Lactococcus gasseri ZB15, cell-free fermentation freeze-dried substance with anti-inflammatory activity and preparation method of cell-free fermentation freeze-dried substance

By using Lactococcus grenigne ZB15 and freeze-dried cell-freeze-dried lyophilized substances, the negative effects and unstable efficacy of lactic acid bacteria in the treatment of colitis were solved, and the effect of effectively improving the symptoms of colitis and improving the levels of anti-inflammatory metabolites was achieved.

CN120118796AActive Publication Date: 2025-06-10SHAANXI SCI TECH UNIV

Patent Information

Application Number
CN202510359222.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-25
Publication Date
2025-06-10
Estimated Expiration
2045-03-25

AI Technical Summary

Technical Problem

The existing methods of lactic acid bacteria for treating colitis have negative effects caused by direct intake of live bacteria, and the efficacy varies from person to person, and there is a problem that the antibacterial and anti-inflammatory effects are not fully released.

Method used

Lactococcus grenigne ZB15 was used for fermentation, and cell-free fermentation freeze-dried substances were obtained through freeze-drying, which was used to treat colitis, avoiding the direct intake of live bacteria, and retaining the therapeutic effect of lactic acid bacteria fermentation products to the greatest extent.

Benefits of technology

This method effectively improves the symptoms of colitis in mice, reduces anti-inflammatory factors in the serum, improves the levels of metabolites with anti-inflammatory bacterial flora and antibacterial efficacy in the intestinal tract, and activates the KEGG pathway with anti-inflammatory and antioxidant effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118796A_ABST
    Figure CN120118796A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of fermentation, in particular to a strain of lactococcus gasseri ZB15, an acellular fermentation freeze-dried substance with anti-inflammatory activity and a preparation method of the acellular fermentation freeze-dried substance. The Lactococcus garvieae ZB15 is preserved in the Guangdong Microbial Culture Collection Center, the address is the 5th floor of building 59, No.100 Courtyard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences, the preservation date is February 27, 2025, and the preservation number is GDMCC No: 65947. The lactococcus gasseri ZB15 disclosed by the invention is prepared into an acellular fermentation freeze-dried substance, and the acellular fermentation freeze-dried substance can improve the body immunity by changing the intestinal microflora structure while relieving and improving enteritis, so that a basis is provided for the preparation of enteritis medicines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of fermentation technology, and particularly to a Lactococcus garvieae ZB15 and a cell-free fermentation freeze-dried product with anti-inflammatory activity and a preparation method thereof. Background Art

[0002] Ulcerative colitis (UC) is a recurrent inflammatory bowel disease. As one of the main types of inflammatory bowel disease, the main characteristics of UC are weight loss, abdominal pain, diarrhea, and bloody stools. Although UC is more common in Western countries, the incidence of UC in developing countries has also increased sharply in recent years, which has led to UC becoming one of the global health problems in the 21st century. The occurrence of UC is closely related to various factors, including genetic factors, environmental factors, immune regulation, gut microbiota, and lifestyle, etc. Its exact pathogenesis is still not clear, and currently, no effective cure has been found. Conventional UC intervention drugs include corticosteroids, 5-aminosalicylic acid, immunosuppressants, and antibiotics, etc., but the effects are limited and accompanied by a series of side effects, and the toxicity produced by long-term use will also limit their efficacy. Therefore, it is crucial to explore safe and effective ways to prevent or improve UC.

[0003] Studies have shown that the intake of probiotics by the human body has a certain inhibitory effect on colitis. Lactobacillus and Bifidobacterium, as important members of probiotics, are widely present in the human body. Both are human physiological bacteria that maintain the health of the host intestine and also inhibit the occurrence of cancer to a certain extent. The anti-tumor function of Bifidobacterium infantis (B. infantis) in mice was first reported in 1978. Since then, a large number of in vivo experiments have confirmed that fermented foods rich in lactic acid bacteria are beneficial to the human body and can inhibit the occurrence of tumors. For example, long-term consumption of yogurt or fermented dairy products can reduce the incidence of colorectal inflammation or other cancers, while the intake of Bulgarian yogurt can inhibit the growth of colon tumors.

[0004] The research by Rafter and Commane shows that the possible ways for lactic acid bacteria to inhibit colon cancer are as follows: changing the quantity or type of the host gut microbiota; binding or degrading potential carcinogens; producing anti-tumor or antimutagenic substances; inhibiting tumor growth; enhancing the host's immune stress and affecting the host's physiological metabolism, etc.

[0005] The immune system plays a crucial regulatory role in the occurrence and development of tumors in the body. Research shows that the anti-colorectal cancer function of lactic acid bacteria is closely related to its immune regulation of the body. Research shows that lactic acid bacteria can increase the activity of macrophages, activate NK cells in mice, promote the release of tumor necrosis factor TNF-α, interleukin IL-10, IL-12, etc. from human peripheral blood monocytes, and stimulate dendritic cells to release IL-12 and regulate the release of IL-10. This indicates that lactic acid bacteria can achieve anti-tumor function by enhancing the body's immunity. The research by Wang Shumei et al. shows that the live bacteria, cell walls, and genomic DNA of Lactobacillus paracasei subsp. paracasei M5, Lactobacillus coryniformis subsp. torquens T3, Lactobacillus rhamnosus SB5, SB31, J5, and INI can promote the proliferation of blood monocytes (PBMCs) in vitro and promote the release of IL-12, IFN-γ, and TNF-α, thus realizing their immune-promoting function. The above research results all indicate that lactic acid bacteria have certain probiotic effects on the body, especially can enhance the body's immunity.

[0006] At present, the mechanism of the occurrence of colitis is still unclear, and the toxic and side effects caused by drug treatment cannot be ignored. As a recognized probiotic, the antibacterial and anti-inflammatory effects of lactic acid bacteria have been confirmed by a large number of studies. Some researchers have also used lactic acid bacteria to intervene in and treat colitis, but the potential of lactic acid bacteria in treating colitis has not been fully released, and there are many defects that cannot be ignored. For example, differences in the intestinal flora composition, immune status, and genetic background of patients will lead to different effects of lactic acid bacteria, and the original flora in the patient's intestine may inhibit the colonization or function of exogenous lactic acid bacteria. Some studies have found that lactic acid bacteria may exacerbate inflammation by activating the TLR signaling pathway, and the two-way nature of the mechanism needs to be further verified. Gastric acid, bile salts, etc. may destroy the activity of lactic acid bacteria, resulting in an inconsistent number of live bacteria reaching the intestine; long-term use of live bacteria may disrupt the balance of the intestinal flora and induce the transfer of drug-resistant genes (such as plasmid-mediated antibiotic resistance).

[0007] In view of the above defects in the treatment of colitis with lactic acid bacteria, the existing technology requires a preparation that can maximize the therapeutic effect of lactic acid bacteria fermentation products while reducing the negative effects brought by live bacteria. Summary of the Invention

[0008] The purpose of the present invention is to provide a strain of Lactococcus garvieae ZB15 and its cell-free fermentation freeze-dried product with anti-inflammatory activity and a preparation method thereof.

[0009] To achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0010] The present invention provides a strain of Lactococcus garvieae ZB15, which is deposited in the Guangdong Provincial Microbial Culture Collection Center, located at the 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou City, Institute of Microbiology, Guangdong Academy of Sciences. The deposit date is February 27, 2025, and the deposit number is GDMCC No: 65947.

[0011] The present invention also provides the application of the Lactococcus garvieae ZB15 in the preparation of products with anti-inflammatory activity.

[0012] The present invention also provides the application of the Lactococcus garvieae ZB15 in the preparation of products for treating colitis.

[0013] The present invention also provides a cell-free fermentation freeze-dried product with anti-inflammatory activity, which is obtained by fermenting and freeze-drying the Lactococcus garvieae ZB15.

[0014] The present invention also provides a preparation method of a cell-free fermentation freeze-dried product with anti-inflammatory activity, including the following steps:

[0015] (1) Inoculate the Lactococcus garvieae ZB15 into MRS solid medium and culture at 36 - 38°C for 20 - 28 h to obtain single colonies;

[0016] (2) Inoculate the single colonies obtained in step (1) into MRS liquid medium and culture at 36 - 38°C for 20 - 28 h to obtain a seed solution; inoculate the seed solution into MRS liquid medium and culture at 36 - 38°C for 20 - 28 h to obtain a working bacterial solution;

[0017] (3) Inoculate the working bacterial solution into MRS broth medium and culture at 36 - 38°C for 20 - 28 h to obtain a fermentation broth; centrifuge the fermentation broth, collect the supernatant, filter, and take the filtrate to obtain a cell-free fermentation supernatant;

[0018] (4) Freeze-dry the cell-free fermentation supernatant to obtain a cell-free fermentation freeze-dried product;

[0019] The freeze-drying in step (4) includes a pre-cooling and a vacuum freezing step;

[0020] The temperature of the pre-cooling is -75 to -85°C, and the time of the pre-cooling is 18 - 22 h;

[0021] The temperature of the vacuum freezing is -45 to -55 °C, the degree of vacuum of the vacuum freezing is 20 to 40 Pa, and the time of the vacuum freezing is 22 to 26 h.

[0022] Preferably, the inoculation amount of the working bacterial liquid in step (3) is 0.5 to 1.5% of the volume of the MRS broth medium.

[0023] Preferably, the rotation speed of the centrifugation in step (3) is 3500 to 4500 rpm, and the time of the centrifugation is 15 to 25 min.

[0024] Preferably, the filtration in step (3) is membrane filtration, and the pore size of the filter membrane is ≤ 0.22 μm.

[0025] The present invention also provides the application of the cell-free fermentation freeze-dried product or the cell-free fermentation freeze-dried product prepared by the preparation method in the preparation of a product for treating colitis.

[0026] The present invention also provides the application of the cell-free fermentation freeze-dried product or the cell-free fermentation freeze-dried product prepared by the preparation method in the preparation of a product having any one or more of the following effects;

[0027] (i) Reducing anti-inflammatory factors in serum;

[0028] (ii) Increasing intestinal anti-inflammatory flora and inhibiting the number of harmful flora;

[0029] (iii) Increasing the level of metabolites with intestinal anti-inflammatory and antibacterial effects;

[0030] (iv) Activating the pathways with anti-inflammatory and antioxidant effects in KEGG;

[0031] The anti-inflammatory factors in the serum include one or more of interleukin-6, interleukin-1β, tumor necrosis factor α, and interleukin-10;

[0032] The intestinal anti-inflammatory flora includes Firmicutes and / or Bacteroidetes at the phylum level; and includes one or more of Bacteroides, Faecalibaculum, and Lactobacillus at the genus level;

[0033] The harmful flora includes Campylobacter and / or Escherichia-Shigella;

[0034] The metabolites include one or more of xanthosine, erioflorin, 7-dehydrocholesterol, 27-hydroxy cholesterol, 6-hydroxy dihydroquercetin, benzocaine, N-acetylmuramate, ganoderol A, alisol A and theasapogenol E;

[0035] The pathways with anti-inflammatory and antioxidant effects include one or more of insulin resistance, tryptophan metabolism, serum neuromedin, HIF-1 signaling pathway, fat digestion and absorption, central carbon metabolism in cancer, insulin secretion, phospholipase D signaling pathway, choline metabolism in cancer, purine metabolism, parathyroid hormone synthesis and secretion, cancer pathway, steroid biosynthesis, ascorbate and aldarate metabolism, FCR-mediated phagocytosis, GnRH signaling pathway, pyrimidine metabolism, bile acid biosynthesis and nucleotide metabolism.

[0036] The present invention provides a strain of Lactococcus garvieae ZB15 and a cell-free fermentation freeze-dried product with anti-inflammatory activity and a preparation method thereof. The Lactococcus garvieae ZB15 of the present invention is preserved in the Guangdong Provincial Culture Collection of Microorganisms, located at the 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou City, Institute of Microbiology, Guangdong Academy of Sciences. The preservation date is February 27, 2025, and the preservation number is GDMCC No: 65947. The strain of the present invention is a homofermentative type and no virulence genes are detected, and it is a safe food-grade lactic acid bacterium.

[0037] The Lactococcus garvieae ZB15 of the present invention is fermented and cultured, and the fermentation broth is obtained by centrifugation. Subsequently, the bacterial cells and other impurities are filtered by a filter membrane. Finally, the cell-free fermentation supernatant is freeze-dried to obtain a cell-free fermentation freeze-dried product. The cell-free fermentation freeze-dried product is configured into a solution with a determined concentration to treat colitis, which not only avoids the direct intake of live bacteria but also determines the intake of the cell-free fermentation freeze-dried product in the patient's body, and maximally retains the therapeutic effect of the lactic acid bacteria fermentation product while reducing the possible negative effects brought by live bacteria.

[0038] The present invention uses the cell-free fermentation supernatant obtained by fermenting Lactococcus garvieae ZB15 as an anti-inflammatory active ingredient. This active ingredient does not belong to a chemical preparation and has no negative effects of drugs such as antibiotics. It is a green and natural anti-inflammatory material. By adding the cell-free fermentation freeze-dried product to the mouse diet, the symptoms of mouse colitis can be effectively improved.

[0039] When the present invention is industrially mass-produced, the raw materials are easily obtained, and the amount of antibiotics ingested by patients with enteritis can be reduced while ensuring the microbial safety of the product.

[0040] The cell-free fermentation freeze-dried product prepared by the present invention can not only relieve and improve colitis, but also improve the body's immune ability by changing the intestinal microbial community structure. Description of Drawings

[0041] Figure 1 It is a microscopic observation diagram of Lactococcus garvieae ZB15;

[0042] Figure 2 It is the grouping and feeding method of mice;

[0043] Figure 3 It is the colon length of mice in different groups;

[0044] Figure 4 It is the weight change diagram of mice in different groups;

[0045] Figure 5 It is the DAI score diagram of mice in different groups;

[0046] Figure 6 It is the content of inflammatory factors in the serum of mice in different groups (the upper left is the content of IL-6 cytokine, the upper right is the content of TNF-α, the lower left is the content of IL-1β cytokine, and the lower right is the content of IL-10 cytokine);

[0047] Figure 7 It is the HE staining diagram of mouse colon tissue;

[0048] Figure 8 It is the colony Bar diagram of the colon contents of mice in each group;

[0049] Figure 9 It is the result of comparing and analyzing the phylum level of the colon contents of mice in each group;

[0050] Figure 10 It is the result of comparing and analyzing the genus level of the colon contents of mice in each group;

[0051] Figure 11 It is the differential volcano diagram of metabolites between groups of mouse intestines (Figure A shows the difference between the DSS group and the blank control group, Figure B shows the difference between the CFS group and the blank control group, and Figure C shows the difference between the CFS group and the DSS group);

[0052] Figure 12 It is the KEGG pathway enrichment bubble diagram.

[0053] Deposit Description

[0054] Lactococcus garvieae ZB15 was deposited in the Guangdong Provincial Culture Collection Center of Microorganisms, located at the 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences. The deposit date was February 27, 2025, and the deposit number was GDMCC No: 65947. Detailed Implementation Modes

[0055] The solution provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0056] In the embodiment of the present invention, the MRS solid medium uses water as a solvent and includes 66.2 g / L of MRS agar medium and 2 wt% calcium carbonate. The MRS agar medium is purchased from Haibo Biotechnology Co., Ltd. in Qingdao High-tech Industrial Park. The MRS liquid medium uses water as a solvent and further includes 52.44 g / L of MRS broth medium and 10 g / L of glucose. The MRS broth medium is purchased from Haibo Biotechnology Co., Ltd. in Qingdao High-tech Industrial Park.

[0057] Example 1

[0058] Take the Zhenba bacon sample during the pickling period, weigh 5 g of the sample and cut it into pieces about 1 cm in size, add 10 mL of sterilized normal saline, vortex and oscillate for 5 min to fully suspend, repeat 2 times, collect the supernatant, centrifuge at 6000 rpm for 10 min, discard the supernatant, and collect the bacterial cells.

[0059] Add 5 mL of normal saline to resuspend the bacterial cells to obtain a bacterial cell suspension. Observe the microorganisms under a microscope, initially estimate the microorganism concentration, and select an appropriate dilution factor according to the initial concentration. Gradient dilute the bacterial cell suspension with normal saline to 10 -1 、10 -2 . Take 100 μL of the bacterial liquid with different dilution concentrations and coat them on the MRS solid medium containing calcium carbonate (CaCO 3 ), and statically culture in a 37 °C incubator for 24 h. Select the colonies with obvious calcium dissolution circles, and use a sterilized bamboo stick to spot-seed them into a new MRS solid medium containing CaCO 3 , and culture at 37 °C for 48 h, observe and record the diameter size of the calcium dissolution circle and the colony characteristics. Preserve the isolated lactic acid bacteria in glycerol at -80 °C for standby.

[0060] Observe the characteristics of single colonies on the above culture plates, such as the color, transparency, and edge morphology of the single colonies. Select the single colonies that meet the basic characteristics of lactic acid bacteria for Gram staining, observe the staining results and record the microscope pictures, as Figure 1 shown.

[0061] Streak the preserved lactic acid bacteria strain onto the MRS solid medium containing CaCO 3Activate in MRS solid medium, after culturing at 37 °C for 24 h, pick a single colony and inoculate it into 1 mL of MRS liquid medium, statically culture at 37 °C for 24 h, and use a genomic DNA extraction kit to extract the genomic DNA of the strain. Use universal primers 27F (SEQ ID NO.1) and 1429R (SEQ ID NO.2) (Table 1) to amplify 16S rDNA, and the PCR program is as follows: pre-denaturation at 95 °C for 5 min; 34 cycles (denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min); sufficient extension at 72 °C for 10 min. The amplified product was sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing (SEQ ID NO.3).

[0062] Table 1 Primers

[0063] Primer Sequence (5’→3’) Sequence Number 27F AGAGTTTGATCCTGGCTCAG SEQ ID NO.1 1429R GGTTACCTTGTTACGACTT SEQ ID NO.2

[0064] SEQ ID NO.3:

[0065]

[0066] The sequencing data analysis and alignment were performed using CloneManager software and BLAST (Basic Local Alignment Search Tool) to align with the known sequences in NCBI (National Center for Biotechnology Information) to determine its species. After 16s rDNA sequencing, homologous sequence alignment analysis in NCBI, and drawing using Mega5 software, it was identified as Lactococcus garvieae, which is a homofermentative type. No virulence genes were detected, and it is a safe food-grade lactic acid bacterium.

[0067] Finally, this strain was Lactococcus garvieae and named ZB15. The Lactococcus garvieae ZB15 was deposited in the Guangdong Provincial Microbial Culture Collection Center, located at the 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences. The deposit date was February 27, 2025, and the deposit number was GDMCC No: 65947.

[0068] Example 2

[0069] Take the Lactococcus garvieae ZB15 bacteria, dip a small amount of the bacterial liquid with an inoculation loop, and streak it in a "zigzag" pattern on the MRS solid medium, and culture it at 37°C for 24 h. After the streak culture is completed, add 1.2 mL of MRS liquid medium to a 1.5 mL centrifuge tube, pick a single colony with an inoculation loop into the 1.5 mL centrifuge tube, and culture it statically at 37°C for 24 h to obtain a seed liquid. Inoculate the seed liquid into the MRS liquid medium and culture it statically at 37°C for 24 h to obtain a working bacterial liquid. Inoculate the working bacterial liquid into the MRS broth medium at an inoculation amount of 1 vt%, and culture it statically at 37°C for 24 h to obtain a fermentation broth. Use a high-speed low-temperature refrigerated centrifuge to centrifuge at 4°C and 4000 rpm for 20 min, collect the supernatant, and then filter it through a 0.22 μm water-based filter membrane to remove impurities to obtain a cell-free supernatant of Lactococcus garvieae, which is collected in a 50 mL centrifuge tube. Pour the cell-free supernatant into a glass petri dish, seal it with sterile plastic wrap, and pre-freeze it in an -80°C refrigerator for 20 h. After the pre-freezing is completed, put the petri dish into a vacuum freeze dryer, set the temperature of the dryer to -50°C, evacuate to a pressure range of 30 Pa, and perform vacuum freeze drying for 24 h. After the freeze drying is completed, collect the freeze-dried product in a 10 mL sterile centrifuge tube and store it at -80°C to obtain a cell-free fermentation freeze-dried product (CFS).

[0070] Example 3

[0071] (1) Mouse grouping and establishment of colitis model

[0072] After one week of adaptive feeding, 30 male C57 mice aged 6 - 8 weeks were randomly divided into 3 groups (during the adaptive feeding period, mice had free access to water and food). Each group had 10 mice, namely the blank control group (Control), the dextran sulfate sodium (DSS) model group, and the 100 mg / mL CFS group (DSS + CFS group). The breeding environment temperature was 23 ± 1 °C, the humidity was 50% - 60%, the mouse cages were made of transparent plastic material, and the light and dark periods were each half of the day (light period: 08:00 - 20:00). During the breeding period, mice had free access to water and basic feed. Before starting the modeling, mice in the CFS group were gavaged with CFS at a dose of 100 μL per day for 7 days (pre - protection period). After the modeling started, except for the blank control group, other groups used a 4% DSS aqueous solution instead of normal drinking water, and mice in the CFS group were gavaged with 100 μL of CFS per day for 7 days (during the pre - protection and modeling periods, mice in the blank control group and the DSS model group were given corresponding gavage stimuli, 100 μL of drinking water per day). The clinical symptoms of mouse colonic inflammation were monitored daily, including daily activities, bloody stools, diarrhea, etc. After 7 days of continuous administration, the mice were sacrificed by cervical dislocation.

[0073] The grouping and feeding methods of the mice were as Figure 2 shown.

[0074] The preparation method of 100 mg / mL CFS was as follows: 100 mg of cell - free fermentation freeze - dried product was dissolved in 1 mL of water to obtain.

[0075] (2) Collection and processing of mouse samples

[0076] Blood was collected from the mouse eyeballs and placed in an anticoagulant tube containing sodium heparin. After standing for 2 h, it was centrifuged (4 °C, 3000 rpm, 15 min), and the upper - layer serum was collected and stored at - 80 °C for later use; under aseptic conditions, after the mice were sacrificed by cervical dislocation, dissections were performed, and the colon, cecum, etc. were taken out, processed, quickly placed in liquid nitrogen, and then transferred to - 80 °C for storage for later use.

[0077] (3) Determination of mouse physiological indexes

[0078] (3.1) Colon length of mice

[0079] After the mice were sacrificed by cervical dislocation, the colon tissues of mice in different groups were collected, photographed, and their lengths were measured and recorded. The results were as Figure 3 shown in Table 2.

[0080] Table 2 Statistics of colon lengths of mice in each group

[0081]

[0082]

[0083] Table 2 and Figure 3 As can be seen, the colon length of mice in the blank control group was significantly longer than that in the DSS model group and the DSS + CFS group, and the colon length of the DSS model group was the shortest. As shown in Table 2, the average colon length of mice in the blank control group was 8.21 cm, the average colon length of mice in the DSS group was 5.85 cm, and the average colon length of the DSS + CFS group was 6.83 cm. This indicates that the colon length of mice with enteritis was significantly longer than that of the DSS model group after intragastric administration of CFS, and the cell-free fermentation freeze-dried product of Lactococcus garvieae ZB15 could improve DSS-induced colitis in mice.

[0084] (3.2) Mouse disease activity index score (Disease activity index, DAI)

[0085] From the start of modeling, the diet, water intake, feces, and body weight of mice were recorded every day. After modeling was completed, the above four indicators were summarized and collated, and the mouse disease activity index was scored according to the DAI scoring criteria (the scoring criteria refer to the literature Cooper, H.S., et al. (1993). Gastroenterology 105(3): 798 - 805). The results are as Figures 4 - 5 shown.

[0086] Figure 4 As can be seen, the body weight of mice in the DSS model group decreased with the prolongation of DSS feeding time, with the largest decline; while the body weight decline of mice in the DSS + CFS group was significantly improved under the action of the cell-free fermentation freeze-dried product of Lactococcus garvieae ZB15.

[0087] The disease activity index (DAI) score of mouse colitis is a commonly used method to evaluate the severity of mouse colitis. This scoring system usually comprehensively evaluates multiple indicators such as the body weight change, stool form, and the presence of mucus and blood in mice. By comparing the DAI scores before and after treatment, the disease condition change of mouse colitis can be intuitively understood. As Figure 5 can be seen, the DAI score of mice in the DSS model group was the highest, exceeding 3.0 at the 7th day, while the DAI score of mice in the DSS + CFS group was less than 3.0, and the decline was obvious.

[0088] (3.3) Determination of mouse serum cytokines

[0089] The serum collected in (2) was taken out from the -80 °C refrigerator, and the contents of the above four cytokines in the serum of the three groups of mice were detected according to the instructions of the interleukin-6 (IL-6), interleukin-1β (IL-1β), tumor necrosis factor α (TNF-α), and interleukin-10 (IL-10) ELISA kits. The results are as Figure 6as shown

[0090] IL-6 is an inflammatory marker factor that can reflect the degree of inflammation and is an important molecular index for evaluating the disease severity of ulcerative colitis (UC). IL-6 is also associated with the determination of the tendency of colon canceration. IL-1β is a powerful cell inflammatory factor with a wide range of biological effects, which participates in local and systemic responses to injury, infection, and inflammation, and can exacerbate the condition of ulcerative colitis. Tumor necrosis factor α (TNF-α) is a pro-inflammatory cytokine mainly produced by macrophages and monocytes, which can aggravate the degree of in vivo inflammatory response and the damage degree of digestive tract tissues and mucosae. Studies have shown that continuous high levels of TNF-α can cause acute colitis and also lead to intestinal barrier dysfunction. IL-10 is a cytokine involved in inflammation and immunosuppression. As an anti-inflammatory factor, it can inhibit the specific immune function of macrophages and enhance immune induction.

[0091] It can be seen from Figure 6 that the contents of IL-6, IL-1β, and TNF-α in the sera of mice in the DSS model group were the highest, and the contents of IL-6, IL-1β, and TNF-α in their sera were significantly decreased after administration of the cell-free fermentation freeze-dried product of Lactococcus garvieae ZB15 to the mice. While the content of IL-10 was the highest in the sera of DSS model mice, indicating that the inflammation in the model mice was more severe; and the content of IL-10 in the sera of mice was significantly decreased after administration of the cell-free fermentation freeze-dried product of Lactococcus garvieae ZB15 to the mice, suggesting that the cell-free fermentation freeze-dried product of Lactococcus garvieae ZB15 improved the inflammatory condition in the mice.

[0092] (3.4) HE staining of colon

[0093] The colons of mice in each group were taken for HE staining, and the results were as Figure 7 shown.

[0094] Figure 7 It can be seen that there were a large number of goblet cells in the colon tissues of mice in the blank control group, and these goblet cells formed obvious crypt structures with complete tissue morphology and few inflammatory factor invasions. The tissue morphology of the colon of mice in the DSS model group was damaged, with a large loss of goblet cells, no complete crypt structure, and a large number of inflammatory factor invasions; the DSS + CFS group significantly improved DSS-induced colitis, with a significant increase in the number of goblet cells, obvious crypt structures, more complete intestinal tissue morphology, and a substantial decrease in the number of inflammatory factors.

[0095] (4) Effects of the fermentation product of Lactobacillus garvieae ZB15 on the intestinal flora of mice

[0096] The colonic contents of the sacrificed mice were collected in a sterile centrifuge tube, quickly transferred to liquid nitrogen for rapid freezing, and then stored in a -80°C freezer for later measurement. The blank control group, DSS model group, and DSS + CFS group were selected for measurement. The bar chart of the colonies at the genus level of the results is as shown in Figure 8 ; Using LEfSe analysis (Linear discriminant analysis Effect Size (LDA>2, P<0.05)) to compare the differences in the phylum-level colonies of the colonic contents of mice in each group, the results are as shown in Figure 9 ; Comparing the differences in the genus-level colonies of the colonic contents of mice in each group, the results are as shown in Figure 10 .

[0097] Figure 8 It can be seen that in the colonic contents of the mice in the blank control group, the bacteria of the genus Muribaculaceae were the most, followed by the genus Lactobacillus, and the genera norank-o-Clostridia_UCG-014 and Dubosiella were the next. There were few harmful bacteria in the blank control group. In the DSS group, the bacteria of the genus Muribaculaceae decreased significantly, and the numbers of the genera Faecalibacterium, Campylobacter, and Escherichia-Shigella increased significantly. Secondly, the number of bacteria of the genus Lachnospira, which has an anti-inflammatory effect, was higher than that in the blank control group. In the DSS + CFS group, the number of bacteria of the genus Muribaculaceae was higher than that in the DSS group, and the bacteria of the genus Faecalibacterium were significantly higher than those in the DSS group. However, the harmful genus Campylobacter decreased significantly, the genus norank-o-Clostridia_UCG-014 increased significantly, the number of the genus Dubosiella was also higher than that in the DSS group, and the number of the genus Turicibacter increased significantly.

[0098] Figure 9It can be seen that the abundance of Firmicutes in the CFS group was significantly higher than that in the DSS group (p < 0.01). As an important part of the intestinal microbial community, Firmicutes is involved in the process of food digestion and absorption and has a profound impact on the health of the host. Some Firmicutes strains are used as probiotics to improve the health of the host by regulating the balance of the intestinal microbial community. For example, certain Lactobacillus and Bifidobacterium belong to Firmicutes and are widely used in food additives and health products to promote intestinal health. Such as Lactobacillus, Faecalibacterium, Eubacterium, Roseburia, etc., which produce acetic acid, lactic acid, butyric acid and antibiotics, can fight against pathogens and are beneficial to human health. Among them, Lactobacillus is one of the few facultative anaerobes in Firmicutes and is relatively common in the small intestinal flora. Butyric acid is the main energy source of intestinal cells and plays an active role in inhibiting inflammation and anti-tumor. The abundance of Bacteroidetes in the blank control group was significantly higher than that in the DSS and CFS groups (p < 0.01). Bacteroidetes is an important part of the intestinal microbiota and plays a key role in fecal microbiota transplantation (FMT) treatment. By transplanting the feces of healthy donors containing Bacteroidetes, the balance of the patient's intestinal flora can be restored, and diseases related to intestinal flora dysregulation, such as ulcerative colitis, can be treated. The abundances of Campylobacterota and Proteobacteria in the DSS group were significantly higher than those in the blank control group and the CFS group (p < 0.01). For example, Escherichia coli, Salmonella, Vibrio cholerae, Helicobacter pylori, etc. can cause intestinal infections, gastritis, gastric ulcers and other diseases. The results at the phylum level are as Figure 9 shown.

[0099] Figure 10 It can be seen that the abundances of the genera Muribaculaceae, Lactobacillus and Bacillus in the blank control group were significantly higher than those in the DSS group and the CFS group (p < 0.01). The abundance of the genus Faecalibacterium in the CFS group was significantly higher than that in the DSS and CFS groups (p < 0.001). In addition, the genus Clostridium in the CFS group was significantly higher than that in the blank control group and the DSS group (p < 0.01). The abundances of the genera Campylobacter and Escherichia-Shigella in the DSS group were significantly higher than those in the blank control group and the CFS group (p < 0.01).

[0100] In summary, after intragastric administration of the cell-free fermentation freeze-dried product of Lactococcus garvieae ZB15 to DSS mice, the number of beneficial bacteria in the intestinal tract of mice can be significantly increased, such as Lactobacillus, Faecalibacterium, Eubacterium, Roseburia, etc. in Firmicutes and Bacteroidetes, and the genera Faecalibacterium and Clostridium at the genus level. The metabolites of these bacteria, such as lactic acid, acetic acid, butyric acid, antimicrobial peptides and other substances, can effectively inhibit the growth of harmful bacteria and improve enteritis at the flora level.

[0101] (5) Effects on mouse intestinal metabolites

[0102] The expression levels of differential metabolites in the intestines of mice in different groups were detected and represented by a volcano plot. The results are asFigure 11 As shown. The metabolites with differences between the CFS group and the blank control group are shown in Table 3.

[0103] Figure 11 It can be seen that compared with the blank control group, there are 75 up-regulated and 314 down-regulated intestinal metabolites in the DSS group of mice; there are 75 up-regulated and 175 down-regulated intestinal metabolites in the CFS group of mice; and when comparing the CFS group with the DSS group, there are 219 up-regulated and 26 down-regulated.

[0104] Table 3 Metabolites with differences between the CFS group and the blank control group

[0105]

[0106] As can be seen from Table 3, the metabolites up-regulated in the intestines of DSS mice after intragastric administration of cell-free fermentation freeze-dried product of Lactococcus garvieae ZB15 are mainly substances with anti-inflammatory and antibacterial effects. Among them, xanthosine, erythrocentaurin, 7-dehydrocholesterol, 27-hydroxycholesterol, 6-hydroxydihydroquercetin and benzocaine have strong antibacterial effects, and N-acetylmuramate, ganoderol A, alisol A, theasapogenol E, etc. have good anti-inflammatory and antioxidant effects.

[0107] The metabolites in the selected metabolic set were compared and analyzed using the Kyoto Encyclopedia of Genes and Genomes database, and the significantly enriched pathways of the metabolites in this metabolic set were obtained using the hypergeometric distribution algorithm. And when P < 0.05, the pathway is significantly enriched. The KEGG pathway set bubble chart is as Figure 12 shown.

[0108] Figure 12 It can be seen that compared with the DSS group, the KEGG pathways of the CFS group are mainly enriched in insulin resistance, tryptophan metabolism, serum neuromedin, HIF-1 signaling pathway, fat digestion and absorption, central carbon metabolism in cancer, insulin secretion, phospholipase D signaling pathway, choline metabolism in cancer, purine metabolism, parathyroid hormone synthesis and secretion, cancer pathway, steroid biosynthesis, ascorbate and aldarate metabolism, FCR-mediated phagocytosis, GnRH signaling pathway, pyrimidine metabolism, bile acid biosynthesis, and nucleotide metabolism. Most of the above pathways are related to cancer, and secondly, mainly pathways of substances with anti-inflammatory and antioxidant effects such as steroids and ascorbic acid. This indicates that CFS can produce corresponding substances through these metabolic pathways to improve enteritis.

[0109] As can be seen from the above embodiments, the present invention provides a strain of Lactococcus garvieae ZB15 and a cell-free fermentation freeze-dried product with anti-inflammatory activity and a preparation method thereof. The Lactococcus garvieae ZB15 of the present invention is deposited in the Guangdong Provincial Culture Collection Center of Microorganisms, located at the 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences. The deposit date is February 27, 2025, and the deposit number is GDMCC No: 65947. The strain of the present invention is a homofermentative type and no virulence genes are detected, and it is a safe food-grade lactic acid bacterium. The Lactococcus garvieae ZB15 of the present invention is fermented and cultured, and the fermentation broth is obtained by centrifugation. Subsequently, the bacterial cells and other impurities are filtered by a filter membrane. Finally, the cell-free fermentation supernatant is freeze-dried to obtain a cell-free fermentation freeze-dried product. The cell-free fermentation freeze-dried product is formulated into a solution with a determined concentration to treat colitis, which not only avoids the direct intake of live bacteria but also determines the intake of the cell-free fermentation freeze-dried product in the patient's body, maximizing the therapeutic effect of the lactic acid bacteria fermentation product while reducing the possible negative effects brought by live bacteria. The present invention uses the cell-free fermentation supernatant obtained by fermenting Lactococcus garvieae ZB15 as an anti-inflammatory active ingredient. This active ingredient does not belong to a chemical preparation and has no negative effects of drugs such as antibiotics. It is a green and natural anti-inflammatory material. By adding the cell-free fermentation freeze-dried product to the mouse diet, the symptoms of mouse colitis can be effectively improved.

[0110] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A strain of Lactococcus garvieae ZB15, characterized in that: It is deposited in Guangdong Microbiological Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences, with the deposit date of February 27, 2025 and the deposit number of GDMCC No: 65947.

2. Use of Lactococcus garvieae ZB15 according to claim 1 in the preparation of products with anti-inflammatory activity.

3. Use of Lactococcus garvieae ZB15 according to claim 1 in preparing a product for treating colitis.

4. A cell-free fermentation freeze-dried product having anti-inflammatory activity, characterized in that: The cell-free fermentation freeze-dried product is obtained by fermenting the Lactococcus garvieae ZB15 according to claim 1 and freeze-drying it.

5. A method for preparing a cell-free fermentation freeze-dried product having anti-inflammatory activity, characterized in that: The steps include: (1) inoculating the Lactococcus garvieae ZB15 described in claim 1 into MRS solid culture medium and culturing at 36-38° C. for 20-28 hours to obtain a single colony; (2) inoculating the single bacterial colony described in step (1) into MRS liquid culture medium, and culturing at 36-38° C. for 20-28 h to obtain a seed solution; inoculating the seed solution into MRS liquid culture medium, and culturing at 36-38° C. for 20-28 h to obtain a working bacterial solution; (3) inoculating the working bacterial liquid into MRS broth medium, culturing at 36-38° C. for 20-28 hours to obtain a fermentation liquid; centrifuging the fermentation liquid, collecting the supernatant, filtering, and taking the filtrate to obtain a cell-free fermentation supernatant; (4) freeze-drying the cell-free fermentation supernatant to obtain a cell-free fermentation freeze-dried product; The freeze drying in step (4) includes precooling and vacuum freezing steps; The precooling temperature is -75 to -85°C, and the precooling time is 18 to 22 hours; The temperature of the vacuum freezing is -45 to -55°C, the vacuum degree of the vacuum freezing is 20 to 40 Pa, and the time of the vacuum freezing is 22 to 26 hours.

6. The preparation method according to claim 5, characterized in that: The inoculation amount of the working bacterial solution in step (3) is 0.5-1.5% of the volume of the MRS broth culture medium.

7. The preparation method according to claim 6, characterized in that: The centrifugal speed in step (3) is 3500-4500 rpm, and the centrifugal time is 15-25 min.

8. The preparation method according to claim 7, characterized in that: The filtration in step (3) is membrane filtration, and the pore size of the membrane is ≤0.22 μm.

9. Use of the cell-free fermentation freeze-dried product according to claim 4 or the cell-free fermentation freeze-dried product prepared by the preparation method according to any one of claims 5 to 8 in preparing a product for treating colitis.

10. Use of the cell-free fermentation freeze-dried product according to claim 4 or the cell-free fermentation freeze-dried product prepared by the preparation method according to any one of claims 5 to 7 in preparing a product having any one or more of the following effects; (i) Reduce anti-inflammatory factors in serum; (ii) Increase the number of anti-inflammatory bacteria in the intestine and inhibit the number of harmful bacteria; (iii) increasing the levels of metabolites with anti-inflammatory and antibacterial effects in the intestine; (iv) activating KEGG pathways with anti-inflammatory and antioxidant effects; The anti-inflammatory factors in the serum include one or more of interleukin-6, interleukin-1β, tumor necrosis factor α and interleukin-10; The intestinal anti-inflammatory bacteria include Firmicutes and / or Bacteroidetes at the phylum level; and include one or more of Bacteroides, Faecalibaculum and Lactobacillus at the genus level; The harmful bacteria include Campylobacter and / or Escherichia-Shigella; The metabolites include one or more of xanthosine, rubrocephalosin, 7-dehydrocholesterol, 27-hydroxycholesterol, 6-hydroxydihydroquercetin, benzocaine, N-acetylmuramic acid ester, ganoderin A, alismatol A and tea saponin E; The pathways with anti-inflammatory and antioxidant effects include one or more of insulin resistance, tryptophan metabolism, serum neurotrophins, HIF-1 signaling pathway, fat digestion and absorption, cancer central carbon metabolism, insulin secretion, phospholipase D signaling pathway, cancer choline metabolism, purine metabolism, parathyroid hormone synthesis and secretion, cancer pathways, steroid biosynthesis, ascorbic acid and aldehyde salt metabolism, FCR-mediated phagocytosis, GmRH signaling pathway, pyrimidine metabolism, bile acid biosynthesis and nucleotide metabolism.

Citation Information

Patent Citations

  • Lactococcus gasseri for preventing or treating diarrhea and application of lactococcus gasseri

    CN116004483A

  • Lactococcus gasseri SHAMU-LG6 with broad-spectrum antibacterial activity and application of lactococcus gasseri SHAMU-LG6

    CN116515715A

  • Application of Lactococcus gasseri SHAMU-LG6 in preparation of anti-inflammatory and anti-oxidation products

    CN116650536A

  • Lactococcus gasseri LG3092 capable of producing bacteriocin GarQ and efficiently antagonizing multidrug-resistant helicobacter pylori and application of lactococcus gasseri LG3092

    CN117660238A

  • Lactococcus lactis ZB11 with bacteriostatic activity, cell-free fermentation supernatant and preparation method of cell-free fermentation supernatant

    CN119144477A

Cited By

  • Black-bone chicken liver hydrolyzed peptide capable of improving ulcerative colitis as well as preparation method and application of black-bone chicken liver hydrolyzed peptide

    CN119979649A

  • Application of lactococcus gasseri ZB15 in degradation of kitasamycin

    CN122059546A

  • Application of lactococcus garviae zb15 in degrading kitasamycin

    CN122059546B