Strain construction method for improving yield of L-tryptophan of escherichia coli and application

Abstract

The invention discloses a strain construction method for improving the yield of L-tryptophan of escherichia coli and application, and belongs to the technical field of microbial engineering. The invention provides a construction process and an application method of a recombinant strain for improving the yield of L-tryptophan. The construction process specifically comprises the following steps: carrying out ARTP treatment in escherichia coli MG1655, and screening by using a TnaC biosensor to obtain an L-tryptophan producing strain Trp1. The L-tryptophan production strain Trp4 is obtained by blocking a by-product pathway affecting L-tryptophan synthesis, overexpressing key enzyme in a tryptophan synthesis pathway and supplying a precursor required by the synthesis pathway. The recombinant strain can produce 70.54 g / L of L-tryptophan by taking glucose as a substrate and fermenting in a 5L fermentation tank for 48 hours, and the conversion rate reaches 18.77%.

Description

Technical Field

[0001] The present invention relates to a method for constructing a strain for improving the yield of L-tryptophan in Escherichia coli and its application, belonging to the technical field of microbial engineering. Background Art

[0002] L-tryptophan is one of the eight essential amino acids for normal physiological activities of humans and animals, belonging to aromatic amino acids. It has been widely used in the fields of medicine, food, feed, etc., and has a huge market demand. Tryptophan participates in the metabolism in the body and can synthesize important bioactive substances such as 5-hydroxytryptamine, nicotinic acid, indole, alkaloids, coenzymes, etc.; relevant research reports show that L-tryptophan also has antidepressant, sleep quality improvement, antihypertensive and analgesic effects. In the food industry, tryptophan is often used as a flavoring agent, additive and antioxidant, etc., to improve food flavor, enhance umami, and prevent food spoilage. In the feed field, the addition of tryptophan has a significant effect on improving the growth rate and disease resistance of livestock, and can regulate the stress behavior of fish and improve the intestinal microbial environment of cattle, improving animal productivity, etc.

[0003] With the continuous development of biotechnology and metabolic engineering, the production of L-tryptophan by microbial fermentation has become a hot topic. However, due to the rather complicated metabolic regulation mechanism of the biosynthesis of L-tryptophan, current L-tryptophan-producing strains generally have problems such as more by-product accumulation and low product yield, which restricts the development of industrial production of L-tryptophan.

[0004] At present, the improvement of the yield of L-tryptophan still faces bottlenecks. For example, in the Chinese patent application text with the publication number CN117802021A, it is pointed out that the protein sequence expressed by the fadR gene or the protein sequence expressed by the pepD gene in the starting strain is modified. These modifications make the obtained engineered strain have a higher tryptophan yield compared with the starting strain. In the case of large-scale production, the tryptophan yield in a 5L fermenter reaches 62.38±5.80 g / L, and the sugar-acid conversion rate is 24.1%; although the sugar-acid conversion rate is increased, the yield is still not very high. To meet the market demand for L-tryptophan, it is urgent to strengthen the breeding of high-yield L-tryptophan engineering strains and vigorously develop and improve the fermentation production process of L-tryptophan. Summary of the Invention

[0005] Aiming at the deficiencies of the above-mentioned prior art, the present invention provides a construction method and application for improving the yield of L-tryptophan in Escherichia coli, aiming to solve the technical problems of low fermentation yield and high by-product level of existing L-tryptophan strains.

[0006] The present invention provides an Escherichia coli Trp1, which was deposited at the China Center for Type Culture Collection on March 3, 2025, with the deposit number CCTCC NO: M 2025337.

[0007] The present invention also provides a microbial inoculum, which contains Escherichia coli Trp1 or its fermentation broth, or freeze-dried powder containing Escherichia coli Trp1, or inactivated cells of Escherichia coli Trp1, or lysates containing Escherichia coli Trp1, or extracts containing Escherichia coli Trp1, and the fermentation broth contains Escherichia coli Trp1.

[0008] The present invention provides a recombinant Escherichia coli for producing L-tryptophan. Using wild-type Escherichia coli MG1655 as the starting strain, a strain Trp1 producing L-tryptophan was screened by ARTP mutagenesis, and the key enzymes aroG FBR and trpE FBR that are de-repressed in the synthesis pathway are overexpressed in the strain Trp1, and the deposit number of the strain Trp1 is CCTCC M 2025337.

[0009] In one embodiment, the ppsA gene, pck gene, zwf gene, and tktA gene are also integrated and expressed on the genome of the strain Trp1 simultaneously.

[0010] In one embodiment, the ppsA gene is integrated at the ldhA locus of the strain Trp1; the pck gene is integrated at the poxB locus; the zwf gene is integrated at the pflB locus; the tktA gene is integrated at the ynck locus.

[0011] In one embodiment, the glnA gene encoding glutamine synthetase and the de-repressed serA FBR gene encoding 3-phosphoglyceraldehyde dehydrogenase are overexpressed in the strain Trp1 simultaneously; the transcriptional regulator purR is knocked out and the prs gene encoding ribose phosphate diphosphate kinase is overexpressed.

[0012] In one embodiment, the purpose of the modification is:

[0013] (1) The lacI gene is deleted to enable the use of the strong promoter Ptrc to express genes in the strain; the key enzymes aroG FBR and trpE FBR that are de-repressed in the synthesis pathway are overexpressed at the pseudogene loci gapC and gapC to obtain the strain Trp2.

[0014] (2) To reduce the loss of PEP in the L-tryptophan synthesis pathway and enhance the supply of PEP and E4P, the ppsA gene was integrated at the ldhA gene locus, the pck gene was integrated at the poxB gene locus, the zwf gene was integrated at the pflB gene locus, and the tktA gene was integrated at the pseudogene ynck locus, resulting in strain Trp3.

[0015] (3) To supplement the precursors glutamine, serine, and PRPP required in the L-tryptophan synthesis pathway, the glnA gene encoding glutamine synthetase was overexpressed at the pseudogene ycgH locus, the serA FBR gene encoding 3-phosphoglycerate dehydrogenase was overexpressed at the pseudogene wbbL locus, and the prs gene encoding ribose phosphate diphosphate kinase was overexpressed at the transcriptional regulator purR locus, resulting in strain Trp4.

[0016] In one embodiment, the sequence of the aroG FBR gene is as shown in SEQ ID NO.1, and the gene sequence of trpE FBR is as shown in SEQ ID NO.2, and the gene sequence of serA FBR is as shown in SEQ ID NO.3.

[0017] Other genes integrated in the present invention are all genes in the Escherichia coli MG1655 genome.

[0018] In one embodiment, the aroG FBR gene, trpE FBR gene, ppsA gene, pck gene, zwf gene, tktA gene, glnA gene, serA FBR gene, and prs gene are all driven by the strong promoter Ptrc to express genes.

[0019] The present invention also provides a genetically engineered recombinant Escherichia coli for producing L-tryptophan. The recombinant Escherichia coli uses the Escherichia coli Trp1 described in claim 1 as the starting strain, knocks out the lacI gene on the genome, and overexpresses aroG S180F , trpE S40F in Escherichia coli Trp1; at the same time, the ppsA gene, pck gene, zwf gene, tktA gene, glnA gene, serA H344A / N364A gene, and prs gene are also integrated and expressed on the Escherichia coli Trp1 genome.

[0020] In one embodiment, the recombinant Escherichia coli uses the Escherichia coli Trp1 described in claim 1 as the starting strain, knocks out the lacI gene on the genome, and integrates and expresses aroG at the gapC locus on the Escherichia coli Trp1 genomeS180F Genes, integrating and expressing trpE at the yeeL locus S40F Genes, integrating and expressing the ppsA gene at the ldhA locus, integrating and expressing the pck gene at the poxB locus, integrating and expressing the zwf gene at the pflB locus, integrating and expressing the tktA gene at the ynck locus, integrating and expressing the glnA gene at the ycgH locus, integrating and expressing serA at the wbbL locus H344A / N364A Genes, integrating and expressing the prs gene at the purR locus.

[0021] In one embodiment, the NCBI number of the lacI gene is: 945007; the NCBI number of the gapC locus is: 2847738; the NCBI number of the yeeL locus is: 2847764; the NCBI number of the ldhA locus is: 946315; the NCBI number of the poxB locus is: 946132; the NCBI number of the pflB locus is: 945514; the NCBI number of the ynck locus is: 4056028; the NCBI number of the ycgH locus is: 2847703; the NCBI number of the wbbL locus is: 4056030; the NCBI number of the purR locus is: 945226;

[0022] Preferably, the aroG S180F gene is a nucleotide sequence encoding the sequence shown in SEQ ID NO.1 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having aroG protein activity;

[0023] The trpE S40F gene is a nucleotide sequence encoding the sequence shown in SEQ ID NO.2 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having trpE protein activity;

[0024] The ppsA gene is a nucleotide sequence having the NCBI number: 946209 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having ppsA protein activity;

[0025] The pck gene is a nucleotide sequence having the NCBI number: 945667 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having pck protein activity;

[0026] The zwf gene is a nucleotide sequence having the NCBI number: 946370 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having zwf protein activity;

[0027] The tktA gene is a nucleotide sequence containing the NCBI number: 947420 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having tktA protein activity;

[0028] The glnA gene is a nucleotide sequence containing the NCBI number: 948370 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having glnA protein activity;

[0029] The said serA H344A / N364A gene is a nucleotide sequence encoded by the sequence shown in SEQ ID NO.3 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having serA protein activity;

[0030] The prs gene is a nucleotide sequence containing the NCBI number: 945772 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having prs protein activity.

[0031] The present invention provides a method for preparing L-tryptophan, and the solution is to ferment and produce L-tryptophan using recombinant Escherichia coli.

[0032] In one embodiment, during the production of L-tryptophan, the activated recombinant Escherichia coli bacterial solution is inoculated into a secondary seed medium at an inoculation amount of 8-10%, and cultured at 36-37 °C until OD 600 reaches 12-18; then inoculated into a fermentation medium at an inoculation amount of 10-15%, and cultured at 36-37 °C for 40-48 hours. The dissolved oxygen is controlled at 28-35% from 0 to 9 hours after the start of fermentation, and the dissolved oxygen is controlled at 18-25% after 9 hours.

[0033] In one embodiment, the secondary seed medium formula is 20-30 g / L of glucose, 1-3 g / L of magnesium sulfate heptahydrate, 4-6 g / L of potassium dihydrogen phosphate, 8-10 g / L of dipotassium hydrogen phosphate, 4-6 g / L of ammonium sulfate, 8-10 g / L of yeast extract powder, 1-3 g / L of citric acid monohydrate, and 10-20 mg / L of ferrous sulfate heptahydrate.

[0034] In one embodiment, the fermentation medium formulation is 8 - 12 g / L of glucose, 2 - 4 g / L of magnesium sulfate heptahydrate, 8 - 10 g / L of potassium dihydrogen phosphate, 10 - 12 g / L of dipotassium hydrogen phosphate, 4 - 6 g / L of ammonium sulfate, 4 - 8 g / L of yeast extract powder, 2 - 4 g / L of citric acid monohydrate, 20 - 30 mg / L of ferrous sulfate heptahydrate, 20 - 30 mg / L of manganese sulfate monohydrate, and 0.05 - 0.1 mg / L of copper sulfate pentahydrate.

[0035] Beneficial effects

[0036] (1) The present invention provides a process for constructing a recombinant strain for improving the production of L - tryptophan and an application method. Specifically, a strain of L - tryptophan - producing bacterium Trp1 was screened in Escherichia coli MG1655 by ARTP treatment and using the TnaC biosensor. By blocking the by - product pathways that affect L - tryptophan synthesis, overexpressing the key enzymes in the tryptophan synthesis pathway, and supplying the precursors required for the synthesis pathway, the L - tryptophan - producing strain Trp4 was obtained. Using glucose as a substrate, after 48 - hour fermentation in a 5 - L fermenter, this recombinant strain can produce 70.54 g / L of L - tryptophan, and the sugar - acid conversion rate reaches 18.77%.

[0037] (2) The present invention constructs a strain with high - yield L - tryptophan. Under the condition of a relatively high sugar - acid conversion rate, it has achieved fermentation in a 5 - L fermenter and produced a high yield of 70.54 g / L of L - tryptophan, laying a foundation for the development of the food industry.

[0038] Biological material preservation

[0039] A strain of Escherichia coli, taxonomically named Escherichia coli Trp1, was deposited at the China Center for Type Culture Collection on March 3, 2025. The deposit number is CCTCC NO: M2025337, and the deposit address is Wuhan University, Wuhan, China. Brief description of the drawings

[0040] Figure 1 It is the construction idea of recombinant Escherichia coli Trp4. Detailed implementation manners

[0041] Technical terms:

[0042] "Genetically modified" refers to a strain that has been artificially changed by biological means and has one or more changes compared with the initial strain before modification, such as gene deletion, amplification, or mutation, thus having changed biological properties such as improved production performance.

[0043] Initial strain: It can be a natural strain to be genetically modified or a strain with other genetic modifications.

[0044] Recombinant: When used in reference to a cell, nucleic acid, protein, or vector, the term "recombinant" means that it has been modified from its natural state. Thus, for example, a recombinant cell expresses a gene not found in a cell in its natural (non-recombinant) form, or expresses a natural gene at a different level or under different conditions compared to that found in nature. A recombinant nucleic acid differs from a natural sequence by one or more nucleotides and / or is operably linked to a heterologous sequence (e.g., a heterologous promoter in an expression vector). A recombinant protein differs from a natural sequence by one or more amino acids and / or is fused to a heterologous sequence. A vector containing a nucleic acid encoding a polypeptide is a recombinant vector. The terms "recombinant" are synonymous with "genetically modified" and "transgenic".

[0045] Gene knockout is a method to disable a certain gene in an organism through specific technical means, and gene knockout is mainly achieved based on homologous recombination or gene editing tools (such as CRISPR-Cas9). The homologous recombination method utilizes the homologous recombination of an exogenous DNA fragment with a gene having the same or similar sequence in the genome of the recipient cell, thereby replacing the corresponding gene sequence in the genome of the recipient cell. The CRISPR-Cas9 technology, on the other hand, introduces double-strand breaks (DSBs) in the target gene through a guide RNA (gRNA) to guide the Cas9 endonuclease. During the repair process of the cell, insertions or deletions may be introduced, resulting in the loss of gene function.

[0046] The gene knockout of the present invention completely knocks out the gene and integrates other genes at this site; conventional technical means in the art can be adopted.

[0047] The following describes the preferred embodiments of the present invention. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0048] It will be recognized from the foregoing that the present disclosure can be embodied in various ways, including but not limited to the following:

[0049] Example 1: A strain of Escherichia coli was deposited at the China Center for Type Culture Collection on March 3, 2025, with the deposit number CCTCC NO: M 2025337.

[0050] Example 2: A microbial inoculant contains Escherichia coli Trp1 or its fermentation broth, or freeze-dried powder containing Escherichia coli Trp1, or inactivated cells of Escherichia coli Trp1, or lysates containing Escherichia coli Trp1, or extracts containing Escherichia coli Trp1, and the fermentation broth contains Escherichia coli Trp1.

[0051] Example 3: A genetically engineered recombinant Escherichia coli for producing L-tryptophan. The recombinant Escherichia coli uses Escherichia coli Trp1 as the starting strain, knocks out the lacI gene on the genome, and overexpresses aroG in Escherichia coli Trp1 S180F , trpE S40F ; meanwhile, the ppsA gene, pck gene, zwf gene, tktA gene, glnA gene, serA H344A / N364A gene and prs gene are also integrally expressed on the Escherichia coli Trp1 genome.

[0052] Example 4: A genetically engineered recombinant Escherichia coli for producing L-tryptophan. The recombinant Escherichia coli uses Escherichia coli Trp1 as the starting strain, knocks out the lacI gene on the genome, and integrally expresses aroG at the gapC locus on the Escherichia coli Trp1 genome S180F gene, integrally expresses trpE at the yeeL locus S40F gene, integrally expresses the ppsA gene at the ldhA locus, integrally expresses the pck gene at the poxB locus, integrally expresses the zwf gene at the pflB locus, integrally expresses the tktA gene at the ynck locus, integrally expresses the glnA gene at the ycgH locus, integrally expresses serA H344A / N364A gene, and integrally expresses the prs gene at the purR locus.

[0053] Example 5: A genetically engineered recombinant Escherichia coli for producing L-tryptophan. Using Escherichia coli Trp1 as the starting strain, it knocks out the lacI gene with NCBI number 945007 on the genome, and integrally expresses aroG (SEQ ID NO.1) at the gapC locus with NCBI number 2847738 on the Escherichia coli Trp1 genome, and integrally expresses trpE at the yeeL locus with NCBI number 2847764 S180F gene, and integrally expresses serA S40FThe gene, (SEQ ID NO.2), integrates and expresses the ppsA gene with NCBI number 946209 at the ldhA locus with NCBI number 946315, integrates and expresses the pck gene with NCBI number 945667 at the poxB locus with NCBI number 946132, integrates and expresses the zwf gene with NCBI number 946370 at the pflB locus with NCBI number 945514, integrates and expresses the tktA gene with NCBI number 947420 at the ynck locus with NCBI number 4056028, integrates and expresses the glnA gene with NCBI number 948370 at the ycgH locus with NCBI number 2847703, and integrates and expresses serA at the wbbL locus with NCBI number 4056030 H344A / N364A The gene (SEQ ID NO.3) integrates and expresses the prs gene with NCBI number 945772 at the purR locus with NCBI number 945226;

[0054] Finally, the strain obtained is: E.coli Trp1ΔlacIΔgapC::aroG S180F ΔyeeL::trpE S40F ΔldhA::ppsAΔpoxB::pckΔpflB::zwfΔyncK::tktAΔycgH::glnAΔwbbL::serA H344A / N364A ΔpurR::prs.

[0055] Example 6: The recombinant Escherichia coli described in Example 5, wherein the aroG S180F gene, trpE S40F gene, ppsA gene, pck gene, zwf gene, tktA gene, glnA gene, serA H344A / N364A gene, and prs gene are all driven by the strong promoter Ptrc to express the gene;

[0056] The sequence of the P trc promoter is: TTGACAATTAATCATCCGGCTCGTATAATG

[0057] The obtained recombinant Escherichia coli is:

[0058] E.coli Trp1ΔlacIΔgapC::P trc -aroG S180F ΔyeeL::P trc -trpE S40F ΔldhA::P trc -ppsAΔpoxB::P trc -pckΔpflB::Ptrc -zwfΔyncK::P trc -tktAΔycgH::P trc -glnAΔwbbL::P trc -serA H344A / N364A ΔpurR::P trc -prs。

[0059] Example 7: A method for constructing a recombinant Escherichia coli with high yield of L-tryptophan or high conversion rate of gluconic acid. The method is as follows: using Escherichia coli Trp1 as the starting strain, knocking out the lacI gene on the genome, and overexpressing aroG S180F 、trpE S40F in Escherichia coli Trp1; at the same time, the ppsA gene, pck gene, zwf gene, tktA gene, glnA gene, serA H344A / N364A gene and prs gene are also integrally expressed on the genome of Escherichia coli Trp1.

[0060] Integrally express aroG S180F gene at the gapC locus on the genome of Escherichia coli Trp1, express trpE S40F gene at the yeeL locus, express the ppsA gene at the ldhA locus, express the pck gene at the poxB locus, express the zwf gene at the pflB locus, express the tktA gene at the ynck locus, express the glnA gene at the ycgH locus, express serA H344A / N364A gene at the wbbL locus, and express the prs gene at the purR locus.

[0061] Example 8: Application of Escherichia coli Trp1 in the preparation of a strain with high yield of L-tryptophan.

[0062] Example 9: A method for preparing L-tryptophan. The method is as follows: using any one of the recombinant Escherichia coli described in Examples 3-6, or the recombinant Escherichia coli constructed by the method described in Example 7, and fermenting to prepare L-tryptophan.

[0063] Example 10: According to the method described in Example 9, the specific preparation method is as follows:

[0064] (1) Preparation of seed liquid

[0065] Inoculate the activated recombinant Escherichia coli liquid into the secondary seed medium according to an inoculation amount of 8-10%, and culture at 35-37 °C until OD 600from 12 - 18; further, the inoculation amount can be: 8%, 9%, 10%; the culture temperature can be 36 - 37 °C; the OD value can be 13 - 18, 14 - 18, 15 - 18, 16 - 18, 17 - 18;

[0066] The formula of the secondary seed culture medium is 20 - 30 g / L of glucose, 1 - 3 g / L of magnesium sulfate heptahydrate, 4 - 6 g / L of potassium dihydrogen phosphate, 8 - 10 g / L of dipotassium hydrogen phosphate, 4 - 6 g / L of ammonium sulfate, 8 - 10 g / L of yeast extract powder, 1 - 3 g / L of citric acid monohydrate, and 10 - 20 mg / L of ferrous sulfate heptahydrate.

[0067] (2) Fermentation to prepare L - tryptophan

[0068] Inoculate the prepared seed liquid into the fermentation medium at an inoculation amount of 10 - 15%, and culture at 36 - 37 °C for 40 - 48 hours. Control the dissolved oxygen at 28 - 35% from 0 - 9 hours after the start of fermentation, and control the dissolved oxygen at 18 - 25% after 9 hours. Further, the inoculation amount can be: 11%, 12%, 13%, 14%, 15%;

[0069] The formula of the secondary seed culture medium is: 25 g / L of glucose, 1 g / L of magnesium sulfate heptahydrate, 4 g / L of potassium dihydrogen phosphate, 8 g / L of dipotassium hydrogen phosphate, 5 g / L of ammonium sulfate, 8 g / L of yeast extract powder, 2 g / L of citric acid monohydrate, and 20 mg / L of ferrous sulfate heptahydrate

[0070] Example 11: According to the method described in Example 9 or 10, the fermentation conditions are: reacting at 30 - 40 °C for at least 24 h;

[0071] Preferably, the temperature condition of the fermentation is to react at 35 - 37 °C; or to react at 30 - 31 °C; or to react at 32 - 33 °C; or to react at 34 - 35 °C; or to react at 36 - 37 °C; or to react at 38 - 39 °C:

[0072] Preferably, the fermentation time is 24 h - 54 h; more preferably 48 h.

[0073] Example 12: The application of the recombinant Escherichia coli described in any one of Examples 3 - 6, or the recombinant Escherichia coli constructed by the method described in Example 7, in the preparation of L - tryptophan or products containing L - tryptophan.

[0074] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art; the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0075] In the following embodiments, the primers shown in Table 1 were used.

[0076] Table 1 Primer Information

[0077]

[0078]

[0079] The genotype of the strain constructed by the present invention is shown in Table 2:

[0080] Table 2: Gene Construction Table

[0081] Strain Genotype Trp1 E.coli MG1655 (mutagenized) Trp2 <![CDATA[Trp1+ΔlacIΔgapC::aroG S180F ΔyeeL::trpE S40F > Trp3 Trp2+ΔldhA::ppsAΔpoxB::pckΔpflB::zwfΔyncK::tktA Trp4 <![CDATA[Trp3+ΔycgH::P trc -glnAΔwbbL::P trc -serA H344A / N364A ΔpurR::P trc -prs]]>

[0082] The test methods involved in the following embodiments:

[0083] Detection method of L-tryptophan:

[0084] OPA pre-column derivation reversed-phase high performance liquid chromatography-ultraviolet detection method.

[0085] The instrument used was an Agilent 1260 high performance liquid chromatography system (Agilent Technologies, USA), including an online degassing device, a quaternary pump, an autosampler, and a VWD detector. Mobile phase A was 27.6 mmol / L sodium acetate-triethylamine-tetrahydrofuran (volume ratio 500:0.11:2.5) (pH = 7.2); mobile phase B was mmol / L sodium acetate-methanol-acetonitrile (volume ratio 1:2:2) (pH = 7.2).

[0086] The detection conditions were: the chromatographic column used was Diamonsil 5μm C18(2), 250x 4.6mm; gradient elution was adopted: 0 min, 8% B; 17 min, 50% B; 20.1 min, 100% B; 24 min, 0% B. The flow rate of the mobile phase was 1.0 mL / min; the column temperature was 40°C; the detection wavelength of the ultraviolet detector (VWD) was 338 nm.

[0087] Calculation method of sugar acid conversion rate:

[0088] Total yield of L-tryptophan (g) / Total consumption of glucose (g) * 100%

[0089] Example 1: Obtaining of Recombinant Escherichia coli Trp1

[0090] ARTP mutagenesis was used to screen the recombinant Escherichia coli Trp1 producing L-tryptophan; the specific steps are as follows:

[0091] 1. ARTP mutagenesis:

[0092] The starting strain Escherichia coli MG1655 was cultured in LB liquid medium until the OD 600 was 0.6 - 0.8; then the supernatant was removed by centrifugation, and the cells were washed with an equal volume of sterile normal saline to obtain a cell suspension; 10 μL of the cell suspension was evenly spread on a sterile stainless steel slide, the radio frequency power of the ARTP mutagenesis breeding instrument was adjusted to 120 W, the carrier gas flow rate was 10 SLM, the mutagenesis time was 0 - 60 s for mutagenesis; the mutagenized cells were eluted and collected, and spread on a plate to obtain a mutant library.

[0093] 2. Screening of L-tryptophan-producing strains:

[0094] The mutant library was screened by fluorescence using the TnaC biosensor system (described in Fang M, Wang T, Zhang C, Bai J, Zheng X, Zhao X, Lou C, Xing XH. Intermediate-sensor assisted push-pull strategy and its application in heterologous deoxyviolacein production in Escherichia coli. Metab Eng. 2016 Jan; 33: 41 - 51. doi: 10.1016 / j.ymben.2015.10.006. Epub 2015 Oct 23. PMID: 26506462.), and mutants with fluorescence intensity significantly higher than that of the starting strain were selected for shake flask rescreening;

[0095] Finally, a dominant mutant strain was screened, named Escherichia coli Trp1 (E. coli Trp1), and the strain was preserved, with the preservation number of CCTCC NO: M 2025337.

[0096] 3. Fermentation of Escherichia coli Trp1 and wild-type Escherichia coli MG1655 to prepare L-tryptophan

[0097] The specific method is as follows:

[0098] 1. Preparation of seed solution

[0099] (1) Flat plate activation: Take the strains Trp1 and wild-type Escherichia coli MG1655 stored at -80°C and thaw them on ice. Use a sterile inoculation loop to pick up a loop of bacterial liquid and streak it on a solid LB medium, then place it in an incubator at 37°C and incubate it upside down for 16 hours.

[0100] (2) Shake flask seed culture: Use a sterile inoculation loop to pick up a loop of colonies from the activated flat plate and inoculate them into the seed medium, and culture them at 37°C and 200 rpm for 12 hours.

[0101] The formula of the shake flask seed medium is: glucose 25 g / L, magnesium sulfate heptahydrate 1 g / L, potassium dihydrogen phosphate 4 g / L, dipotassium hydrogen phosphate 8 g / L, ammonium sulfate 5 g / L, yeast extract powder 8 g / L, citric acid monohydrate 2 g / L, ferrous sulfate heptahydrate 20 mg / L.

[0102] 2. Shake flask fermentation culture:

[0103] Take the completed seed liquid and inoculate it into the fermentation medium at an inoculation amount of 10% (v / v), and culture it at 37°C and 200 rpm for 48 hours. Regularly add ammonia water to control the pH, and regularly add glucose to supplement the carbon source.

[0104] The formula of the fermentation medium is: glucose 10 g / L, magnesium sulfate heptahydrate 3 g / L, potassium dihydrogen phosphate 8 g / L, dipotassium hydrogen phosphate 10 g / L, ammonium sulfate 5 g / L, yeast extract powder 6 g / L, citric acid monohydrate 4 g / L, ferrous sulfate heptahydrate 30 mg / L, manganese sulfate monohydrate 20 mg / L, copper sulfate pentahydrate 0.05 mg / L.

[0105] The results show that:

[0106] The shake flask yield of L-tryptophan of Escherichia coli Trp1 is 4.78 g / L, and the shake flask yield of L-tryptophan of wild-type Escherichia coli MG1655 is 0.24 g / L.

[0107] Example 2: Construction of recombinant Escherichia coli Trp4 with high yield of L-tryptophan

[0108] 1. Gene knockout (taking the knockout of lacI as an example)

[0109] (1) Construction of homologous arms for gene knockout

[0110] Select a base sequence of about 350 - 500 bp at the positions 500 bp upstream and 500 bp downstream of the lacI gene (Gene ID: 945007) in the genome of Escherichia coli MG1655 as the homologous arms for homologous recombination. Use two pairs of primers, UP-lacI-F and UP-lacI-R, DO-lacI-F and DO-lacI-R, to amplify the upstream and downstream homologous arm fragments on both sides of the lacI gene respectively according to the high-fidelity enzyme usage method in the common PCR amplification program.

[0111] Using the upstream and downstream fragments of lacI as templates, use a pair of primers, UP-lacI-F and DO-lacI-R, to obtain the fused fragment UP-lacI-DO according to the high-fidelity enzyme usage method in the common PCR amplification program.

[0112] (2) Construction of the lacI-sgRNA recombinant plasmid

[0113] Using the vector pGRB as a template, use the primers pGRB-F and pGRB-R to obtain the linearized vector L-pGRB according to the high-fidelity enzyme usage method in the common PCR amplification program. Connect the designed lacI-sgRNA with the linearized vector L-pGRB according to the usage method of the homologous recombination enzyme to construct the plasmid pGRB-lacI-sgRNA.

[0114] (3) Construction of recombinant Escherichia coli with lacI knocked out

[0115] Transform the Cas9 plasmid into Escherichia coli Trp1 (E.coli Trp1) obtained in Example 1. Then transform the recombinant plasmid pGRB-lacI-sgRNA and the fused fragment UP-lacI-DO into the strain Trp1 containing the Cas9 plasmid. Select the primers UP-lacI-F and DO-lacI-R for colony PCR to screen for positive transformants, and confirm that the fused fragment UP-lacI-DO is successfully integrated at the lacI locus. Then add 2 mM arabinose and culture at 30 °C for 12 h to remove the recombinant plasmid pGRB-lacI-sgRNA, and obtain the recombinant strain Trp1+ΔlacI (E.coli Trp1ΔlacI).

[0116] 2. Gene site-directed mutagenesis

[0117] (1) aroG S180F Obtaining of the fragment:

[0118] aroG S180F The nucleotide sequence of the fragment is shown in SEQ ID NO.1:

[0119]

[0120] The said fragment can be directly sent to a biological company for synthesis, or can be prepared through a PCR amplification procedure. The following gives an implementation method:

[0121] 1) Select the aroG (Gene ID: 945605) gene in the genome of Escherichia coli MG1655, and use the upstream and downstream primers pET-aroG-F and pET-aroG-R with homologous arms of the pET28a plasmid to amplify the aroG-pET fragment on a common PCR amplification procedure according to the usage method of high-fidelity enzyme.

[0122] 2) Using the pET28a plasmid as a template, use the primers pET-F and pET-R to obtain the linearized vector L-pET on a common PCR amplification procedure according to the usage method of high-fidelity enzyme. Connect and construct the fragment aroG-pET obtained in (1) according to the usage method of homologous recombination enzyme to obtain the plasmid pET28a-aroG.

[0123] 3) Using the plasmid pET28a-aroG as a template, use the primers aroG180-F and aroG180-R to obtain the linearized vector L-pET-aroGMT on a common PCR amplification procedure according to the usage method of high-fidelity enzyme, and then directly transform it into Escherichia coli JM109 to obtain the recombinant plasmid L-pET-aroGMT.

[0124] 4) Using the plasmid L-pET-aroGMT as a template, use the primers aroGMT-F and aroGMT-R to obtain the site-directed mutagenized aroG S180F fragment (nucleotide sequence as shown in SEQ ID NO.1).

[0125] (2) trpE S40F Obtaining of the fragment:

[0126] As described in (1), using the same method, obtain the site-directed mutagenized trpE S40F fragment (nucleotide sequence as shown in SEQ ID NO.2), or can also directly send it to a biological company to synthesize the trpE S40F fragment with the nucleotide sequence as shown in SEQ ID NO.2.

[0127] SEQ ID NO.2:

[0128]

[0129] (3) serA H344A / N364A Obtaining of the fragment:

[0130] As described in (1), using the same method, the site-directed mutagenesis serA H344A / N364A fragment (the nucleotide sequence is shown in SEQ ID NO.3) can also be directly sent to a biological company to synthesize serA with the nucleotide sequence shown in SEQ ID NO.3 H344A / N364A fragment.

[0131] SEQ ID NO.3:

[0132]

[0133] 3. Gene integration (taking the knockout of gapC and the integration of aroG S180F as an example)

[0134] (1) Select about 350 - 500 bp of base sequences at the positions 500 bp upstream and 500 bp downstream of the pseudogene gapC (Gene ID: 2847738) gene in the genome of Escherichia coli MG1655 as the homologous arms for homologous recombination. Use two pairs of primers, UP-gapC-F and UP-gapC-R, DO-gapC-F and DO-gapC-R, and amplify the upstream and downstream homologous arm fragments on both sides of the gapC gene respectively according to the usage method of high-fidelity enzymes in the common PCR amplification program.

[0135] (2) Using the upstream and downstream homologous arm fragments on both sides of the gapC gene obtained in (1) and the S180F aroG fragment as templates, use a pair of primers, UP-gapC-F and DO-gapC-R, and obtain the fused fragment gapC-aroGMT according to the usage method of high-fidelity enzymes in the common PCR amplification program.

[0136] (3) Using the vector pGRB as a template, utilize the primers pGRB-F and pGRB-R, and obtain the linearized vector L-pGRB according to the usage method of high-fidelity enzymes in the common PCR amplification program. Connect the designed gapC-sgRNA with the linearized vector L-pGRB according to the usage method of homologous recombinase to construct pGRB-gapC-sgRNA.

[0137] (4) Transform the recombinant plasmid pGRB-gapC-sgRNA and the fused fragment UP-gapC-DO into the recombinant strain Trp1+ΔlacI containing the Cas9 plasmid. Select the primers UP-gapC-F and DO-gapC-R for colony PCR to screen positive transformants, and confirm that the fused fragment UP-gapC-DO is successfully integrated at the gapC locus; then add 2 mM arabinose and culture at 30 °C for 12 h to remove the recombinant plasmid pGRB-gapC-sgRNA, and obtain the recombinant strain Trp1+ΔlacIΔgapC::aroG FBR (E.coli Trp1ΔlacIΔgapC::aroG S180F ).

[0138] 4. According to the method described in 1 - 3, in the recombinant strain Trp1+ΔlacIΔgapC::aroG FBR (E.coli Trp1ΔlacIΔgapC::aroG S180F)Design primers to knockout yeeL (NCBI accession number: 2847764) and integrate site-directed mutagenesis of trpE S40F , to obtain the L-tryptophan-producing strain Trp2 (E. coli Trp1ΔlacIΔgapC::aroG S180F ΔyeeL::trpE S40F );

[0139] Design primers to knockout ldhA (NCBI accession number: 946315) and integrate ppsA (NCBI accession number: 946209) in Trp2, knockout poxB (NCBI accession number: 946132) and integrate pck (NCBI accession number: 945667), knockout pflB (NCBI accession number: 945514) and integrate zwf (NCBI accession number: 946370), knockout yncK (NCBI accession number: 4056028) and integrate tktA (NCBI accession number: 947420), to obtain the L-tryptophan-producing strain Trp3 (E. coli Trp1ΔlacIΔgapC::aroG S180F ΔyeeL::trpE S40F ΔldhA::ppsAΔpoxB::pckΔpflB::zwfΔyncK::tktA);

[0140] Design primers to knockout ycgH (NCBI accession number: 2847703) and integrate glnA (NCBI accession number: 948370) in Trp3, knockout wbbL (NCBI accession number: 4056030) and integrate site-directed mutagenesis of serA H344A / N364A , knockout purR (NCBI accession number: 945226) and integrate prs (NCBI accession number: 945772), to obtain the L-tryptophan-producing strain Trp4 (E. coli Trp1ΔlacIΔgapC::aroG S180F ΔyeeL::trpE S40F ΔldhA::ppsAΔpoxB::pckΔpflB::zwfΔyncK::tktAΔycgH::glnAΔwbbL::serA H344A / N364A ΔpurR::prs).

[0141] Example 3: Application of recombinant E. coli Trp1-4 in the production of L-tryptophan

[0142] The specific steps are as follows:

[0143] 1. Preparation of seed culture

[0144] (1) Flat plate activation: Take the strains Trp1-4 stored at -80°C and thaw them on ice. Use a sterile inoculation loop to pick a loop of bacterial liquid and streak it on a solid LB medium plate, then place it in an incubator at 37°C and incubate it upside down for 16 hours.

[0145] (2) Primary seed culture: Use a sterile inoculation loop to pick a loop of colonies activated on the flat plate and inoculate them into an LB liquid medium. Incubate at 37°C and 200 rpm for 12 hours.

[0146] (3) Secondary seed culture: Inoculate the activated bacterial liquid into the secondary seed medium at an inoculation amount of 10%. Incubate at 37°C and 200 rpm until OD 600 reaches 12-18;

[0147] The formula of the secondary seed medium is: glucose 25 g / L, magnesium sulfate heptahydrate 1 g / L, potassium dihydrogen phosphate 4 g / L, dipotassium hydrogen phosphate 8 g / L, ammonium sulfate 5 g / L, yeast extract powder 8 g / L, citric acid monohydrate 2 g / L, ferrous sulfate heptahydrate 20 mg / L.

[0148] 2. Fermentation culture:

[0149] Take the completed secondary seed liquid and inoculate it into the fermentation medium at an inoculation amount of 15% (v / v). Incubate at 37°C for 48 hours. When the bottom sugar is about to be consumed, quickly feed 800 g / L glucose and control the residual sugar concentration below 1 g / L; control the dissolved oxygen at 28-35% from 0 to 9 hours after the start of fermentation, and control the dissolved oxygen at 18-25% after 9 hours.

[0150] The formula of the fermentation medium is: glucose 10 g / L, magnesium sulfate heptahydrate 3 g / L, potassium dihydrogen phosphate 8 g / L, dipotassium hydrogen phosphate 10 g / L, ammonium sulfate 5 g / L, yeast extract powder 6 g / L, citric acid monohydrate 4 g / L, ferrous sulfate heptahydrate 30 mg / L, manganese sulfate monohydrate 20 mg / L, copper sulfate pentahydrate 0.05 mg / L.

[0151] 3. Experimental results:

[0152] Verify the recombinant strains Trp1-4 in a 5 L fermenter according to the above method, and the results are shown in Table 3:

[0153] Table 3 L-tryptophan production of different recombinant strains in a 5 L fermenter

[0154] Strain <![CDATA[OD 600 > L-Tryptophan (g / L) Sugar-acid conversion rate (g / g) Trp1 86.7 12.56 11.03％ Trp2 90.2 31.42 14.27％ Trp3 91.8 53.18 16.52％ Trp4 93.5 70.54 18.77％

[0155] After 48 hours of fermentation in a 5 L fermenter, the L-tryptophan production of the Trp4 strain reached 70.54 g / L, and the sugar-acid conversion rate was 18.77%.

[0156] It shows that blocking the by-product pathway and overexpressing the key enzymes in the L-tryptophan synthesis pathway adopted by the present invention, and supplying the precursors required in the L-tryptophan synthesis pathway have an obvious positive effect on the accumulation of L-tryptophan in Escherichia coli.

[0157] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A strain of Escherichia coli Trp1 was deposited in the China Center for Type Culture Collection on March 3, 2025, with the deposit number CCTCC NO:M 2025337.

2. A microbial agent, characterized in that: The microbial agent contains the Escherichia coli Trp1 or its fermentation broth according to claim 1, or contains the lyophilized powder of the Escherichia coli Trp1 according to claim 1, or contains the inactivated bacteria of the Escherichia coli Trp1 according to claim 1, or contains the lysate of the Escherichia coli Trp1 according to claim 1, or contains the Escherichia coli Trp1 extract according to claim 1, and the fermentation broth contains the Escherichia coli Trp1 according to claim 1.

3. A genetically modified recombinant Escherichia coli with high L-tryptophan production or high sugar-acid conversion rate, characterized in that: The recombinant Escherichia coli is based on the Escherichia coli Trp1 described in claim 1 as the starting strain, the lacI gene on the genome is knocked out, and aroG is overexpressed in the Escherichia coli Trp1 S180F ,trpE S40F , ppsA gene, pck gene, zwf gene, tktA gene, glnA gene, serA H344A / N364A Gene and pr gene.

4. The recombinant Escherichia coli according to claim 3, characterized in that The recombinant Escherichia coli is a strain of the Escherichia coli Trp1 described in claim 1, wherein the lacI gene on the genome is knocked out, and aroG is integrated and expressed at the gapC site on the Escherichia coli Trp1 genome. S180F Gene, integrated expression of trpE at the yeeL site S40F gene, ppsA gene integrated and expressed at the ldhA site, pck gene integrated and expressed at the poxB site, zwf gene integrated and expressed at the pflB site, tktA gene integrated and expressed at the ynck site, glnA gene integrated and expressed at the ycgH site, serA gene integrated and expressed at the wbbL site H344A / N364A Gene, integrate and express the prs gene at the purR site.

5. The recombinant Escherichia coli according to claim 4, characterized in that The NCBI number of the lacI gene is: 945007; the NCBI number of the gapC site is: 2847738; the NCBI number of the yeeL site is: 2847764; the NCBI number of the ldhA site is: 946315; the NCBI number of the poxB site is: 946132; the NCBI number of the pflB site is: 945514; the NCBI number of the ynck site is: 4056028; the NCBI number of the ycgH site is: 2847703; the NCBI number of the wbbL site is: 4056030; the NCBI number of the purR site is: 945226; Preferably, the aroG S180F The gene is a nucleotide sequence comprising the nucleotide sequence encoded by the sequence shown in SEQ ID NO. 1 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having aroG protein activity; The trpE S40F The gene is a nucleotide sequence comprising the nucleotide sequence encoded by the sequence shown in SEQ ID NO. 2 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having trpE protein activity; The ppsA gene is a nucleotide sequence comprising the NCBI number: 946209 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having ppsA protein activity; The pck gene is a nucleotide sequence comprising NCBI No. 945667 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having pck protein activity; The zwf gene is a nucleotide sequence comprising NCBI No. 946370 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having zwf protein activity; The tktA gene is a nucleotide sequence comprising NCBI No. 947420 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having tktA protein activity; The glnA gene is a nucleotide sequence comprising the NCBI number: 948370 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having glnA protein activity; The serA H344A / N364A The gene is a nucleotide sequence comprising the nucleotide sequence encoded by the sequence shown in SEQ ID NO. 3 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having serA protein activity; The prs gene comprises a nucleotide sequence with NCBI number: 945772 or a nucleotide sequence having at least 96%, 97%, 98%, 99% or higher identity thereto and having prs protein activity.

6. The method for constructing a recombinant Escherichia coli with high L-tryptophan production or high sugar-acid conversion rate according to any one of claims 3 to 5, characterized in that: The method comprises the following steps: using the Escherichia coli Trp1 described in claim 1 as a starting strain, knocking out the lacI gene on the genome, and overexpressing aroG in the Escherichia coli Trp1. S180F ,trpE S40F , ppsA gene, pck gene, zwf gene, tktA gene, glnA gene, serA H344A / N364A gene and pr gene; Preferably, aroG is expressed by integrating at the gapC site on the Trp1 genome of E. coli. S180F Gene, integrated expression of trpE at the yeeL site S40F gene, ppsA gene integrated and expressed at the ldhA site, pck gene integrated and expressed at the poxB site, zwf gene integrated and expressed at the pflB site, tktA gene integrated and expressed at the ynck site, glnA gene integrated and expressed at the ycgH site, serA gene integrated and expressed at the wbbL site H344A / N364A Gene, integrate and express the prs gene at the purR site.

7. Use of the Escherichia coli Trp1 according to claim 1 in preparing a recombinant strain with high L-tryptophan production.

8. A method for preparing L-tryptophan, characterized in that: The method comprises the following steps: using the recombinant Escherichia coli described in any one of claims 3 to 5, or the recombinant Escherichia coli constructed by the method described in claim 6, to ferment and prepare L-tryptophan.

9. The preparation method according to claim 8, characterized in that: The fermentation conditions are: reacting at 30-40°C for at least 24 hours; Preferably, the fermentation temperature condition is: fermentation at 35-37°C; or fermentation at 30-31°C; or fermentation at 32-33°C; or fermentation at 34-35°C; or fermentation at 36-37°C; or fermentation at 38-39°C: Preferably, the fermentation time is 24 h to 54 h; more preferably 48 h.

10. Use of the recombinant Escherichia coli according to any one of claims 3 to 5 or the method according to claim 8 or 9 in the preparation of L-tryptophan or a product containing L-tryptophan.

Images