTAATGTGACTCAAAGACTCCGCTCGA, SEQ ID NO.5;

[0053] Among them, the underlined sequences are deletion fragments with a length of 28 bp. Therefore, the full length of the non-deleted sequence predicted to be amplified by PO1A2 is 155 bp, and the length of the deleted sequence is 127 bp. The actual amplification result is as shown in Figure 2 A in the figure, which is the PCR amplification result of the molecular marker PO1A2. The size of the actual amplified fragment is basically consistent with the prediction.

[0054] The predicted amplified fragment sequence of PO1B2 is as follows:

[0055] GCAGTCGGGTGGTCAAATCAAAAGACTCATATTTCATGGGCTTCTTCCGAGGTGTCAGACATTGGCGACACCGTATTGTCTTCGTTGTGAAACGTGTTCCTCCATTGCCCACTCCGAATTAGTCCCCTTTTCCCCATGTCTCGAGT CATTATATCAGACCCTCCTA CTAGTTTGTCCAAGAAAATAAGCATACATTGGTTTGAACGTTACTATGTATATTGATCAGAAGCCACTCTAACTGAAGTTTGAGATAGGAATGTTGTGCTTAAGGACGCGAGGGCGAGGTGGGGGAAAC G GCATAGAAGCGGGACAAGGACGTCGGCCAATCCCATGGTACGAACGGGGGAGGGATGTTGTCCCCTCACGTGTCTC C TTGCGTCGACGAGCGCTTAACGACT, SEQ ID NO.6;

[0056] Among them, the two underlined sequences are deletion fragments with lengths of 20 bp and 78 bp respectively. The full length of the non-deleted sequence predicted to be amplified by PO1B2 is 398 bp, and the length of the deleted sequence is 300 bp. The actual amplification result is as shown in Figure 2As shown in B, the PCR amplification result of the molecular marker PO1B2 is presented. In the actual amplified fragment, the missing band (less than 250 bp) is smaller than the predicted length (300 bp). Due to the presence of a large number of repetitive sequences at the mating B locus, some reads will have incorrect alignments during the re-sequencing data alignment, resulting in sequences being aligned at the originally missing fragment, causing the predicted length to be longer and the actual amplification result to be shorter. However, there is indeed an InDel variation at the marker development site. Although the amplification result differs from the predicted length, the amplification result does not affect the determination of the genotype.

[0057] Figure 2 In it, lanes 1 and 2 are respectively the protoplast mononucleates '3015pm-2' and '3015pm-302' of two different karyotypes of strain P2101, 3 is P2101, 4 is QHP315, and lanes 5 and 6 are respectively the protoplast mononucleates 'HPpm-1' and 'HPpm-93' of two different karyotypes of strain QHP315. It can be seen that the mating type molecular markers PO1A2 and PO1B2 can be used to distinguish the mating types of different karyotype protoplast mononucleates within strains P2101 and QHP315, but cannot distinguish the mating types between strains because the amplified fragment sizes of the two mating type loci of parents A and B are the same, such as Figure 2 in A, the sizes of strain 1 and strain 5 are the same, but strain 1 and strain 5 may not be of the same mating type.

[0058] ② Diallel cross and relative mating type identification between strains

[0059] The two protoplast mononuclear populations of each parent were subjected to a complete diallel cross, and the pairing compatibility results are shown in Table 1.

[0060] Table 1 Diallel cross results and mating type speculation between parental protoplast mononucleates

[0061]

[0062] In the naming of the relative mating types of two strains, usually the two different karyotypes of one strain are named A1B1 and A2B2. Here, 'HPpm-1' is named the A1B1 mating type and 'HPpm-93' is named the A2B2 mating type. Since '3015pm-302' is compatible with both 'HPpm-1' and 'HPpm-93', the mating type of '3015pm-302' can be named A3B3. '3015pm-2' is only compatible with 'HPpm-1' and not with 'HPpm-93', indicating that one of the A and B loci of the mating type of '3015pm-2' is the same as that of 'HPpm-93'. Therefore, the mating type of '3015pm-2' is A2B4 or A4B2. Combining Figure 2The amplification results showed that the amplification results of locus B of '3015pm-2' and 'HPpm-93' were the same, but the amplification results of locus A were different. Therefore, it was speculated that the mating type of '3015pm-2' was likely to be A4B2.

[0063] After obtaining the relative mating types between the strains, it was found that the molecular marker PO1A2 could not distinguish between A1 and A4, and between A2 and A3, and PO1B2 could not distinguish between B1 and B3. Therefore, in order to distinguish the hybrid offspring, another pair of molecular markers was developed. Similar to the development method of PO1A2 and PO1B2, the variant sites obtained by aligning two parents within 50 Kb upstream and downstream of the mating type A and B loci on the genome were listed. Similarly, InDel variations among these variant sites were selected, but the sites that were homozygous in both P2101 and QHP315 and P2101 and QHP315 were of opposite genotypes were chosen, and the inserted / deleted fragments were also greater than or equal to 10 bp. Finally, one InDel variation at CM057205.1: 2566488 was selected for the mating type A locus, and one InDel variation at CM057213.1: 1829569 was selected for the mating type B locus. Primer3 was used to develop primers upstream and downstream of these two variations, resulting in two molecular markers, PO2A1 and PO2B1. The predicted amplified fragment sizes of the two different genotypes of PO2A1 were 175 bp and 165 bp respectively; the predicted amplified fragment sizes of the two different genotypes of PO2B1 were 161 bp and 134 bp respectively.

[0064] Detection primers for PO2A1:

[0065] PO2A1-F: 5’-CCCAATCTACATGCTGGGCT-3’; SEQ ID NO.7;

[0066] PO2A1-R: 5’-ATGGTGGCTTGCGAAGTGTA-3’; SEQ ID NO.8.

[0067] Detection primers for PO2B1:

[0068] PO2B1-F: 5’-CAACCAAGCCTGAGCCAACT-3’; SEQ ID NO.9;

[0069] PO2B1-R: 5’-TAGGAGATGCGATGGAGCGT-3’; SEQ ID NO.10.

[0070] The predicted amplified fragment sequences of PO2A1 are as follows:

[0071] CCCAATCTACATGCTGGGCTTGAGCTGGGCTAGAGGGTAGAACTCCGTGGATTTCTTTGGTG CAGGCG CTG CCCAAATGCGGTCGTGCCTGTGACTGTCACGTGATGTGATGGCACGCGATTGTGACTAATTGTGGCGCCGTGACTTGCCTTTGTACACTTCGCAAGCCACCAT, SEQ ID NO.11;

[0072] Among them, the underlined sequence is the deleted fragment with a length of 10 bp. Therefore, the full length of the non-deleted sequence predicted to be amplified by PO2A1 is 175 bp, and the length of the deleted sequence is 165 bp. The actual amplification result is as shown in Figure 3 A in the figure, which is the PCR amplification result of the molecular marker PO2A1, and the size of the actual amplified fragment is basically consistent with the prediction.

[0073] The predicted amplified fragment sequence of PO2B1 is as follows:

[0074] CAACCAAGCCTGAGCCAACTTGCAACACACGCCCCCAACTGGTCCGTCTCATCATACTACTAACTAGCTAGTACTACGGAC GTCGTCGAGCCTGGCGAAGGTCTTGCT CCTCTGAGTCTGCACCTTTCTGCCGTCACGCGCACGCTCCATCGCATCTCCTA, SEQ ID NO.12;

[0075] Among them, the underlined sequence is the deleted fragment with a length of 27 bp. The full length of the non-deleted sequence predicted to be amplified by PO2B1 is 161 bp, and the length of the deleted sequence is 134 bp. The actual amplification result is as shown in Figure 3 B in the figure, which is the PCR amplification result of the molecular marker PO2B1, and the size of the actual amplified fragment is basically consistent with the prediction.

[0076] The parental lines P2101 and QHP315 were identified using the detection primers of PO2A1 and PO2B1, and the results are as shown in Figure 3As shown in the figure, in Figure A, the identification results of the molecular marker PO2A1 at the mating type A locus for the parents P2101 and QHP315 are presented. Band 1 is the same band for the A3 and A4 mating types of P2101, and band 2 is the same band for the A1 and A2 mating types of QHP315. Therefore, A1 and A4, as well as A2 and A3, can be distinguished by this marker. In Figure B, the identification results of the molecular marker PO2B1 at the mating type B locus for the parents P2101 and QHP315 are shown. Band 1 is the same band for the B2 and B3 mating types of P2101, and band 2 is the same band for the B1 and B2 of QHP315. Thus, B1 and B2, as well as B2 of P2101 and B3 of QHP315, can be distinguished by this marker. M is the molecular weight Marker DL2000. The molecular weights of the two bands shown in the figure are 100 bp and 250 bp from bottom to top, respectively, and the amplified band sizes are consistent with the predicted amplified product sizes of the two molecular markers PO2A1 and PO2B1. The mating types of the hybrid offspring of the two parents can be distinguished using the mating type molecular markers PO1A2 and PO1B2.

[0077] ③ Construction of first-generation hybrid strains

[0078] One of the protoplast monokaryons 'HPpm-1' of QHP315 (the mononuclear mating type A1B1 of which is compatible with both protoplast monokaryons of 'P2101') was hybridized with the two protoplast monokaryons of P2101 respectively to obtain the hybrid offspring '3H01-1' ('HPpm-1' × '3015pm-2') and '3H01-2' ('HPpm-1' × '3015pm-302'), and they were cultivated to produce fruiting bodies and spores were collected.

[0079] ④ Isolation of spore monokaryons, identification of sporeless loci and identification of mating types

[0080] Spores ejected from the mature fruiting bodies of '3H01-1' and '3H01-2' were collected and made into a spore suspension with sterile water. After gradient dilution, it was spread on a complete medium plate and cultured in the dark at 25°C for a period of time. After the spores germinated, the hyphae germinated from single spores were isolated and transferred to a PDA solid medium plate and cultured under dark conditions at 25°C, and single colonies were picked out.

[0081] First, it was observed under a microscope to check for the presence of clamp connections, and the dikaryotic strains with clamp connections were removed.

[0082] Then use the primer combination for identifying the sporeless locus of Pleurotus ostreatus strains described in Chinese Invention Patent CN202410927401.5 (sppo1: 5’-TAGATGTTGCACGGGAGAC-3’; SEQ ID NO.13; sppo2: 5’-ATCCATTTAGTGCCACAATC-3’; SEQ ID NO.14; sppo3: 5’-CAACTGAACACTCCCCAATA-3’; SEQ ID NO.15) to identify whether the spore mononucleate bodies carry the sporeless locus, and remove the mononuclear strains that do not carry the sporeless locus.

[0083] Finally, use the mating type molecular markers developed in step ② to identify the mating types of all mononuclear strains carrying the sporeless locus, so as to obtain the mating types of the mononucleate bodies carrying the sporeless locus. Retain the spore mononuclear strain with the mating type of A4B2 for ‘3H01-1’, and retain the spore mononuclear strain with the mating type of A3B3 for ‘3H01-2’.

[0084] ⑤ Construction and screening of the second-generation hybrid population

[0085] Hybridize and pair the two sporeless mononuclear populations with the mating types of A4B2 and A3B3 obtained in the previous step. Randomly select pairwise combinations of the strains from the two populations and co-inoculate them in the center of a PDA petri dish medium, and place them in an incubator at 25°C for cultivation. When the hyphae come into contact and blend with each other, pick the hyphae at the junction of the blend and examine the clamp connection structure of the hyphae under a microscope to obtain the second-generation hybrid population. After purification, finally obtain 47 hybrid offspring strains with stable growth and clamp connections. Among the 47 strains, 15 strains can normally produce mushrooms and all show sporeless traits.

[0086] Table 2 shows the results of measuring and comparing the hyphal growth rate (HGS), sporulation traits (ST), full-bag time (PT), primordium emergence time (XT), single-bag yield (YP), cap color (CC), cap shape (CS), and contamination rate (CR) of 15 strains and their parents.

[0087] Hyphal growth rate: Measure the growth amount of hyphae on the 3rd - 5th day using the plate cross-streaking method, and then calculate the daily average growth rate.

[0088] Sporulation traits: Select Pleurotus ostreatus leaves with fully expanded caps, place the fruiting body leaves on a black background, cover them with a paper box and let them stand for 1 day, and take a comparison picture of the spore print.

[0089] Full-bag time: The number of days required for the mycelium to fill the entire bag after the strain is inoculated into the bag.

[0090] Primordium emergence time: The time from when the mushroom bag is placed on the shelf to the emergence of primordia.

[0091] Single-bag yield: When the first flush of Pleurotus ostreatus reaches about 80% maturity, harvest it and weigh the fresh weight of the fruiting bodies per bag, then take the average value.

[0092] Cap color: 1: Brown; 2: Grayish brown

[0093] Cap shape: 1: Trumpet-shaped; 2: Spherical; 3: Mixed; 4: Fan-shaped

[0094] Contamination rate: The proportion of contaminated bags to the total inoculated bags.

[0095] Table 2 Comparison of agronomic traits between parents and the second-generation hybrid population

[0096]

[0097] Among the above strains, the agronomic traits of 3H02F79 are closest to those of the parent P2101. The fruiting bodies of this strain do not produce spores; the fruiting bodies are tufted or overlapping; the caps are fan-shaped and grayish brown; the gills are regularly arranged; it has high yield, good consistency, short cycle, and fast flush turnover (see Figure 4 ). The fruiting body morphology of the parent P2101 is as shown in Figure 5 and that of the parent QHP315 is as shown in Figure 6 .

[0098] The strain 3H02F79 was deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M2025718, the deposit address being Wuhan, China, the deposit date being April 7, 2025, and the taxonomic name being Pleurotus ostreatus 3H02F79.

[0099] Example 2

[0100] Comparison of agronomic traits between the sporeless Pleurotus ostreatus strain 3H02F79 and its parents

[0101] (1) Test strains: P2101, QHP315, and 3H02F79

[0102] (2) Experimental method:

[0103] ① Strain culture and fruiting management:

[0104] PDA slant medium: 200 g of potato, 20 g of glucose, 1 L of water, natural pH, used for culturing slant / test-tube mother cultures.

[0105] Formula for branch spawn culture medium: 89% hardwood branches, 10% wheat bran, 1% gypsum, water content 60% - 65%; the hardwood branches are broad-leaved hardwood, φ4 - 6 mm, length 18 - 22 cm.

[0106] Cultivation bag culture medium formula: cottonseed hulls 30%, corn cob 48%, wheat bran 18%, soybean meal 2%, gypsum 1%, lime 1%, water content 63%.

[0107] The test strains were activated and cultured on PDA slant medium to prepare PDA slants, and then inoculated into the branch stock culture medium. After the stock culture was mature, it was inoculated into the cultivation bags (for the cultivation bags, the culture medium was put into a blender according to the formula, and after adding water, it was stirred evenly to make the water content of the medium 65%. It was filled into bags by an automatic bagging machine and sealed with a matching plastic cover. The culture medium was filled into high-pressure polypropylene mushroom bags with a specification of 6 cm×18 cm, and each bag was filled with 1400 - 1450 g of the medium. It was sterilized at 121℃ under high-pressure steam for 2 h. After sterilization, when the temperature dropped to 80℃, the spawn bags were moved to a pre-cooling room, and when cooled to about 25℃, they were transferred to the inoculation room by a conveyor belt and inoculated under sterile conditions), and one test tube spawn / branch was inoculated into each bag, and 250 bags were inoculated for each variety. It was cultured indoors at 25℃ in the dark, with the relative air humidity below 60% - 70% and the carbon dioxide concentration below 0.3%. After the mycelium filled the bags, fruiting occurred. Observation plots were set up: 24 bags of mushroom bags of each variety were randomly selected and placed adjacent to each other, and 2 observation plots were set up at different positions, and the remaining mushroom bags were randomly placed. The fruiting temperature was 8 - 16℃, the relative air humidity was above 95%, the light intensity was 100 - 300 lx, and the carbon dioxide concentration was below 0.1%.

[0108] ② Determination of agronomic trait indicators:

[0109] Measure the growth rate of slant mycelium (HGS), sporulation traits (ST), full-bag time (PT), primordium emergence time (XT), yield per bag (YP), cap color (CC), cap shape (CS), contamination rate (CR), and turnover time (TTT).

[0110] Growth rate of slant mycelium: The growth amount of the mycelium on the 3rd - 5th day was measured by the plate cross-streaking method, and then the daily average growth rate was calculated.

[0111] Sporulation traits: Select the Pleurotus ostreatus leaves with fully expanded caps, place the fruiting body leaves on a black background, cover them with a paper box and let them stand for 1 day, and take a comparison picture of the spore print.

[0112] Full-bag time: The number of days required for the mycelium to fill the entire bag after the spawn was inoculated into the bag.

[0113] Primordium emergence time: The time from when the mushroom bags were placed on the shelf to the emergence of primordia.

[0114] Yield per bag: When the first flush of Pleurotus ostreatus grew to about eight-tenths maturity, it was harvested, and the fresh weight of the fruiting bodies of each bag was weighed, and the average value was taken.

[0115] Cap color: 1: brown; 2: grayish brown

[0116] Cap shape: 1: Flared; 2: Spherical; 3: Mixed; 4: Fan-shaped

[0117] Contamination rate: The proportion of contaminated bags to the total inoculated bags.

[0118] Turnover time: The time from the end of the first flush of mushroom picking to the budding of the second flush.

[0119] ③ Data analysis:

[0120] Data processing and analysis were carried out using two analysis software, Microsoft excel 2016 and SPSS17.0, as shown in Table 3.

[0121] Table 3 Comparison of agronomic traits of parental and offspring strains

[0122]

[0123] It can be seen that after the plot and scale-up tests, all agronomic trait indicators of strain 3H02F79 are better than those of the non-sporulating parent QHP315. The sporulation trait shows non-sporulation, and the yield is increased by 18.18% compared with the non-sporulating parent QHP315. Compared with the commercial sporulating parent P2101, the harm of spore release is solved, and there are no significant differences in mycelial growth rate, yield, etc. Among the three tested varieties, strain 3H02F79 has the lowest contamination rate and the shortest turnover time. At the same time, after the plot and scale-up tests, the fruiting rate of 3H02F79 is 100%, the traits are stable, and the phenotypes in different plot tests are highly consistent.

[0124] In summary, strain 3H02F79 is a factory-farmed non-sporulating variety with great potential. Strain 3H02F79 and its breeding method are of great significance for enriching the categories in the edible mushroom market, improving the competitiveness of edible mushroom enterprises, and promoting the development of the edible mushroom industry.

Claims

1. A Pleurotus ostreatus strain 3H02F79, characterized in that: The Pleurotus ostreatus strain 3H02F79 was deposited in the China Center for Type Culture Collection on April 7, 2025, with the deposit address in Wuhan, China, the deposit number is CCTCC NO: M 2025718, and the classification name is Pleurotus ostreatus 3H02F79.

2. A mycelium and / or fruiting body of Pleurotus ostreatus, characterized in that: Obtained by the growth and development of the Pleurotus ostreatus strain 3H02F79 described in claim 1.

3. The use of the Pleurotus ostreatus strain according to claim 1, or the mycelium and / or fruiting body according to claim 2, characterized in that: The application is at least one of the following: A. Use as a parent in hybrid breeding; B. Strain propagation; C. Fruiting body production; D. Food processing.

4. A primer combination for detecting different karyotypes of the protoplasts of the Pleurotus ostreatus strain of claim 1, characterized in that: The primer combination includes the sequences shown in SEQ ID NO.1-SEQ ID NO.

4.

5. A primer combination for detecting the relative mating type of the Pleurotus ostreatus strain according to claim 1, characterized in that: The primer combination includes the sequences shown in SEQ ID NO.7-SEQ ID NO.

10.

6. Use of the primer combination according to claim 4 or 5 in identification of Pleurotus ostreatus varieties and / or breeding of Pleurotus ostreatus.

7. The method for cultivating the Pleurotus ostreatus strain 3H02F79 according to claim 1, characterized in that: The following steps are involved: S1: Activate and culture the strain 3H02F79 in PDA mother culture medium to prepare PDA mother culture; S2: inoculating the PDA mother seed into the branch stock culture medium to prepare the branch stock; S3: Inoculate the branch seed into the culture medium of the cultivation bag, place it in a dark room at 25℃, with relative humidity of 60%-70% and carbon dioxide concentration below 0.3%, and wait for the mycelium to fill the bag and then produce mushrooms; The temperature for mushroom production is 8-16℃, the relative humidity of the air is above 95%, the light intensity is 100-300 lx, and the carbon dioxide concentration is less than 0.1%.

8. The cultivation method according to claim 7, characterized in that: The PDA mother culture medium is: 200 g potato, 20 g glucose, 1 L water, natural pH; The branch original seed culture medium is: 89% wood branches, 10% bran, 1% gypsum, and a water content of 60% to 65%; The cultivation bag culture material comprises: 30% cottonseed hull, 48% corn cob, 18% bran, 2% soybean meal, 1% gypsum, 1% lime and 63% water content.

9. A method for breeding the Pleurotus ostreatus strain according to claim 1, characterized in that: The following steps are involved: S1: preparing protoplast monokaryons of the spore-forming parent P2101 and the spore-free parent QHP315, using the primer combination of claim 4 to distinguish different karyotypes of the parent protoplasts, and obtaining two protoplast monokaryons of each; S2: performing complete diallel hybridization on the obtained monokaryons, inferring the relative mating type between the two parents based on whether they are compatible, and using the primer combination described in claim 5 to distinguish the relative mating type between the two parents; S3: hybridizing one of the parent QHP315 with the monokaryons of the two protoplast monokaryons of the parent P2101 to obtain two hybrids, cultivating the two hybrids to produce mushrooms, and collecting spores; S4: performing single spore separation on the spores collected in step S3, removing the dikaryon strains with lock-like union by microscopic examination, and then removing the monokaryon strains that do not carry the a-spore site by the primer combination shown in SEQ ID NO.13-SEQ ID NO.15, and finally performing mating type identification on all monokaryon strains carrying the a-spore site by the primer combination shown in SEQ ID NO.7-SEQ ID NO.10, thereby obtaining two spore monokaryon populations carrying the a-spore site and having the same mating type as the P2101 protoplast; S5: The two spore mononuclear populations are hybridized for the second time to obtain a hybrid population carrying a homozygous aspora locus that is closest to P2101. The population is screened for fruiting to obtain a spore-free and high-yielding Pleurotus ostreatus strain.

Images