Auricularia cereus strain LS01 and application thereof in promoting pleione bulbocodioides seeds to germinate and form seedlings

Abstract

The invention belongs to the technical field of microorganisms, and particularly provides a Sebacinales strain LS01 and application thereof in promoting germination of pleione bulbocodioides seeds to form seedlings. The LS01 strain disclosed by the invention is an auricularia cerasus species, and the preservation number of the LS01 strain is CCTCC (China Center for Type Culture Collection) NO: M 2024813. The invention further provides application of the Auricularia lasiocarpa LS01 in promoting germination of pleione bulbocodioides seeds to form seedlings. Compared with a traditional tissue culture mode, the strain has the advantages of being low in cost, high in field cultivation survival rate and the like, can be used for industrial development of large-scale pleione bulbocodioides seedling breeding, and lays an application foundation for wild-imitating cultivation, species regression and population reconstruction of pleione bulbocodioides.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and specifically to the Sebacinales strain LS01 and its application in promoting the germination of Pleione bulbocodioides seeds to form seedlings. Background Art

[0003] The seeds of Pleione bulbocodioides are as fine as dust, and the natural reproduction coefficient is extremely low. The main method of artificial cultivation for protecting the germplasm resources of Pleione bulbocodioides is tissue culture, which uses the aseptic germination of seeds and the induction of germination relying on pseudobulbs. However, this tissue culture method takes a long time, the survival rate of tissue-cultured seedlings is low, and when the tissue-cultured seedlings are transplanted into the natural environment, their survival rate is also low, thus restricting the large-scale development of the Pleione bulbocodioides industry.

[0004] The germination stage of Pleione bulbocodioides completely depends on mycorrhizal fungi to provide nutrients. The core of using symbiotic fungi to promote the growth of Orchidaceae plants lies in finding suitable fungi. At present, there are few cases of putting effective fungi into practical application, and there is no technical report on effective fungi isolated from Pleione bulbocodioides itself.

[0005] Therefore, how to screen and utilize effective symbiotic fungi of Pleione bulbocodioides to achieve large-scale propagation of Pleione bulbocodioides is an urgent problem to be solved in this field. Summary of the Invention

[0006] The purpose of the present invention is to provide the Sebacinales strain LS01 and its application in promoting the germination of Pleione bulbocodioides seeds to form seedlings, and this strain can effectively promote the germination of Pleione bulbocodioides seeds and the formation of seedlings.

[0007] The present invention specifically includes the following technical solutions: A Sebacinales strain LS01, and the Sebacinales strain LS01 is deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M 2024813.

[0008] The present invention also provides a microbial agent containing the above-mentioned Sebacinales strain LS01.

[0009] Preferably, the microbial agent includes one or more of microbial blocks, culture supernatant, and microbial suspension.

[0010] The present invention also provides the application of the above-mentioned Sebacinales strain LS01 or microbial agent in promoting the germination of Pleione bulbocodioides seeds and / or the formation of seedlings.

[0011] Preferably, the application of promoting the germination of Pleione bulbocodioides seeds and / or the formation of seedlings includes the following steps: Prepare the Pleione bulbocodioides seeds into a seed suspension; Inoculate the agar oatmeal medium with the mycelial block of Sebacinales LS01, add the seed suspension to the surface of the agar oatmeal medium, seal the culture dish, and conduct symbiotic germination culture on the seeds and mycelial block in the seed suspension in the agar oatmeal medium until the seeds germinate and / or form seedlings.

[0012] Preferably, the step of preparing the Pleione bulbocodioides seeds into a seed suspension includes: disinfecting the Pleione bulbocodioides seeds to obtain sterile seeds; mixing the sterile seeds with a sterile agar solution to prepare a seed suspension.

[0013] Preferably, the specific operation of disinfecting the Pleione bulbocodioides seeds includes: soaking and disinfecting with 1% sodium hypochlorite solution for 5 min, and then rinsing with sterile water 3 - 5 times to obtain sterile seeds.

[0014] Preferably, the method for preparing the mycelial block includes: Inoculate the Sebacinales strain LS01 in a PDA medium for subculture until the medium is covered with mycelia to obtain the mycelial block of the Sebacinales strain LS01.

[0015] Preferably, the conditions for the symbiotic germination culture are: temperature is 23 - 27 °C, humidity is 55 - 65%, light cycle L / D = 12 h / 12 h, and light intensity is 4500 - 5500 Lx.

[0016] Preferably, based on the number of seeds in the seed suspension, the inoculation ratio of the mycelial block to the seed suspension is 0.5 cm 3 : 30 seeds.

[0017] The beneficial effects of the above technical solutions are as follows: The Sebacinales strain LS01 of the present invention is isolated from a one - leaf seedling formed by the ex - situ symbiotic germination of seeds. This strain has strong specificity and can effectively promote the germination of Pleione bulbocodioides seeds and the formation of seedlings. The Sebacinales strain LS01 of the present invention promotes the development of the Pleione bulbocodioides seedling - raising industry and can be used for direct seeding and seedling - raising in the Pleione bulbocodioides field, solving the problems of high cost, low yield, and cumbersome operation in artificial cultivation of Pleione bulbocodioides.

[0018] Biological preservation description The Sebacinales strain LS01, with the biological classification of Sebacinales ( Sebacinales sp.), was deposited at the China Center for Type Culture Collection (CCTCC) on April 30, 2024. The deposit address is Wuhan University, Wuhan, China. The deposit number is CCTCC NO: M 2024813, and the taxonomic name is Sebacinales LS01 Sebacinales sp.LS01. Detailed implementation methods

[0019] The specific implementation manners of the present invention will be further described in detail below in conjunction with embodiments. However, they should not be construed as limiting the protection scope of the present invention.

[0020] The present invention provides the ear fungus strain LS01 of Cerinomyces. The ear fungus strain LS01 of Cerinomyces is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 2024813.

[0021] As an implementation manner, the colony of the ear fungus strain LS01 of Cerinomyces on a PDA plate is light brown, regularly round, and grows diffusely; when observed under an optical microscope, it can be seen that the hyphae of the strain have septa, with a diameter of 2.45 μm to 4.45 μm, the hyphal growth rate is 0.049 ± 0.009 mm / h, the branches are nearly at right angles, there are septa in the branched hyphae not far from the branches, the hyphal ends are beaded after culturing for 10 days, the colony edge is neat, the thickness is uneven, and the cell walls of the old hyphae have a thickening phenomenon.

[0022] The present invention also provides a bacterial agent of the ear fungus strain LS01 of Cerinomyces as described above.

[0023] As an implementation manner, the bacterial agent of the present invention includes one, two or three of bacterial blocks, culture supernatant and bacterial suspension.

[0024] The present invention also provides the application of the ear fungus strain LS01 of Cerinomyces or the bacterial agent as described above in promoting the germination of Pleione bulbocodioides seeds and / or the formation of seedlings.

[0025] The present invention also provides the operation steps of the ear fungus strain LS01 of Cerinomyces in promoting the germination of Pleione bulbocodioides seeds and / or the formation of seedlings: making Pleione bulbocodioides seeds into a seed suspension; inoculating a bacterial block of Cerinomyces LS01 in the middle of an agar oatmeal medium, adding the seed suspension to the surface of the agar oatmeal medium, sealing the culture dish, and performing symbiotic germination culture on the seeds and the bacterial block in the seed suspension in the agar oatmeal medium until the seeds germinate.

[0026] As an implementation manner, after the germination of Pleione bulbocodioides seeds, the present invention further includes the step of continuing to culture the germinated Pleione bulbocodioides seeds until seedlings are formed; as an implementation manner, the conditions for continuing to culture the germinated seeds are: the temperature is 23 °C to 27 °C, the humidity is 60%, the light cycle L / D = 12 h / 12 h, and the light intensity is 5000 Lx; in a specific embodiment, after the germination of Pleione bulbocodioides seeds, the germinated Pleione bulbocodioides seeds are placed in an environment of 25 °C, 60% humidity, and a light cycle L / D = 12h / 12h and continue to be cultured until seedlings are formed.

[0027] As an implementation method, the present invention makes Pleione bulbocodioides seeds into a seed suspension. As an implementation method, the specific steps for making the Pleione bulbocodioides seeds into a seed suspension by the present invention are as follows: disinfect the Pleione bulbocodioides seeds to obtain sterile seeds, and mix the sterile seeds with a sterile agar solution to make a seed suspension. As an implementation method, the specific operation of disinfecting the Pleione bulbocodioides seeds includes: soaking the Pleione bulbocodioides seeds in a 1% sodium hypochlorite solution for 5 minutes for disinfection, and then rinsing with sterile water 3 to 5 times. As an implementation method, the specific preparation steps of the seed suspension include: mixing sterile seeds, sterile water, and a 0.1% agar solution to suspend the Pleione bulbocodioides seeds and obtain a seed suspension; in a specific embodiment, the present invention soaks the Pleione bulbocodioides seeds in a 1% sodium hypochlorite solution for 5 minutes for disinfection, and then rinses with sterile water 4 times to obtain sterile seeds; then mixing the sterile seeds, sterile water, and 0.1% agar to suspend the Pleione bulbocodioides seeds and obtain a seed suspension.

[0028] As an implementation method, the present invention inoculates a fungal block of Sebacinales LS01 in an agar oatmeal medium. As an implementation method, the present invention inoculates the fungal block in the middle of the agar oatmeal medium.

[0029] The present invention also provides a method for preparing the fungal block, which specifically includes the following steps: inoculating the Sebacinales strain LS01 in a PDA medium for strain cultivation to obtain the Sebacinales strain LS01; inoculating the obtained LS01 strain in a new PDA medium for subculture until the medium is covered with mycelium to obtain a fungal block of the Sebacinales strain LS01. As an implementation method, the cultivation conditions for the strain cultivation are: the cultivation environment is dark, the cultivation temperature is 23°C to 27°C, and the cultivation humidity is 50% to 60%. As an implementation method, the conditions for the subculture are: the cultivation environment is dark, the cultivation temperature is 23°C to 27°C, and the cultivation humidity is 50% to 60%. In a specific embodiment, the present invention takes out the Sebacinales strain LS01 from a 4°C refrigerator, transfers the fungus to a new PDA medium with a sterilized inoculation loop, and then places it in a dark environment at a temperature of 25°C and a humidity of 55% for strain cultivation to obtain the Sebacinales strain LS01; inoculating the Sebacinales strain LS01 in a new medium, placing it in a dark environment at a temperature of 25°C and a humidity of 55% for subculture until the medium is covered with mycelium to obtain a fungal block of the Sebacinales strain LS01.

[0030] After adding the mycelium block of Auriculariales LS01 with a wax shell to the agar-oat medium, as an implementation method, the present invention adds the seed suspension to the surface of the agar-oat medium. After sealing the culture dish, the seeds and the mycelium block in the seed suspension in the agar-oat medium are co-cultured for germination until the seeds germinate. As an implementation method, based on the number of seeds in the seed suspension, the inoculation ratio of the mycelium block to the seed suspension in the present invention is 0.5 cm 3 : 30 seeds. As an implementation method, the specific steps of sealing the culture dish in the present invention include: winding the culture dish with a sealing film for one circle, and then winding it with a plastic wrap for one circle for sealing, so as to achieve the effects of moisture preservation, isolation from the external environment, and prevention of contamination. As an implementation method, the culture conditions for the co-germination in the present invention are: the temperature is 23°C to 27°C, the humidity is 55% to 65%, the light cycle L / D = 12 h / 12 h, and the light intensity is 4500 Lx to 5500 Lx; as an implementation method, the culture temperature for the co-germination can be any one of 24°C, 25°C, 26°C, and 27°C; as an implementation method, the culture humidity for the co-germination can be any one of 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, and 65%; as an implementation method, the light intensity for the co-germination can be any one of 4500 Lx, 4600 Lx, 4700 Lx, 4800 Lx, 4900 Lx, 5000 Lx, 5100 Lx, 5200 Lx, 5300 Lx, 5400 Lx, and 5500 Lx; in a specific embodiment, after adding the mycelium block of Auriculariales LS01 with a wax shell to the agar-oat medium, the present invention adds the seed suspension to the surface of the agar-oat medium according to the ratio of 0.5 cm 3 : 30 seeds, winds the culture dish with a sealing film for one circle, and then winds it with a plastic wrap for one circle for sealing. Then, the seeds and the mycelium block in the agar-oat medium are co-cultured for germination, and cultured under the conditions of a temperature of 25°C, a humidity of 60%, a light cycle L / D = 12 h / 12 h, and a light intensity of 5000 Lx until the seeds germinate.

[0031] To further illustrate the present invention, the following describes in detail the embodiments provided by the present invention in combination with examples, but they cannot be understood as limiting the protection scope of the present invention.

[0032] Example 1 Ex-situ co-germination of seeds In March 2023, the native habitat substrate of Pleione bulbocodioides was collected in Lijiang Alpine Botanical Garden, Yunnan Province, and brought back to the laboratory and divided into 18 plastic square boxes. The specifications of the plastic square boxes were: 20.5 cm in length, 12.5 cm in width, and 6.0 cm in height. A layer of nylon cloth with a mesh size of 45 μm was covered on the native habitat substrate in the plastic square boxes, and sterile water was sprayed to make the nylon cloth fully contact with the native habitat substrate.

[0033] The seeds of Pleione bulbocodioides stored in the laboratory were taken out from the -20 °C refrigerator. The seeds of Pleione bulbocodioides were poured into a disposable syringe, and the contact surface between the syringe and the needle tube was blocked with a non-woven fabric with a diameter of 2 cm. 1% NaClO solution was inhaled until the NaClO solution could completely immerse the seeds and there was a space for shaking. The syringe was shaken, and the seeds of Pleione bulbocodioides were disinfected by fully contacting with the NaClO solution for 5 minutes. After disinfection, the steps of inhaling sterile distilled water 5 times, shaking the syringe and then discharging were repeated to obtain the disinfected seeds of Pleione bulbocodioides.

[0034] The disinfected seeds of Pleione bulbocodioides and sterile distilled water were injected into a 0.1% agar suspension together to suspend the seeds and make a seed suspension.

[0035] The seed suspension was evenly transferred onto the nylon gauze in the plastic square box with a 1000 mL pipette. Then, 0.3 cm thick native habitat substrate was evenly spread on the surface of the nylon gauze to cover the nylon cloth. Sterile water was sprayed on the surface of the native habitat substrate to keep it in a moist state, and it was placed in a constant temperature incubator. The culture temperature was 25 °C, and the photoperiod was L / D = 12 h / 12 h. The seed germination was observed every two weeks, and the humidity of the substrate in the plastic box was maintained.

[0036] After 45 days, protocorms were successively found in the box. After 80 days of induction, a one-leaf seedling appeared. Symbiotic protocorms and symbiotic seedlings were picked out at different time periods for fungal isolation.

[0037] The standards for different stages of seed germination are as follows: 1) Seeds that did not germinate; 2) Seeds absorbed water and swelled, producing root-like structures (germination stage); 3) Seeds continued to swell, broke through the seed coat, and a promeristem appeared (protocorm development stage); 4) The first leaf grew and roots grew (seedling development and growth stage).

[0038] Example 2 Isolation of the strain LS01 of Sebacinales Using the symbiotic seedlings obtained from the germination of Pleione bulbocodioides seeds selected in Example 1, rinse the surface of the symbiotic seedlings with the native habitat substrate 3 times with clean water, and then, in a laminar flow hood, place the symbiotic seedlings in a sterile Petri dish containing 2% NaClO solution and soak for 3 min, and gently shake the Petri dish for disinfection, and then rinse 5 times with sterile water.

[0039] Use a sterile scalpel to cut the disinfected symbiotic seedlings into fragments of 0.5 mm in size, and then use forceps to transfer the fragments into a new PDA medium, and place them in an incubator at 25 °C for dark culture. After new hyphae grow at the edges of the plant tissue fragments, use a sterile scalpel to cut and transfer the hyphae into a new PDA medium, and purify and culture 4 times to obtain a purified strain, denoted as strain LS01.

[0040] Conduct physiological research on the purified strain. The colonies of the purified strain on the PDA plate are light brown, regular round, and grow diffusely.

[0041] Use the cover glass insert culture method to observe the microscopic morphological characteristics of the strain: culture the PDA medium in the dark and inverted at 25 °C for 10 d, and take the insert to prepare slides according to the conventional slide-making method. Observe under an optical microscope, and it can be seen that the hyphae of the strain have septa, with a diameter of 2.45 μm - 4.45 μm, the hyphal growth rate is 0.049 ± 0.009 mm / h, the branches are nearly right-angled, and there are septa in the branched hyphae not far from the branch. After culturing for 10 d, the hyphal ends are beaded, the colony edge is neat, the thickness is uneven, and the cell walls of the old hyphae have thickening phenomena.

[0042] Use the CTAB method to extract and isolate the DNA of the obtained strain. The primers used for PCR amplification are ITS1 and ITS4, and the sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively; the nrDNA ITS sequence characteristics in the nucleotide sequence of the strain are shown in SEQ ID NO.3.

[0043] SEQ ID NO.1: 5'-TCCGTAGGTGAACCTGCGG-3'; SEQ ID NO.2: 5'-TCCTCCGCTTATTGATATGC-3'; SEQ ID NO.3: GTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTATAAGTCGGTCTTCTGTGCTGGTGGTAACACATGTGCACGTTGATCGCAAATCCACACACCTGTGCACTTTTGACTTTGGGATCCGCCTGTTGGCTTGTCCGACTTGCAGCTGGCTTGGTCTTGTACCGGCCTGGGTCTCAGAGTAATTTTTACACACTCTGAATGTAATGGAATGTCTTGTGCATAACGCATATAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCACCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCGAAAGGTACACCCGTTTGAGTGTCATTGTAATCTCACTCCGACAACTTTGTTGTTGCCGGATGTGGACTTGGACTCTGTCGTGTTACTACGACTGGTCTGAAATGCCTGAGTGCACCCTGCTGTTGCAGCGTCTTCAGTGTGATAAGCATCTTCACTGATTCAAGCTCCCTTTTGGGGACACGTAGCATTGTGGGCTCTGTGCTGACGAACCGTCTTTGGACAATCTTTGACAATTTGACCTCAAATCGGGTGGGACTACCCGCTGAACTTA The PCR reaction system (25 μl) includes: 2.5 μl of 10×PCR buffer, 0.4 μl of dNTP, 1.5 μl of Mg 2+ , 1.5 μl of ITS1, 1.5 μl of ITS4, 0.2 μl of Taq enzyme, 15.4 μl of ddH 2 O, and 2 μl of DNA template; The amplification reaction was carried out on a PCR instrument Perkin Elmer with the following PCR cycles: pre-denaturation at 94 °C for 3 min, 1 cycle; denaturation at 94 °C for 1 min, annealing at 51 °C for 1 min, extension at 72 °C for 1 min, 30 cycles; and finally extension at 72 °C for 10 min; The PCR amplification products were sequenced by Shanghai Sangon Biotech Co., Ltd. The sequenced sequences were submitted to the National Center for Biotechnology Information database in the United States for comparison to preliminarily confirm their taxonomic status. The BLAST comparison of the strain of the present invention was carried out, and the results showed that the strain was most similar to KJ188464.1 fungal Uncultured Sebacinales (Sebacinales), and the maximum similarity reached 96.41%. According to the results of the physiological research on the purified strain and the BLAST comparison results as described above, the strain LS01 belongs to the order Sebacinales.

[0044] The Sebacinales strain was preserved by the conventional test tube slant method. The specific operation of the test tube slant method was as follows: Pour an appropriate amount of prepared PDA medium into a glass test tube with a specification of 18 mm × 20 mm, and the amount of medium poured was about 1 / 3 of the test tube volume. After plugging with a silica gel plug, it was placed in an autoclave and sterilized at 121 °C for 20 min. After sterilization, the test tubes were placed in a laminar flow hood and arranged into slopes for standby. On the laminar flow hood, the purified strain was picked with a sterile inoculation needle to inoculate the edge hyphae on the PDA slope, and the strain name, number, and date were marked. The inoculated test tubes were placed in an artificial climate chamber at 25 ± 2 °C under dark conditions. The test tubes were filled with PDA, wrapped with sealing film and then wrapped with a layer of plastic wrap. The humidity in the artificial climate chamber was about 50% for cultivation. When the hyphae were about to cover the PDA slope, the test tubes were taken out and stored in a 4 °C refrigerator in the laboratory. In addition, the isolated strain was deposited in the China Center for Type Culture Collection for biological deposit.

[0045] The Sebacinales strain LS01 was preserved in the fungal library of the Plant Germplasm Resources Protection Group of Yunnan University in December 2023, and was deposited in the China Center for Type Culture Collection for biological deposit in April 2024. The deposit number is: CCTCC NO: M 2024813.

[0046] Example 3 Experiment on promoting the germination of Pleione bulbocodioides seeds by Sebacinales strain LS01 The symbiotic germination experiment of the LS01 strain isolated in Example 2 and the seeds was carried out in a symbiotic medium to test the effectiveness of the obtained fungus on the germination of Pleione bulbocodioides seeds. The steps were as follows: Prepare the symbiotic medium: The symbiotic germination medium was oat agar medium (OMA). The raw materials of the medium were: 4 g·L -1 oatmeal and 15 g·L -1 agar, and the pH of the medium was 5.7. Prepare 3 L of medium and 120 culture dishes, which were divided into 4 treatment groups, namely the experimental group, control group 1, control group 2, and blank control group. Each treatment was set with 30 replicates.

[0047] Seed disinfection: Pleione bulbocodioides seeds stored in a -20 °C refrigerator were taken out and placed at room temperature for 10 h. Weighed 0.0083 g of seeds and put them in weighing paper, folded it, and poured the seeds into a disposable syringe on the ultra-clean workbench. The connection between the needle and the syringe barrel was blocked with sterilized non-woven fabric, 1% sodium hypochlorite solution was inhaled to fully contact the seeds, and the syringe barrel was shaken. After 5 min, the waste liquid was discharged, and then sterile water was inhaled and rinsed 5 times to obtain sterile seeds.

[0048] Inoculation and sowing: The mycelium was inoculated on a new PDA medium and cultured to obtain a medium covered with mycelium. A piece of the medium containing mycelium was taken to obtain a mycelium block. The sterile Pleione bulbocodioides seeds were mixed with 1 g·L -1 sterile agar solution to make a seed suspension.

[0049] Experimental group: In the middle of the OMA medium, inoculate a 0.5 cm 3 mycelium block of LS01 strain, and add the seed suspension according to the ratio of mycelium block: Pleione bulbocodioides seeds = 0.5 cm 3 : 30 seeds; Control group 1: In the middle of the OMA medium, inoculate a 0.5 cm 3 mycelium block of the Sebacinales SO strain, and add the seed suspension according to the ratio of mycelium block: Pleione bulbocodioides seeds = 0.5 cm 3 : 30 seeds; The Sebacinales SO strain is the strain in Patent CN110699261A and was named Sebacinales LQ strain in Patent CN110699261A. This strain was isolated from Dendrobium officinale.

[0050] Control group 2: In the middle of the OMA medium, inoculate a 0.5 cm 3 mycelium block of the Tulasnella GYBQ01 strain, and add the seed suspension according to the ratio of mycelium block: Pleione bulbocodioides seeds = 0.5 cm 3 : 30 seeds; The Tulasnella GYBQ01 strain is the strain in Patent CN111876336A and was isolated from Paphiopedilum wardianum.

[0051] Blank control group: In the middle of the medium, inoculate a 0.5 cm 3 PDA medium without mycelium and add 30 Pleione bulbocodioides seeds.

[0052] After configuring according to the above limitations, wrap the culture dish with a sealing film for one circle, and then wrap the culture dish with a plastic wrap for one circle for symbiotic germination culture; place the sown culture dish in an artificial climate chamber and incubate at a constant temperature of 25 °C, with a light cycle of L / D = 12 h / 12 h and a light intensity of 5000 Lx.

[0053] The seed germination was counted at 30 d, 60 d, and 90 d after co-culture. At each stage, the germinated protocorms or seedlings were randomly selected for stereomicroscopic observation according to different treatments. Meanwhile, the germinated protocorms and seedlings were stained for observation to confirm the infection of seeds by fungi.

[0054] The seed germination and seedling formation were divided into the following four stages: 1) Seeds that did not germinate; 2) Seeds absorbed water and swelled, producing root-like structures (germination stage); 3) Seeds continued to swell, broke through the seed coat, and showed promeristems (protocorm development stage); 4) The first leaf grew out and further developed, and roots grew out (seedling development and growth stage).

[0055] According to the above criteria, the seed germination rate G, protocorm formation rate P, and seedling development rate S were calculated. t represents the total number of seeds, g represents the number of germinated seeds, p represents the number of seeds that formed protocorms, and s represents the number of seeds that formed seedlings. The calculation formulas are as follows: G = (g + p + s) / t, P = (p + s) / t, S = s / t. All data were summarized as mean ± standard error (SE); The experiment was terminated after 90 d of co-culture. Using the results counted at 90 d and non-parametric test methods, the Kruskal-Wallis test (KW) and Mann-Whitney U–test (U), the significant differences in the seed germination rate, protocorm formation rate, and seedling development rate of different treatments were tested, with α = 0.05; the results are shown in Table 1.

[0056] Table 1 Effects of different fungal treatments on the seed germination of Pleione bulbocodioides (statistics at 90 d)

[0057] As can be seen from Table 1, Pleione bulbocodioides seeds germinated in all treatments, but the germination rates were different. Although the treatment without inoculation could also germinate Pleione bulbocodioides seeds to the protocorm stage, no seedlings appeared after 90 days of culture; the GYBQ01 strain isolated from the protocorms of Paphiopedilum wardianum did not have seedlings after 90 days of symbiotic germination with Pleione bulbocodioides seeds, and the germination rate and protocorm formation rate were also low, indicating that the GYBQ01 strain had no obvious promoting effect on the germination of Pleione bulbocodioides; the SO strain isolated from the protocorms of Dendrobium officinale could promote the germination of Pleione bulbocodioides seeds to the seedling stage, and the seedling rate reached 34.83±3.39% after 90 days of germination; the LS01 strain isolated from Pleione bulbocodioides seedlings could significantly promote the formation of protocorms (85.18±7.36%) and seedling development (66.81±6.57%). Although the SO strain could also promote the germination of Pleione bulbocodioides seeds to the seedling stage, the germination rate, protocorm formation rate and seedling development rate of the LS01 strain were significantly higher than those of the SO treatment, indicating that LS01 was an effective fungus for promoting the germination of Pleione bulbocodioides seeds and seedling growth.

[0058] In summary, different fungal treatments had different effects on the germination of Pleione bulbocodioides seeds. All treatments could germinate them at the initial stage of symbiotic culture. In particular, the treatment without inoculation could also form a small number of protocorms, but this only represented that the seeds absorbed water and swelled, the embryo broke through the seed coat and grew, and began to form meristems, which could not be used as a standard for practical application. The more important index was the seedling development rate. In the later stage of symbiotic culture, that is, at the seedling formation stage, although the SO strain isolated from Dendrobium officinale could promote the formation of seedlings from Pleione bulbocodioides seeds to a certain extent, the LS01 strain obtained from the seedlings of Pleione bulbocodioides germinated by ex-situ symbiosis had the best effect on promoting the germination of Pleione bulbocodioides seeds. The waxy ear fungus strain LS01 could be used for symbiotic germination with Pleione bulbocodioides seeds to obtain symbiotic seedlings.

[0059] Through symbiotic germination experiments, the strain of the present invention cultured sterile Pleione bulbocodioides seeds, different fungi and blank controls on oat medium respectively. By comparing the seed germination rate, protocorm formation rate and seedling development rate, an effective strain for promoting the development of Pleione bulbocodioides seeds to seedlings was successfully screened, thus opening up a new way for the efficient seedling raising, protection practice and population reconstruction of Pleione bulbocodioides.

[0060] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments without creative work as in this embodiment, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A Sebacinales strain LS01, wherein the Sebacinales strain LS01 is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M 2024813.

2. A bacterial agent containing the Otodectes cerifera strain LS01 according to claim 1.

3. The bacterial agent according to claim 2, characterized in that The bacterial agent includes one or more of bacterial blocks, culture supernatant and bacterial suspension.

4. Use of the Ceropegia cerifera strain LS01 according to claim 1 or the bacterial agent according to claim 2 or 3 in promoting seed germination and / or seedling formation of Orchidaceae.

5. The use according to claim 4, characterized in that: The application of promoting the germination of seeds and / or the formation of seedlings of Orchidaceae comprises the following steps: Prepare seed suspension from seeds of Solanum edulis; Inoculate agar oatmeal medium with a bacterial mass of the Ostreella cerifera strain LS01, add a seed suspension onto the surface of the agar oatmeal medium, seal the culture dish, and perform symbiotic germination culture on the seeds and bacterial mass in the seed suspension in the agar oatmeal medium until the seeds germinate and / or form seedlings.

6. The use according to claim 5, characterized in that: The step of preparing seed suspension from Orchidaceae seeds comprises: sterilizing Orchidaceae seeds to obtain sterile seeds; and mixing the sterile seeds with sterile agar solution to prepare seed suspension.

7. The use according to claim 6, characterized in that: The specific operation of disinfecting the seeds of the garlic orchid comprises: soaking and disinfecting them in a 1% sodium hypochlorite solution for 5 minutes, and then washing them with sterile water for 3 to 5 times to obtain sterile seeds.

8. The use according to claim 5, characterized in that: The method for preparing the mushroom block comprises: The Otodectes cerifera strain LS01 was inoculated into a PDA culture medium for expansion culture until the culture medium was full of hyphae to obtain a bacterial block of the Otodectes cerifera strain LS01.

9. The use according to claim 5, characterized in that: The conditions for the symbiotic germination culture are: temperature of 23-27° C., humidity of 55-65%, photoperiod L / D=12 h / 12 ​​h, and light intensity of 4500-5500 Lx.

10. The use according to claim 5, characterized in that: The inoculation ratio of the bacterial block to the seed suspension is 0.5 cm 3 : 30 tablets.

Images