Method and application of tetrabromobenzotriazole in inhibiting in vitro infection of porcine epidemic diarrhea virus

Abstract

The present invention relates to a method and application of TBB in inhibiting the in vitro infection of porcine epidemic diarrhea virus, and the TBB can be used to prepare antiviral drugs for inhibiting the infection of porcine epidemic diarrhea virus. In the process of PEDV infecting Vero cells in the present invention, TBB with a concentration of 10 μmol / L is added. Compared with the group without TBB treatment, the RNA content, protein expression level and virus titer of PEDV in the group treated with TBB are all significantly reduced, indicating that TBB can be used to inhibit the in vitro infection of porcine epidemic diarrhea virus.

Description

Technical Field

[0001] The invention relates to a method and application of tetrabromobenzotriazole in inhibiting porcine epidemic diarrhea virus infection in vitro, belonging to the technical fields of cell biology and virology. Background Art

[0002] Porcine epidemic diarrhea (PED) is an enteric disease of swine caused by the porcine epidemic diarrhea virus (PEDV). It is primarily transmitted through the fecal-oral route and is clinically characterized by vomiting, diarrhea, and dehydration. Since 2010, PED has recurred in numerous countries and regions worldwide. While pigs of all ages can be infected by PEDV and display varying degrees of symptoms, piglets are most severely affected, with mortality rates as high as 100%. Currently, PED remains prevalent in many countries and regions worldwide, causing significant economic losses to the global swine industry.

[0003] PEDV is an enveloped, single-stranded, positive-sense RNA virus belonging to the family Coronaviridae, order Nidovirales, and genus Alphacoronavirus. In vitro, PEDV primarily infects Vero cells, the renal epithelial cells of African green monkeys. Currently, there are no clinically effective drugs against PEDV infection, hindering its effective prevention and control, and thus its spread. Therefore, the development of antiviral drugs for PEDV is urgently needed to reduce the morbidity and mortality of PEDV. Summary of the Invention

[0004] In view of the deficiencies in the prior art, the present invention aims to provide a method and application of 4,5,6,7-tetrabromobenzotriazole (TBB) for inhibiting PEDV infection in vitro.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] Application of 4,5,6,7-tetrabromobenzotriazole in inhibiting porcine epidemic diarrhea virus infection in vitro.

[0007] The concentration of 4,5,6,7-tetrabromobenzotriazole when treating cells is 10 μmol / L.

[0008] The invention relates to an application of the 4,5,6,7-tetrabromobenzotriazole in the preparation of an antiviral drug for inhibiting porcine epidemic diarrhea virus infection.

[0009] The method for inhibiting porcine epidemic diarrhea virus infection in vitro by 4,5,6,7-tetrabromobenzotriazole comprises the following steps:

[0010] (1) Vero cells were cultured at a rate of 2.5×10 5 Cells were plated on a 24-well cell culture plate, 500 μL of DMEM medium was added to each well, and the cells were cultured in a 37°C, 5% CO2 incubator for 24 h.

[0011] (2) Replace the DMEM medium with fresh one and incubate the Vero cells at 37°C with the PEDV DR13 strain at a multiplicity of infection of 0.5 for 1.5 h. Discard the cell supernatant and wash the cells three times with PBS buffer to remove the virus particles that did not invade the cells.

[0012] (3) Add 500 μL of DMEM medium containing 10 μmol / L 4,5,6,7-tetrabromobenzotriazole to the wells of the cell culture plate and continue culturing at 37°C for 12 h.

[0013] The DMEM culture medium contains 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin.

[0014] Beneficial effects of the present invention:

[0015] The present invention uses a combination of cell biology and virology techniques to find that TBB has the effect of inhibiting PEDV infection in vitro. First, the cytotoxicity of commercial TBB was tested, and the cytotoxicity was analyzed by fluorescence quantitative PCR (RT-qPCR), protein blotting (Western blot), and virus titer experiment (TCID 50 ) et al. identified the effect of non-cytotoxic TBB in inhibiting PEDV infection in vitro and found that it could significantly inhibit the RNA content, protein expression and virus titer during PEDV infection in vitro.

[0016] The method of the present invention can significantly inhibit the in vitro infection amount of PEDV using the inhibitor TBB. When 10 μmol / L TBB was added during the infection of Vero cells with PEDV, the RNA content, protein expression and virus titer of PEDV in the TBB treatment group were significantly reduced compared with the group without the inhibitor.

[0017] Since TBB can inhibit the viral titer during PEDV infection in vitro, it can be predicted that this inhibitor can be used to prepare antiviral drugs against PEDV infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is a bar graph showing the toxicity of TBB to Vero cells;

[0019] Figure 2 is a bar graph of the relative content of PEDV RNA in Vero cells infected with PEDV;

[0020] Figure 3 It is the Western blot and bar graph of PEDV virus protein expression in Vero cells infected with PEDV;

[0021] Figure 4 It is a bar graph of the PEDV virus titer in Vero cells infected with PEDV. DETAILED DESCRIPTION

[0022] The specific embodiments of the present invention are further described in detail below with reference to the examples.

[0023] Example 1. Identification of TBB toxicity to Vero cells

[0024] Vero cells were cultured at a rate of 2.5 × 10 5 Cells were plated in 96-well cell culture plates at 4% 4% 4% 4% 2-Hydroxybutyric acid (HBSA) concentrations of 1 μg / mL. 100 μL of DMEM medium (Beijing Solebao Technology Co., Ltd., Catalog No. 12100) containing 10% (v / v) heat-inactivated fetal bovine serum (Gibco, USA, Catalog No. 10270-106), 100 U / mL penicillin, and 100 μg / mL streptomycin was added to each well and cultured in a 37°C, 5% CO2 incubator for 24 h. The original cell culture medium was removed and replaced with DMEM medium containing different concentrations of TBB (0, 10, 20, and 30 μmol / L; MCE, USA, Catalog No. HY-14394). After incubation at 37°C for 24 h, 10 μL of CCK-8 reagent (Catalog No. CK04-500T) from Dojindo, Japan, was added and cultured in a 37°C, 5% CO2 incubator for 2 h. Cytotoxicity was determined according to the operating instructions. Statistical analysis was performed using GraphPadPrism 8.0 software with unpaired, two-tailed Student's t-test; ns indicates no significant difference.

[0025] The results are as follows Figure 1 As shown, compared with the cell activity of the group without TBB treatment (0 μmol / L) (cell activity is 100%), the addition of 10, 20, and 30 μmol / L TBB had no significant effect on cell activity (ns), that is, no cytotoxicity, which can be used in subsequent examples.

[0026] Example 2. Effect of TBB on PEDV RNA Content in Vero Cells

[0027] Vero cells were cultured at a rate of 2.5 × 10 524-well cell culture plates were plated with 500 μL of DMEM medium containing 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin, and the cells were cultured in a 37°C, 5% CO2 incubator for 24 h. Fresh DMEM medium was replaced with the PEDV DR13 strain (GenBank: JQ023162.1) at a multiplicity of infection (MOI) of 0.5 at 37°C for 1.5 h. The cell supernatant was discarded, and the cells were washed three times with phosphate-buffered saline (PBS) to remove viral particles that did not invade the cells. 500 μL of DMEM medium containing 10 μmol / L TBB (the lowest non-cytotoxic TBB concentration in Example 1) was added to the wells of the cell culture plate and cultured at 37°C for 12 h. Vero cells infected with PEDV without TBB treatment were used as controls.

[0028] The cells were collected, the supernatant was discarded, and the cells were washed three times with PBS. The total RNA of PEDV-infected cells was extracted using RNA extraction reagent RNAiso Plus (Dalian TaKaRa Company, Product No. 9109), and complementary DNA (cDNA) was generated using PrimeScript RT Master Mix Reverse Transcription Kit (Dalian TaKaRa Company, Product No. RR036A) as a template for RT-qPCR. The PEDV nucleocapsid protein (N) RNA content was measured by relative RT-qPCR to represent the viral RNA content of infected cells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference in the cells, and viral RNA was normalized with GAPDH mRNA, and the expression of RNA was detected by 2 -△△CT Methods: Relative quantification was performed; primers and reaction systems are shown in Tables 1, 2, and 3; the staining method fluorescence quantitative premix AceQ UniversalSYBR qPCR Master Mix (Nanjing Novozymes Biotechnology Co., Ltd., Cat. No. Q511-03) was used; the reaction program used the Fast program provided with the ABI fluorescence quantitative PCR instrument (Applied Biosystems, USA).

[0029] Table 1 Primer sequences for relative fluorescence quantitative PCR

[0030] Primer name Sequence (5'-3') PEDV-N forward primer CGCAAAGACTGAACCCACTAAC(SEQ1) PEDV-N reverse primer TTGCCTCTGTTGTTACTTGGAGAT(SEQ2) GAPDH forward primer TGACAACAGCCTCAAGATCG(SEQ3) GAPDH reverse primer GTCTTCTGGGTGGCAGTGAT (SEQ4)

[0031] Table 2 Relative fluorescence quantitative PCR reaction system (1)

[0032] Reagents Usage AceQ Universal SYBR qPCR master Mix 10 μL PEDV-N forward primer (10 μmol / L) 0.4μL PEDV-N reverse primer (10 μmol / L) 0.4μL cDNA (50 ng) 2μL <![CDATA[ddH2O]]> to 20 μL

[0033] Table 3 Relative fluorescence quantitative PCR reaction system (2)

[0034] Reagents Usage AceQ Universal SYBR qPCR master Mix 10 μL GAPDH forward primer (10 μmol / L) 0.4μL GAPDH reverse primer (10 μmol / L) 0.4μL cDNA (50 ng) 2μL <![CDATA[ddH2O]]> to 20 μL

[0035] The experiment was performed three times with three replicates each time. The experimental data are expressed as the group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ***p<0.001 indicates extremely significant statistical differences.

[0036] The results are as follows Figure 2 The results showed that compared with the group without TBB (0 μmol / L), the PEDV RNA content in the group treated with 10 μmol / L TBB was significantly reduced (reduced by >99%), indicating that TBB can significantly reduce the PEDV RNA content in Vero cells infected with TBB.

[0037] Example 3. Effect of TBB on the expression of PEDV proteins in Vero infected cells

[0038] To verify whether TBB can reduce the expression of PEDV protein in Vero cells infected with PEDV, Western blot was performed to detect the content of PEDV N protein after TBB treatment.

[0039] Vero cells were cultured as in Example 1; the culture medium was replaced with new culture medium, and the Vero cells were infected with the PEDV DR13 strain at an MOI of 0.5 at 37°C for 1.5 h; the cell supernatant was discarded, and the cells were washed three times with PBS to remove viral particles that did not invade the cells; 500 μL of DMEM culture medium containing 10 μmol / L TBB was added to the wells of the cell culture plate, and the cells were cultured at 37°C for 12 h. Vero cells infected with PEDV without TBB treatment were used as a control.

[0040] Cells were harvested, the supernatant discarded, and washed three times with PBS. Lysed using 100 μL of RIPA (Shanghai Biotech Co., Ltd., Cat. No. P0013B). Protein concentration in the lysate was determined using a BCA protein concentration assay kit (Shanghai Biotech Co., Ltd., Cat. No. P0010) according to the kit instructions. Gel preparation, electrophoresis, membrane transfer, and blocking procedures were performed according to the second edition of the "Genetic Engineering Experiment Guide." Anti-PEDV3F12 (MEDIAN Diagnostics, South Korea, Cat. No. 9191) was used as the primary antibody, and HRP-conjugated goat anti-mouse antibody (Abbkine, USA, Cat. No. A21010) was used as the secondary antibody. An ultrasensitive ECL chemiluminescence kit (Suzhou New Saimei Biotechnology Co., Ltd., Cat. No. P10300) was used, and the chemiluminescence colorimeter was a Fusion FX VILBER Fusion FX7 (VILBER, Germany).

[0041] The experiment was performed three times with three replicates each time. The experimental data are expressed as the group mean and standard deviation (SD). Statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test. ****p<0.0001 indicated a highly significant statistical difference.

[0042] The results are as follows Figure 3 The results showed that, with actin as the internal reference, the same actin content represented the same number of cells; compared with the group without TBB (0 μmol / L), the PEDV N protein content in the group treated with 10 μmol / L TBB was significantly reduced (by about 90%), indicating that TBB can significantly reduce the expression of PEDV N protein in Vero infection.

[0043] Example 4. Effect of TBB on PEDV virus titer in Vero cells infected with

[0044] To further confirm that TBB inhibits the infection of Vero cells with PEDV, Vero cells were cultured according to Example 1; new DMEM medium was replaced, and the Vero cells were infected with PEDV DR13 strain at a virus multiplicity of infection (MOI) of 0.5 at 37°C for 1.5 h; the cell supernatant was discarded, and the cells were washed three times with PBS to wash away the virus particles that did not invade the cells; 500 μL DMEM medium containing 10 μmol / L TBB was added to the wells of the cell culture plate, and the cells were cultured at 37°C for 12 h to perform a virus titer experiment (TCID 50 ), Vero cells infected with PEDV without TBB treatment were used as control.

[0045] Uninfected Vero cells were diluted to 2.5 × 10 5 96-well cell culture plates were plated with 100 μL of DMEM medium per well, and the plates were cultured in a 37°C, 5% CO2 incubator overnight. The supernatant of the Vero cells infected for 12 hours was diluted 10-fold and inoculated into Vero cells plated with 96-well cell culture plates, with 100 μL inoculated into each well. Eight replicates were performed for each dilution. The supernatant of Vero cells infected with PEDV without TBB treatment was used as a control. The 96-well cell culture plates were cultured in a 37°C, 5% CO2 incubator. The cell growth status was observed every 24 hours, and the number of cytopathic wells was recorded. The observation was continued for 5-7 days until the number of cytopathic wells no longer increased. The TCID of the virus was calculated using the Spearman-Karber method. 50The experimental data are expressed as group mean and standard deviation (SD), and statistical analysis was performed using GraphPad Prism 8.0 software with unpaired, two-tailed Student t-test; ***p<0.001 indicates extremely significant statistical differences.

[0046] The results are as follows Figure 4 As shown, compared with the group without TBB (0 μmol / L), the PEDV virus titer in the group treated with 10 μmol / L TBB was significantly reduced (the virus titer was reduced by >3 log 10 TCID 50 / mL, i.e. 1000 times), indicating that TBB can significantly reduce the PEDV virus titer in Vero cells, which once again confirms that TBB can significantly reduce the PEDV infection amount in Vero cells.

Claims

1. Use of 4,5,6,7-tetrabromobenzotriazole in the preparation of an antiviral drug for inhibiting porcine epidemic diarrhea virus infection.

Images