Application of bovine TRIM5 gene as target spot in regulation and control of BVDV replication

Abstract

The invention discloses application of a bovine TRIM5 gene as a target spot in regulation and control of BVDV replication. SiRNA capable of inhibiting bovine TRIM5 gene expression is designed, and the result shows that by interfering with the TRIM5 gene in host cells, replication of BVDV in the cells is promoted, and the titer of viruses in cell culture supernatant is improved; by preparing TRIM5 overexpression cells, the result shows that after the TRIM5 expression level in host cells is remarkably improved, the corresponding in-vitro replication level and virus titer of the BVDV are reduced. Results show that the bovine TRIM5 gene can be used as a target spot in research of a BVDV pathogenic mechanism and development of antiviral drugs.

Description

Technical Field

[0001] The present invention belongs to the fields of animal genetic engineering and molecular biotechnology, and relates to a novel target for the development of antiviral drugs against bovine viral diarrhea virus, the study of virus pathogenic mechanisms, and disease-resistant breeding. Specifically, it relates to affecting the replication of bovine viral diarrhea virus and its applications by regulating the expression level of bovine TRIM5 genes. Background Art Bovine viral diarrhea virus (BVDV) is a member of the family Flaviviridae, genus Pestivirus ( Flaviviridae Pestivirus ). Viruses in the same family also include hepatitis C virus (HCV), West Nile virus (WNV), dengue virus (DENV), Zika virus (ZIKV), Japanese encephalitis virus (JEV), classical swine fever virus (CSFV), yellow fever virus (YFV), and border disease virus (BDV), etc. Among them, CSFV and BDV are viruses in the same genus as BVDV. The genome of BVDV encodes multiple structural proteins and non-structural proteins such as N pro , Erns, E1, NS, etc., that is, virion proteins.

[0002] Bovine viral diarrhea / mucosal disease (BVD-MD) is a contagious disease caused by BVDV, characterized by diarrhea, fever, leukopenia, erosion and necrosis of the oral and digestive tract mucosa, abortion or birth of deformed fetuses in pregnant cows. It mainly causes diarrhea and mucosal disease in calves and adult cows, can also cause poor postnatal development in cattle, and cause the body to carry the virus for life and persistent infection. The worldwide distribution of this disease has caused huge losses to the cattle industry and has become one of the diseases that are key monitored and controlled in the cattle industry (and also an infectious disease that is strictly quarantined in cattle farms). Epidemiological investigations have found that BVDV can also infect a variety of cloven-hoofed animals such as pigs, deer, goats, sheep, and camels, and its range of infected animals is constantly expanding. Therefore, with the rapid development of the cattle industry in recent years, especially the increasing frequency of cattle introduction, the frequent circulation of cattle in different regions and the increase in the range of BVDV-infected animals, it will inevitably bring greater challenges to the prevention, control, and eradication of BVDV.

[0003] So far, more than 80 TRIM family proteins have been reported, and TRIM5 is one of them. TRIM family proteins are highly conserved in evolution. They are expressed in relatively lower invertebrates such as Drosophila, and higher mammals such as mice and humans. However, their specific functions show both certain conservation and species specificity. For example, TRIM5α is expressed in a variety of primates and has the function of restricting retroviral infection. However, the ability of TRIM5α in different primates to recognize and restrict viruses varies. TRIM family proteins usually consist of an N-terminal RING domain, one or two B-box motifs, and an α-helical coiled-coil domain in protein structure. Among them, the RING domain constitutes the catalytic center, which is a unique linear series of cysteine and histidine residues of the zinc finger domain. The RING domain plays a role by mediating protein-protein interactions. Dimerization of the RING domain is usually a prerequisite for ubiquitin ligase activity. With the continuous in-depth study of TRIM family proteins, their diverse biological functions in various biological processes have been revealed, including regulating cell proliferation, differentiation and apoptosis, participating in the post-translational modification pathway and autophagy process of proteins, and regulating the host immune signaling pathway, etc.

[0004] Innate immunity is the first line of defense for the host to resist pathogen invasion. When pathogens invade the body, pathogen-associated molecular patterns can be recognized by pattern recognition receptors (PRRs) of host cells, ultimately activating various signaling pathways and promoting the expression of pro-inflammatory cytokines and type I IFN, thereby resisting pathogen invasion. Recent studies have shown that many TRIM family proteins play important roles in the process of virus infection, and they can affect virus replication by regulating the signaling pathways of antiviral innate immune responses. However, the research results of exploring TRIM family genes in the bovine genome TRIM5 and using them as disease-resistant genes related to regulating virus replication are not yet clear. Specifically, although CN104357444A discloses an interference method for silencing one of the gene alternative splice variants (specifically trim5α), it actually verifies that knocking down the bovine TRIM5 gene can improve the expression efficiency of tool vectors transfected with foreign genes such as human lentiviral expression vectors in MDBK cells, and subsequent research and technical applications no longer involve antiviral reports on bovine TRIM family genes such as TRIM5 (see Wang Cuihui et al. "Establishment of a HEK293 cell line stably expressing equine TRIM5α protein and preliminary study on its antiviral activity." Chinese Journal of Preventive Veterinary Medicine 38.4(2016):5.; CN117281824A, etc.). TRIM5

[0005] Currently, no research has been reported on bovine TRIM5 Report on regulating the replication of Bovine viral diarrhea virus by using genes as targets. Summary of the Invention

[0006] The purpose of the present invention is to provide an application of a bovine TRIM5 gene as a target in regulating the replication of BVDV.

[0007] To achieve the above purpose, the present invention adopts the following technical solutions: In the first aspect, a method for preparing Bovine viral diarrhea virus with high titer is provided, including the following steps: Knock down the TRIM5 gene in host bovine cells to obtain knockdown cells; infect the obtained knockdown cells with Bovine viral diarrhea virus, culture the knockdown cells after infecting with Bovine viral diarrhea virus, and separate the cell culture supernatant after culturing for at least 48 h, then high-titer Bovine viral diarrhea virus can be obtained.

[0008] Preferably, the knockdown is carried out by RNA interference technology, that is, siRNA designed against the bovine TRIM5 gene is transfected into host bovine cells.

[0009] Preferably, the sequence of the siRNA is as shown in SEQ.ID.NO.10.

[0010] Preferably, the Bovine viral diarrhea virus is selected from the BVDV-1 NADL strain.

[0011] Preferably, the host bovine cells are bovine kidney cells.

[0012] In the second aspect, a cell model for promoting the infection of Bovine viral diarrhea virus is provided. This cell model is prepared by introducing (such as transfection) a preparation or reagent for inhibiting the expression of the endogenous TRIM5 gene (that is, an inhibitor of the bovine TRIM5 gene) into host bovine cells.

[0013] Preferably, the preparation includes the above-mentioned siRNA designed against the bovine TRIM5 gene (see SEQ.ID.NO.10).

[0014] Preferably, the reagent is a drug molecule targeting the bovine TRIM5 gene and capable of reducing the expression level of TRIM5.

[0015] Preferably, the cell model is a virus amplification cell that can improve the replication level of the virus in cells and the virus titer in the cell culture supernatant after infecting with Bovine viral diarrhea virus. Such cells that can improve the virus amplification efficiency are helpful for better studying the pathogenic mechanism of the virus and more efficiently amplifying virus vaccine strains.

[0016] In a third aspect, there is provided an interfering RNA for knocking down bovine TRIM5 genes, and the interfering RNA is an siRNA with a sequence as shown in SEQ.ID.NO.10.

[0017] In a fourth aspect, there is provided an overexpression vector for bovine TRIM5 genes, including a vector backbone and a target gene connected to the vector backbone, and the target gene includes a bovine TRIM5 gene sequence with a kozak sequence at the 5' end.

[0018] Preferably, the vector backbone is derived from a eukaryotic expression vector, such as pcDNA3.1(+), and the corresponding recombinant vector for overexpressing bovine TRIM5 genes is pcDNA3.1(+)-TRIM5.

[0019] In a fifth aspect, there is provided the use of an activator targeting bovine TRIM5 genes / proteins in the preparation of antiviral drugs against bovine viral diarrhea virus.

[0020] Preferably, the activator is a preparation or reagent that promotes the expression of bovine TRIM5 genes.

[0021] Preferably, the preparation includes the above-mentioned overexpression vector for bovine TRIM5 genes, and after being injected into the host, the overexpression vector activates TRIM5 genes by increasing the expression level of TRIM5 in its cells.

[0022] Preferably, the reagent is a drug molecule targeting bovine TRIM5 genes and capable of increasing the expression level of TRIM5.

[0023] In a sixth aspect, there is provided a cell model resistant to bovine viral diarrhea virus infection, and the cell model is prepared by introducing (such as by electroporation) a preparation or reagent for promoting the expression of endogenous TRIM5 genes into host bovine cells.

[0024] Preferably, the preparation includes the above-mentioned overexpression vector for bovine TRIM5 genes, which can significantly reduce the virus replication level in cells and the virus titer in the cell culture supernatant after the cells are infected with bovine viral diarrhea virus.

[0025] Preferably, the ratio of the overexpression vector for bovine TRIM5 genes to host bovine cells is: for every 1×10 6 cells, the plasmid introduced (specifically, the overexpression vector for bovine TRIM5 genes) is 3 - 6 μg.

[0026] Preferably, the reagent is a drug molecule targeting the bovine TRIM5 gene and capable of increasing the expression level of TRIM5.

[0027] The beneficial effects of the present invention are as follows: By constructing an overexpression vector of the bovine TRIM5 gene, it is first discovered that increasing the expression level of TRIM5 in cells (such as MDBK) can reduce the replication level of bovine viral diarrhea virus. This discovery suggests that an activator of the bovine TRIM5 gene (or TRIM5 protein) can be applied in the development of new antiviral drugs against bovine viral diarrhea virus infection (such as inhibiting virus replication by injecting a plasmid overexpressing the bovine TRIM5 gene). In addition, by using RNA interference technology to knockdown the bovine TRIM5 gene, it is first discovered that inhibiting the expression of the TRIM5 gene can promote the replication of bovine viral diarrhea virus in cells and increase the virus titer in the cell culture supernatant. This discovery suggests that an inhibitor of the bovine TRIM5 gene can be used to obtain a high-titer bovine viral diarrhea virus. Based on the change in the expression level of TRIM5 in cells (such as MDBK) infected with bovine viral diarrhea virus, through experiments of knocking down and overexpressing the bovine TRIM5 gene in cells, it is first discovered that promoting the expression of the host cell TRIM5 gene has an inhibitory effect on the replication of bovine viral diarrhea virus, while when the expression of the host cell TRIM5 gene is inhibited, the replication level of bovine viral diarrhea virus is significantly increased and the virus load is increased. Thus, the bovine TRIM5 gene is identified as an anti-disease gene against bovine viral diarrhea virus, and provides important tools and materials (including highly efficient virus-amplifying cells and high-titer viruses) for studying the molecular mechanism of the bovine TRIM5 gene regulating the replication of pathogenic microorganisms in cells and the preparation of bovine viral diarrhea virus vaccines.

[0028] Furthermore, the present invention uses a eukaryotic expression vector, such as pcDNA3.1(+), to construct an overexpression plasmid of the bovine TRIM5 gene, and by electrotransformation, it is introduced into host cells at a certain dose, which can significantly inhibit the replication of bovine viral diarrhea virus in cells, thereby achieving antiviral activity by overexpressing the bovine TRIM5 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] 图1 For BVDV infection on bovine TRIM5 Results of the impact on gene expression; among which: A shows the expression level of TRIM5 protein in MDBK cells detected by Western blot 72 h after BVDV infection of MDBK cells (β-actin was used as an internal reference, and 50 kD and 40 kD indicate the sizes of the protein markers); B shows the level of TRIM5 mRNA in MDBK cells detected by real-time fluorescence quantitative PCR 72 h after BVDV infection (*** indicates that the expression level of TRIM5 in MDBK cells infected with BVDV for 0 h was p < 0.005).

[0030] 图2 is bovine TRIM5 Results of the construction of the overexpression vector of the bovine TRIM5 gene and the identification of the overexpression effect; among which: A shows the PCR product identification of the bovine TRIM5 gene (lane M is DL15000 plus DNA Marker, lane 1 is the negative control without template, and lanes 2, 3, and 4 are the PCR products of about 1558 bp in size containing the bovine

[0031] 图3 is the overexpression of bovine TRIM5 gene on the replication of BVDV; among which: A shows the detection of bovine viral diarrhea virus N protein (BVDV N pro)mRNA level, * indicates relative to the BVDV N expression level in cells of the pcDNA3.1(+)+BVDV group pro with p < 0.05; B is to detect the median tissue culture infective dose (TCID) of BVDV in the culture supernatant of MDBK cells 50 ), * indicates relative to the virus TCID level in the culture supernatant of cells in the pcDNA3.1(+)+BVDV group 50 with p < 0.05; pcDNA3.1(+)+BVDV is the group of cells transfected with an empty vector and then infected with bovine viral diarrhea virus, and pcDNA3.1(+)-TRIM5+BVDV is the group of cells transfected with the constructed overexpression vector at a certain dose and then infected with bovine viral diarrhea virus.

[0032] 图4 is the identification result of siRNA for interfering with the TRIM5 gene; among them: A is the Western blot detection of the expression level of TRIM5 protein in MDBK cells after knocking down the TRIM5 gene by RNA interference (NC is the negative control of siRNA in the knockdown group, si-TRIM5 is the siRNA knockdown group of the TRIM5 gene, β-actin is the internal reference, and 50kD and 40kD are the sizes of the indicated protein Makers); B is the real-time fluorescence quantitative PCR detection of the interference efficiency of si-TRIM5 on the TRIM5 gene after knocking down the TRIM5 gene by RNA interference (*** indicates p < 0.005 relative to the TRIM5 expression level in MDBK cells transfected with the negative control siRNA, i.e., NC).

[0033] 图5 is the result of the effect of interfering with the TRIM5 gene on BVDV replication; among them: A is the real-time fluorescence quantitative PCR detection of the mRNA level of bovine viral diarrhea virus N protein (BVDV N pro ) in MDBK cells, *** indicates p < 0.005 relative to the BVDV N pro expression level in cells of the NC+BVDV group; B is to detect the median tissue culture infective dose (TCID) of BVDV in the culture supernatant of MDBK cells 50 ), * indicates relative to the virus TCID level in the culture supernatant of cells in the NC+BVDV group 50 with p < 0.05; NC+BVDV is the group of cells transfected with the negative control siRNA, i.e., NC, and then infected with bovine viral diarrhea virus, and si-TRIM5+BVDV is the group of cells transfected with siRNA for interfering with the TRIM5 gene and then infected with bovine viral diarrhea virus. Detailed implementation mode

[0034] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments are only used to explain the present invention, rather than limiting the protection scope of the present invention.

[0035] (1) TRIM5 expression level after MDBK is inoculated with virus 1.1 Materials and reagents Madin-Darby bovine kidney cells (MDBK) are preserved by the veterinary public health team of the College of Veterinary Medicine, Northwest A&F University (or purchased from a company); primary antibody: The TRIM5 antibody is a mouse polyclonal antibody prepared in this laboratory (the preparation steps include: constructing a recombinant plasmid pet28a-Trim5 61-300aa , purifying the inclusion body protein after induced expression and immunizing mice; antibodies can also be purchased), β-actin antibody (mouse source) is purchased from Beijing Bioclone Immunotech Co., Ltd.; secondary antibody: Horseradish peroxidase (HRP)-labeled bovine anti-mouse IgG antibody is purchased from Shanghai Di Yi Biotechnology Co., Ltd.; Bovine viral diarrhea virus is specifically the BVDV-1 NADL strain, purchased from CACC; PVDF membrane is purchased from Immobilon Biosciences; ECL chromogenic solution is purchased from Beijing Di Ning Biotechnology Co., Ltd.; RIPA is purchased from Beijing Solarbio Science & Technology Co., Ltd.; mRNA reverse transcription and quantification kit, real-time fluorescence quantitative PCR kit are purchased from Beijing TransGen Biotech Co., Ltd.; the rest of the conventional reagents are all of analytical grade.

[0036] 1.2 Methods and results 1.2.1 TRIM5 protein level in BVDV-infected cells After Madin-Darby bovine kidney (MDBK) cells are infected with bovine viral diarrhea virus at an MOI of 1, cells are collected at 0 h (i.e., mock-infected, MOCK) and 72 h respectively (the specific steps include: removing the culture medium and washing twice with PBS). The cell samples are lysed with RIPA lysis buffer containing protease inhibitor. After lysing on ice for 15 min, 5× Loading Buffer is added and boiled for 10 min, and then SDS-PAGE is carried out and transferred to a PVDF membrane. After blocking with 5% milk powder for 2 h, primary antibody and secondary antibody incubation treatments are carried out and then developed. The expression of TRIM5 protein is as 图1 shown in A, and the results show that the infection of bovine viral diarrhea virus leads to a decrease in the expression level of TRIM5 protein in its host cells.

[0037] 1.2.2 TRIM5 mRNA level in BVDV-infected cells Meanwhile, the total RNA of the collected non-infected and virus-infected cell samples was extracted using the TRIZOL precipitation method respectively; then the extracted total cellular RNA was reverse transcribed into cDNA. Specifically, the reverse transcription reaction system (see Table 1) was incubated in a PCR instrument at 42 °C for 30 min, and after incubation, it was heated at 85 °C for 5 s to inactivate the reverse transcriptase; using the cDNA obtained by reverse transcription as a template, and the relative expression level of TRIM5 mRNA in cells was detected using qPCR primers. Specifically, the qPCR reaction system (see Table 2) was pre-denatured at 94 °C for 30 s in a PCR instrument and then subjected to 40 cycles of reaction (94 °C for 5 s, 58 °C for 15 s, 72 °C for 10 s). The results of real-time fluorescence quantitative PCR showed that bovine viral diarrhea virus infection significantly inhibited the level of TRIM5 mRNA in its host cells ( 图1 B).

[0038] Table 1. Reverse transcription reaction system

[0039] Table 2. qPCR reaction system

[0040] Table 3. qPCR primers

[0041] (II) Bovine TRIM5 Construction of gene overexpression vector 2.1 Materials and reagents Bovine kidney cells (MDBK) were preserved by the veterinary public health team of the College of Veterinary Medicine, Northwest A&F University (or purchased from a company); the plasmid extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; BamH I enzyme and Xho I enzyme were purchased from TaKaRa Company, Escherichia coli DH5ɑ competent cells were purchased from Beijing Tsingke Biotechnology Co., Ltd., and the high-fidelity enzyme PhantaMAX was purchased from Nanjing Novozymes Biotech Co., Ltd.; pcDNA3.1(+) was purchased from Beijing Tsingke Biotechnology Co., Ltd.; the remaining conventional reagents were all of analytical grade.

[0042] 2.2 Methods and results According to the bovine TRIM5 gene (NM_001205305.1) published on NCBI, primers capable of amplifying the coding sequence of this gene (see the gene sequence in Table 4, i.e., SEQ.ID.NO.7) were designed.

[0043] The sequences of the said primers are specifically as follows. All primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.: Upstream primer TRIM5-F: 5'- CGGGATCCGCCACCATGGCTTCAGGAATCCTGAT -3' (i.e., SEQ.ID.NO.5); Downstream primer TRIM5-R: 5'- CCCTCGAGTTAACAGCTTGGTGAGC -3' (i.e., SEQ.ID.NO.6).

[0044] Among them, the restriction enzyme cleavage sites of BamH I and Xho I are respectively after the two protective bases at the 5' end of the upstream and downstream primers ("GGATCC", "CTCGAG"), and the kozak sequence ("GCCACC") is after the restriction enzyme cleavage site of BamH I contained in the upstream primer. The size of the PCR product is 1558 bp.

[0045] Table 4. Cattle TRIM5 Gene sequence

[0046] Use the TRIZOL precipitation method to extract the total RNA of MDBK cells; then reverse transcribe the extracted total cellular RNA into cDNA. Specifically, place the reverse transcription reaction system (which can refer to Table 1 above) in a PCR instrument and incubate at 42 °C for 30 min. After incubation, heat at 85 °C for 5 s to inactivate the reverse transcriptase; use the cDNA obtained by reverse transcription as a template, and use primers TRIM5-F and TRIM5-R to perform PCR amplification of the cattle TRIM5 gene with a kozak sequence connected at the 5' end and a stop codon connected at the 3' end (the amplification reaction system is shown in Table 5, and the amplification reaction procedure is shown in Table 6) to obtain a PCR product containing the target gene.

[0047] Subject the PCR product (the identification result is shown in 图2 A) and pcDNA3.1(+) to double digestion with restriction enzymes BamH I and XhoI respectively (the enzyme digestion reaction system is shown in Table 7). After electrophoresis, recover the target gene and the vector backbone from the gel and connect them according to the connection system shown in Table 8. The ligation product is transformed into Escherichia coli DH5ɑ competent cells by heat shock method. After culturing at 37 °C for 1 h, take a small amount of the bacterial solution and spread it on the surface of an LB solid medium with ampicillin resistance. Culture at 37 °C for 16 h, pick monoclonal colonies for colony PCR identification, and then expand the positive bacteria in an LB liquid medium with ampicillin resistance and extract the plasmid for enzyme digestion identification (the result is as 图2 shown in B). After correct identification, send it to the company for sequencing. The plasmid with correct sequencing is the recombinant plasmid pcDNA3.1(+)-TRIM5.

[0048] Table 5. PCR reaction system

[0049] Table 6. PCR reaction program

[0050] Table 7. Restriction digestion reaction system

[0051] Table 8. Ligation system

[0052] (III) Verification of cattle TRIM5 Overexpression vector of gene expressed intracellularly 3.1 Materials and reagents Bovine kidney cells (MDBK) were preserved by the veterinary public health team of the College of Veterinary Medicine, Northwest A&F University (or purchased from a company); Primary antibody: The TRIM5 antibody was a mouse polyclonal antibody prepared in this laboratory, and the β-actin antibody (mouse source) was purchased from Beijing Bioworld Technology Co., Ltd.; Secondary antibody: Horseradish peroxidase (HRP)-labeled bovine anti-mouse IgG antibody was purchased from Shanghai D&Y Biotech Co., Ltd.; PVDF membrane was purchased from Immobilon; ECL chromogenic solution was purchased from Beijing Dinin Biotech Co., Ltd.; Electroporation cuvette was purchased from Bio-rad; RIPA was purchased from Beijing Solarbio Science & Technology Co., Ltd.; The remaining conventional reagents were all of analytical grade.

[0053] 3.2 Methods and results 3.2.1 Introduction of recombinant plasmid pcDNA3.1(+)-TRIM5 into MDBK cells (by electroporation) MDBK cells were cultured to a density of 90%, digested with trypsin, resuspended with DMEM, and the cells were counted. Take 2.5 μg, 5 μg, and 7.5 μg of pcDNA3.1(+)-TRIM5 plasmid, and mix them evenly with 1×10 6 cells (a total of 100 μl) diluted with DMEM in a 1.5 ml centrifuge tube. Transfer each centrifuge tube to a 2 mm electroporation cuvette and place it on ice for 5 min before electroporation (set the parameters to 300 v, 25 ms, 1 time; or 250 v, 30 ms, 1 time; or 300 v, 5 ms, 4 times, all of which can achieve a high introduction efficiency); At the same time, set a negative control of the empty vector by introducing the pcDNA3.1(+) plasmid. After electroporation, recover on ice for 5 min, transfer the cells to a 12-well plate, and place it in an incubator at 37 °C and 5% CO 2 for culture, and change the medium 12 h after the cells adhere.

[0054] 3.2.2 Evaluation of the expression level of TRIM5 protein in MDBK cells Collect the cells after culturing for 48 h; prepare the protein lysate according to the ratio of tissue cell rapid lysate (RIPA):PMSF = 100:1 (volume ratio), add 100 μl / well of the protein lysate to each 12-well plate, and detect the expression effect of TRIM5 protein according to the method in 1.2.1. The results are as 图2 shown in 图2 Figure C. The expression levels of TRIM5 protein in the three groups of cells transfected with different doses of pcDNA3.1(+)-TRIM5 plasmid were all increased compared with the cells in the pcDNA3.1(+) empty vector group. And according to the analysis of the histogram of the gray value statistics in TRIM5 Figure C, it can be seen that electrotransfecting 5 μg of pcDNA3.1(+)-TRIM5 plasmid can more effectively overexpress the bovine

[0055] gene in cells. TRIM5 3.2.3 Overexpress the bovine gene through the constructed lentiviral vector TRIM5 In addition to introducing the overexpression plasmid of the bovine TRIM5 gene into cells by the method in 3.2.1, our laboratory also inserted the bovine 图2 gene sequence with a FLAG tag into the lentiviral vector phblv-cmv-mcs-ef1-zsgreen1-t2a-puro to construct an overexpression vector, and after packaging the lentivirus, the obtained lentivirus supernatant was used to infect MDBK cells. The results showed that no overexpressed TRIM5 was detected in the cell monoclonal selected by puromycin 72 h after lentivirus infection (

[0056] (IV) Effect of overexpressing the bovine TRIM5 gene on BVDV replication 4.1 Materials and reagents Bovine kidney cells (MDBK) are preserved by the veterinary public health team of the College of Veterinary Medicine, Northwest A&F University (or purchased from the company); the bovine viral diarrhea virus is specifically the BVDV-1 NADL strain, purchased from CACC; the electroporation cuvette is purchased from Bio-rad; the mRNA reverse transcription and quantitative kit, and the real-time fluorescence quantitative PCR kit are purchased from Beijing TransGen Biotech Co., Ltd.; the rest of the conventional reagents are all of analytical grade.

[0057] 4.2 Methods and results According to the method in 3.2.1, 5 μg of pcDNA3.1(+)-TRIM5 plasmid was introduced into MDBK cells by electroporation; at the same time, a cell group transfected with the empty plasmid (i.e., pcDNA3.1(+) plasmid) was set. After electroporation and recovery, the cells were cultured at 37 °C and 5% CO 2Cultivate for 48 h in an incubator, then infect with bovine viral diarrhea virus (BVDV) at an MOI of 1. After 48 h, detect the replication level of BVDV and detect the virus TCID in the cell culture supernatant. 50 。

[0058] Detection of BVDV replication level: Collect the cells of the pcDNA3.1(+)+BVDV group and the pcDNA3.1(+)-TRIM5+BVDV group 48 h after virus inoculation respectively; then detect the BVDV N pro mRNA level in the cells according to the method in 1.2.2; the qPCR primers used are shown in Table 9.

[0059] Table 9. qPCR primers

[0060] The detection results show that compared with the group infected with BVDV after electroporation of the blank plasmid, the BVDV N pro mRNA expression level in the cells of the group infected with BVDV after electroporation of the pcDNA3.1(+)-TRIM5 plasmid was significantly down-regulated ( 图3 A), suggesting that the replication of BVDV in cells was inhibited under the condition of overexpressing TRIM5.

[0061] Detection of virus TCID in the cell culture supernatant 50 : Collect the cell culture supernatants of the pcDNA3.1(+)+BVDV group and the pcDNA3.1(+)-TRIM5+BVDV group 48 h after virus inoculation respectively; plate one day in advance. Specifically, resuspend the MDBK cells in the logarithmic growth phase and adjust the cell concentration to 8×10 4 cells / mL, evenly inoculate them into 96-well plates, and inoculate 8 replicate wells for each virus solution concentration gradient set as parallel repeats. Discard the cell culture medium when the cell density reaches about 80%; Gradient dilute the cell culture supernatant collected after virus inoculation with DMEM. Dilute the cell culture supernatant with dilution multiples of 10 -1 to 10 -10 and add 100 μl of each to the above 96-well plates respectively. Add an equal amount of DMEM to the blank control wells; After waiting for the virus to adsorb for 2 h, change to DMEM containing 2% FBS; Observe the CPE situation every day. After the cell status in each well is stable and the number of wells with lesions no longer increases, calculate the virus titer of BVDV (i.e., TCID 50 ) according to the Reed-Muench method. Through TCID 50The results of detecting the virus titer in the cell culture supernatant showed that, compared with the cells transfected with the empty plasmid and then infected with bovine viral diarrhea virus, the cells overexpressing TRIM5 and then infected with bovine viral diarrhea virus significantly reduced the virus titer in the cell culture supernatant ( 图3 B).

[0062] (V) Evaluation of the RNA interference effect of the bovine TRIM5 gene 5.1 Materials and Reagents Madin-Darby bovine kidney (MDBK) cells were preserved by the veterinary public health team of the College of Veterinary Medicine, Northwest A&F University (or purchased from a company); Primary antibodies: The TRIM5 antibody was a mouse polyclonal antibody prepared in our laboratory, and the β-actin antibody (mouse source) was purchased from Beijing Bioworld Technology Co., Ltd.; Secondary antibody: Horseradish peroxidase (HRP)-labeled goat anti-mouse IgG antibody was purchased from Shanghai D&Y Biotech Co., Ltd.; PVDF membrane was purchased from Immobilon; ECL chromogenic solution was purchased from Beijing Dinin Biotech Co., Ltd.; TurboFect transfection reagent was purchased from Thermo Fisher Scientific; mRNA reverse transcription and quantification kit, real-time fluorescence quantitative PCR kit were purchased from Beijing TransGen Biotech Co., Ltd.; RIPA was purchased from Beijing Solarbio Science & Technology Co., Ltd.; The rest of the conventional reagents were all of analytical grade.

[0063] 5.2 Methods and Results First, siRNAs targeting the bovine TRIM5 gene were designed. The design principles were as follows: The GC content of the siRNA was between 35% and 55%, the length was 19 - 25 nucleotides (a length greater than 30 nucleotides might lead to non-specific silencing), and continuous single bases, inverted repeat sequences, and GG structures were avoided as much as possible (because siRNA can be cleaved by ribonuclease at the single-stranded G base). The designed TRIM5 gene siRNAs were used in the subsequent experiments.

[0064] The cultured MDBK cells were digested and counted one night in advance, diluted with DMEM containing 10% FBS into a cell suspension with a concentration of 1×10 5 cells / ml, and 1 ml of the cell suspension was added to each well of a 12-well plate. When the cell density reached 60% - 70% the next day, transfection could be carried out. The negative control siRNA (NC) and TRIM5 gene siRNAs (such as si-TRIM5) were transfected into MDBK cells using TurboFect transfection reagent (the concentration ratio of siRNA to TurboFect transfection reagent was 1:1.5). The sequences of si-TRIM5 and the negative control siRNA (NC) were as follows: si-TRIM5 (sense): 5'- AAGGAGUGCAAAUGUUGUCAU -3' (i.e., SEQ.ID.NO.10); si-TRIM5 (antisense): 5'- AUGACAACAUUUGCACUCCUU -3' (i.e., SEQ.ID.NO.11); NC: 5'- GCGUACGCGGAAUACUUCGAATT -3' (i.e., SEQ.ID.NO.12).

[0065] After transfection, place the culture plate in an incubator at 37 °C and 5% CO 2 Incubate. After 48 h, collect the cells and detect the expression of TRIM5 protein according to the method in 1.2.1. The results show that the si-TRIM5 transfected into the cells TRIM5 has a high interference efficiency on the 图4 gene. The expression level of TRIM5 protein in the cells transfected with si-TRIM5 is significantly lower than that in the cells of the negative control siRNA group (

[0066] A). TRIM5 TRIM5 图4

[0067] B). TRIM5 (VI) Effect of interfering with the TRIM5 gene on BVDV replication 6.1 Materials and Reagents Bovine kidney cells (MDBK) are preserved by the veterinary public health team of the College of Veterinary Medicine, Northwest A&F University (or purchased from the company); Bovine viral diarrhea virus is specifically the BVDV-1 NADL strain, purchased from CACC; TurboFect transfection reagent is purchased from Thermo Fisher Scientific; mRNA reverse transcription and quantitative kit, real-time fluorescence quantitative PCR kit are purchased from Beijing TransGen Biotech Co., Ltd.; The rest of the conventional reagents are of analytical grade.

[0068] 6.2 Methods and Results Transfect the siRNA of the TRIM5 gene (specifically si-TRIM5) into MDBK cells according to the method in 5.2; At the same time, set up a cell group transfected with NC. After transfection, place the culture plate in an incubator at 37 °C and 5% CO 2Cultured in an incubator, infected with bovine viral diarrhea virus with an MOI of 1 after 48 h, and the replication level of bovine viral diarrhea virus was detected after 48 h, and the virus TCID in the cell culture supernatant was detected 50 .

[0069] Detection of the replication level of bovine viral diarrhea virus: The cells of the NC + BVDV group and the si-TRIM5 + BVDV group after 48 h of virus inoculation were collected respectively, and the relative expression level of BVDV N pro mRNA in the cells was detected according to the method in 1.2.2. The results were as 图5 shown in TRIM5 Figure A. After knocking down the pro gene and then infecting with bovine viral diarrhea virus, the expression level of BVDV N TRIM5 mRNA increased significantly. The results suggest that the replication level of bovine viral diarrhea virus in the cells increases with the

[0070] knockdown expression of the 50 gene. Detection of virus TCID in the cell culture supernatant: The cell culture supernatants of the NC + BVDV group and the si-TRIM5 + BVDV group after 48 h of virus inoculation were collected respectively; the plates were seeded one day in advance. Specifically, the MDBK cells in the logarithmic growth phase were resuspended and the cell concentration was adjusted to 8×10 4 cells / ml, evenly seeded in a 96-well plate, and 8 replicate wells were inoculated according to each virus solution concentration gradient set as parallel repeats. When the cell density reached about 80%, the cell culture medium was discarded; the cell culture supernatants collected after virus inoculation were serially diluted with DMEM, and the cell culture supernatants with dilution factors from 10 -1 to 10 -10 were added to the above 96-well plate at 100 μl per well respectively, and an equal amount of DMEM was added as a blank control; after waiting for the virus to adsorb for 2 h, it was replaced with DMEM containing 2% FBS; the CPE was observed every day. After the cell status in each well was stable and the number of wells with lesions no longer increased, the virus titer of bovine viral diarrhea virus (i.e., TCID 50 ) was calculated according to the Reed-Muench method. From the results of detecting the virus titer in the cell culture supernatant by TCID 50 , it can be seen that compared with infecting with bovine viral diarrhea virus after transfection with negative control siRNA, knocking down the TRIM5 gene and then infecting with bovine viral diarrhea virus significantly increased the virus titer in the cell culture supernatant ( 图5 Figure B).

[0071] In summary, through experiments, the present invention found that: (1) the expression level of TRIM5 in host cells (such as MDBK) decreased after infection with bovine viral diarrhea virus; (2) using RNA interference technology to inhibit host cells (such as MDBK) TRIM5 After gene expression, the down-regulation of TRIM5 expression promotes the replication of bovine viral diarrhea virus, resulting in a significant increase in the in vitro replication level and virus titer of bovine viral diarrhea virus; (3) After electroporating a plasmid overexpressing bovine TRIM5 gene, the up-regulation of TRIM5 expression inhibits the replication of bovine viral diarrhea virus, resulting in a significant decrease in the in vitro replication level and virus titer of bovine viral diarrhea virus. Therefore, bovine TRIM5 gene is a disease-resistant gene against bovine viral diarrhea virus and can be used for certain antiviral applications (such as inhibiting the replication of bovine viral diarrhea virus by effectively overexpressing bovine TRIM5 gene); at the same time, it can provide highly efficient virus-amplifying cells for the study of the pathogenic mechanism of bovine viral diarrhea virus (such as the molecular mechanism regulating virus replication) and the preparation of bovine viral diarrhea virus vaccines (inactivated vaccines, attenuated vaccines, etc.). In addition, the present invention provides a new target for the development of effective and safe new vaccine drugs for preventing bovine viral diarrhea virus, and also provides a new candidate gene for anti-bovine viral diarrhea virus breeding research, thus providing new ideas for the prevention and control of bovine viral diarrhea virus and having broad application prospects.

Claims

1. A method for preparing high titer bovine viral diarrhea virus, characterized in that: The following steps are involved: Knockdown in host bovine cells TRIM5 gene to obtain knockdown cells; using bovine viral diarrhea virus to infect the knockdown cells, culturing the knockdown cells infected with the bovine viral diarrhea virus, and then separating the cell culture supernatant to obtain a high titer bovine viral diarrhea virus.

2. A method for preparing a high titer bovine viral diarrhea virus according to claim 1, characterized in that: The knockdown was performed using RNA interference technology.

3. A method for preparing high titer bovine viral diarrhea virus according to claim 1 or 2, characterized in that: The knockdown specifically includes the following steps: transfecting host bovine cells with siRNA whose sequence is shown in SEQ.ID.NO.

10.

4. A method for preparing a high titer bovine viral diarrhea virus according to claim 1, characterized in that: The bovine viral diarrhea virus is selected from the BVDV-1 NADL strain; the host bovine cell is a bovine kidney cell.

5. A cell model that promotes bovine viral diarrhea virus infection, characterized in that: The cell model was used to inhibit TRIM5 Gene expression preparations or reagents are introduced into host bovine cells.

6. A method for knocking down cattle TRIM5 The interfering RNA of a gene is characterized by: The interfering RNA is a siRNA with a sequence as shown in SEQ.ID.NO.

10.

7. A kind of cattle TRIM5 A gene overexpression vector, characterized in that: The invention comprises a vector skeleton and a target gene connected to the vector skeleton, wherein the target gene comprises a bovine recombinant protein with a kozak sequence at the 5' end. TRIM5 Gene sequence.

8. Cattle TRIM5 Application of gene / protein-targeted activators in the preparation of antiviral drugs for bovine viral diarrhea virus.

9. A cell model resistant to bovine viral diarrhea virus infection, characterized in that: The cell model was used to promote TRIM5 Gene expression preparations or reagents are introduced into host bovine cells.

10. A cell model resistant to bovine viral diarrhea virus infection according to claim 9, characterized in that: The preparation includes cattle TRIM5 Gene overexpression vector TRIM5 The ratio of gene overexpression vector to host bovine cells is: 1×10 6 Each cell is transformed with 3-6 μg of bovine serum TRIM5 Gene overexpression vector.

Images