Porcine epidemic diarrhea virus strains, nanobodies, and antibody cocktails

The nano-antibodies obtained through yeast two-hybrid technology screening solve the problem of poor prevention results caused by PEDV vaccine variability, provide effective PEDV neutralization ability, and provide a new direction for the treatment and prevention of PEDV.

CN119020304BActive Publication Date: 2025-08-08JIANGSU AGRI ANIMAL HUSBANDRY VOCATIONAL COLLEGE
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411293186.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-14
Publication Date
2025-08-08
Estimated Expiration
2044-09-14

AI Technical Summary

Technical Problem

The existing swine epidemic diarrhea virus (PEDV) vaccine has high variability, resulting in poor prevention and lack of effective prevention and treatment measures, especially for the high mortality rate of newborn piglets.

Method used

Nanoantibodies specifically target PEDV were screened through yeast two-hybrid technology, PEDV-JSXH-2021, a swine epidemic diarrhea virus strain PEDV-JSXH-2021 was prepared, and antibody cocktails were developed, including a variety of nanobody to enhance neutralization activity and specific binding ability.

Benefits of technology

The obtained nano-antibodies are non-toxic in vitro and can effectively neutralize PEDV infection, providing a theoretical basis for VHH-based drug treatment and prevention of PEDV-induced diarrhea, and enhancing the prevention and control ability of PEDV.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119020304B_ABST
    Figure CN119020304B_ABST
Patent Text Reader

Abstract

The present invention discloses a porcine epidemic diarrhea virus strain, a nanobody and an antibody cocktail. The porcine epidemic diarrhea virus strain is the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain, whose deposit number is CGMCC No.46088, and was deposited in the General Microbiology Center of the China Culture Collection Administration on August 14, 2024. The nanobody is obtained by screening the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain using yeast two-hybrid technology. The present invention obtains specific nanoantibodies targeting PEDV through yeast two-hybrid technology. The obtained nanoantibodies have neutralizing activity against PEDV and can effectively exert anti-PEDV effects. These nanoantibodies are non-toxic in vitro and can neutralize PEDV infection by binding to different epitopes of the spike protein, providing a theoretical basis and new research direction for the development of VHH-based drugs to treat and prevent PEDV-induced diarrhea.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biology and new medical technology, and in particular to porcine epidemic diarrhea virus strains, nanobodies and antibody cocktails. Background Art

[0002] Porcine epidemic diarrhea (PED) is an enteric disease of swine caused by the porcine epidemic diarrhea virus (PEDV), characterized by acute diarrhea. The disease is characterized by acute watery diarrhea, vomiting, and dehydration, with a high mortality rate, particularly in newborn and weaned piglets. The disease was first reported in 1971 in fattening pigs in the United Kingdom. In 1978, scientists Debouck et al. from Ghent University in Belgium successfully isolated the pathogen from infected pig specimens and named it CV777. A series of experiments demonstrated that the pathogen is pathogenic to both suckling and fattening pigs. In 2010, a new, highly virulent variant of PEDV, identified as the G2 strain, emerged in China. This new PEDV variant causes significant morbidity and mortality in newborn piglets. Both the G1 mutant and the G2 strain, which is more distantly related to CV777, are currently reported to be prevalent. Vaccination is the primary method for preventing PED and mitigating outbreaks. The emergence of new vaccines, such as subunit vaccines, viral vector vaccines, and bacterial vector vaccines, has expanded the scope of PED prevention and treatment. However, due to the high variability of the virus, the effectiveness of existing commercial vaccines has been suboptimal. To date, there are no effective preventive measures to address and control seasonal outbreaks of PED in newborn piglets. PED continues to cause significant economic losses to the pig industry.

[0003] A deep understanding of the structure and function of antigenic epitopes is crucial for the development of immunotherapeutic drugs. Antibodies, key players in the humoral immune system, have been used in clinical treatments since the late 19th century. Since then, with the deepening of antibody genetic research and the advancement of molecular biology techniques, antibody research and development has experienced rapid progress. To date, the development of therapeutic antibodies in human medicine is relatively mature, with breakthroughs particularly achieved in tumor treatment. There is also a focus on developing therapeutic antibodies for serious infectious diseases. However, related research in the veterinary field is in its infancy. As one of the world's major agricultural industries, research into the detection and development of therapeutic antibodies for swine diseases has also made initial progress. Nanobodies, among other areas, have attracted significant attention due to their small size, ease of genetic manipulation, strong specificity, and excellent solubility. Currently, there are few reports of nanobodies targeting swine diseases, and the development and application of commercial antibody therapeutics remains a long and arduous journey. With increasing market demand, there is an urgent need to develop antibody therapeutics for swine diseases to complement vaccine prevention and control, prevent and control viral infections during the vaccine window period, and provide emergency treatment for early viral infections. Nanobodies, with their unique advantages, have become a highly promising area of antibody research.

[0004] Therefore, it is an urgent problem to be solved by the present invention to provide a nanobody that can specifically bind to PEDV, is non-toxic in vitro, can effectively neutralize PEDV infection, and provides a new direction for the treatment of PEDV and prevention of PEDV-induced diarrhea. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to address the problems in the prior art such as the lack of effective vaccines for PEDV, thereby providing a porcine epidemic diarrhea virus strain, nanobody and antibody cocktail. The nanobody has the characteristics of small size, easy genetic manipulation, strong specificity and good solubility, which provides a new direction for the research of VHH-based drugs for the prevention and treatment of PEDV infection.

[0006] In order to achieve the above-mentioned purpose, the present invention provides a porcine epidemic diarrhea virus strain, which is the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain, whose preservation number is CGMCC No.46088, and it was deposited in the General Microbiology Center of China Culture Collection Administration on August 14, 2024, and the address of the preservation unit is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0007] The present invention also provides a nanobody against porcine epidemic diarrhea virus, which is obtained by yeast two-hybrid screening of the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain.

[0008] Preferably, the Nanobody is a first Nanobody having an amino acid sequence as shown in SEQ ID No: 1 (its CDR1 sequence is shown in SEQ ID No: 15, its CDR2 sequence is shown in SEQ ID No: 16, and its CDR3 sequence is shown in SEQ ID No: 17); or,

[0009] The Nanobody is a second Nanobody whose amino acid sequence is shown in SEQ ID No: 2 (its CDR1 sequence is shown in SEQ ID No: 18, its CDR2 sequence is shown in SEQ ID No: 19, and its CDR3 sequence is shown in SEQ ID No: 20); or,

[0010] The Nanobody is a third Nanobody having an amino acid sequence as shown in SEQ ID No: 3 (its CDR1 sequence is shown in SEQ ID No: 21, its CDR2 sequence is shown in SEQ ID No: 22, and its CDR3 sequence is shown in SEQ ID No: 23); or,

[0011] The Nanobody is a fourth Nanobody having an amino acid sequence as shown in SEQ ID No: 4 (its CDR1 sequence is shown in SEQ ID No: 18, its CDR2 sequence is shown in SEQ ID No: 19, and its CDR3 sequence is shown in SEQ ID No: 24); or,

[0012] The Nanobody is the fifth Nanobody with an amino acid sequence as shown in SEQ ID No: 5 (its CDR1 sequence is shown in SEQ ID No: 18, its CDR2 sequence is shown in SEQ ID No: 19, and its CDR3 sequence is shown in SEQ ID No: 25); or,

[0013] The Nanobody is the sixth Nanobody with an amino acid sequence as shown in SEQ ID No: 6 (its CDR1 sequence is shown in SEQ ID No: 26, its CDR2 sequence is shown in SEQ ID No: 27, and its CDR3 sequence is shown in SEQ ID No: 28); or,

[0014] The Nanobody is the seventh Nanobody with an amino acid sequence as shown in SEQ ID No: 7 (its CDR1 sequence is shown in SEQ ID No: 18, its CDR2 sequence is shown in SEQ ID No: 19, and its CDR3 sequence is shown in SEQ ID No: 29); or,

[0015] The nanobody is the eighth nanobody with an amino acid sequence as shown in SEQ ID No: 8 (its CDR1 sequence is shown in SEQ ID No: 18, its CDR2 sequence is shown in SEQ ID No: 19, and its CDR3 sequence is shown in SEQ ID No: 30).

[0016] Preferably, the method for preparing the Nanobody specifically comprises:

[0017] S100, extracting the RNA of the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain and then reverse transcribing it, using the cDNA obtained after reverse transcription as a template, amplifying the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain and then sequencing it to obtain the S gene sequence of the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain, and connecting the S gene sequence to a vector to obtain a bait plasmid;

[0018] S200, transforming the library plasmid and the bait plasmid obtained in step S100 into yeast cells, culturing the transformed yeast cells on SD-TLH medium, picking out grown single colonies, and screening to obtain positive yeast clones;

[0019] S300, extracting the positive yeast clone plasmid obtained in step S300 and amplifying and sequencing it by PCR, and then comparing it by Seqman and BLAST to obtain the coding gene of the nanobody;

[0020] S400, expressing the coding gene of the nanobody in step S300, and obtaining the nanobody accordingly.

[0021] Preferably, in step S100, the amplification process is segmented PCR amplification, and the S gene sequence of the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain is obtained by sequencing and splicing the multiple amplification products after the segmented amplification.

[0022] Preferably, the segmented PCR amplification process uses two pairs of primers for amplification, and the first amplification primer pair is shown as SEQ ID No: 9 and SEQ ID No: 10, and the second amplification primer pair is shown as SEQ ID No: 11 and SEQ ID No: 12.

[0023] Specifically, the S gene of the porcine epidemic diarrhea virus (PEDV-JSXH-2021) strain was amplified in two parts (labeled as S1 and S2). The S1 gene was amplified using a first amplification primer pair, and the S2 gene was amplified using a second amplification primer pair. After amplification, the two amplified products were sequenced separately and then spliced to obtain the complete S gene sequence. There is some overlap between the S1 and S2 genes.

[0024] Preferably, in step S300, the PCR amplification process uses the primer pair shown in SEQ ID No: 13 and SEQ ID No: 14 for amplification; and / or,

[0025] The ligation vector in step S100 is a pGBKT7 vector; and / or,

[0026] The library plasmid in step S200 is a pGADT7-VHH plasmid library.

[0027] The present invention also provides an antibody cocktail for porcine epidemic diarrhea virus, comprising at least two of the first nanobody, second nanobody, third nanobody, fourth nanobody, fifth nanobody, sixth nanobody, seventh nanobody and eighth nanobody as described above.

[0028] Preferably, the antibody cocktail comprises at least two of the first nanobody, the third nanobody, the fourth nanobody, the fifth nanobody, the sixth nanobody, the seventh nanobody and the eighth nanobody.

[0029] Preferably, the antibody cocktail comprises a first nanobody, a third nanobody, a fourth nanobody, a fifth nanobody, a sixth nanobody, a seventh nanobody and an eighth nanobody; and,

[0030] The concentration of each Nanobody in the antibody cocktail was 25-50 ng / μL.

[0031] Through the above technical solution, the present invention discloses a porcine epidemic diarrhea virus strain, and on this basis, a specific nanobody targeting PEDV is screened through yeast two-hybrid technology. At the same time, the obtained nanoantibody has neutralizing activity against PEDV and can effectively exert an anti-PEDV effect. In addition, these nanoantibodies are non-toxic in vitro and can neutralize PEDV infection by binding to different epitopes on the spike protein. The nanoantibodies obtained based on the present invention have considerable potential for further development into antibody therapeutics, and also provide a theoretical basis and new research direction for the development of VHH-based drugs to treat and prevent PEDV-induced diarrhea. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following detailed description, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0033] Figure 1A 2 is a diagram showing the transformation of the bait plasmid pGBKT7-PEDV-S into the recipient bacterium AH109 and the self-activation detection results thereof in Example 2;

[0034] Figure 1B This is the positive yeast clone obtained by screening on the SD-TLHA+X-α-gal screening plate in Example 2;

[0035] Figure 1C This is a diagram showing the results of the positive yeast clone rotation verification in Example 2;

[0036] Figure 2A This is a graph showing the expression of PEDV S-VHHs in HEK293T cells detected by indirect immunofluorescence in Example 3;

[0037] Figure 2B This is a graph showing the expression of PEDV S-VHHs in HEK293T cells detected by Western blotting in Example 3;

[0038] Figure 2C is a diagram showing the results of SDS-PAGE analysis of the protein purified in Example 4;

[0039] Figure 3A This is a graph showing the results of indirect immunofluorescence detection of the specific binding of PEDV S-VHHs to S protein in Verification Example 1;

[0040] Figure 3B This is a graph showing the results of Western blotting to detect the specific binding of PEDV S-VHHs to S protein in Verification Example 1;

[0041] Figure 4 This is a graph showing the results of indirect immunofluorescence detection of the specific binding of purified PEDV S-VHHs to PEDV in Verification Example 1;

[0042] Figure 5 This is a graph showing the results of the neutralization activity assay of PEDV S-VHHs against PEDV in the application example. DETAILED DESCRIPTION

[0043] The following is a detailed description of the specific embodiments of the present invention. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0044] Specifically, the present invention provides a porcine epidemic diarrhea virus strain, which is the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain, whose preservation number is CGMCC No. 46088, and it was deposited in the General Microbiology Center of China Culture Collection Administration on August 14, 2024.

[0045] The present invention prepares nanobodies based on the porcine epidemic diarrhea virus strain, and its preparation method is described in detail below with reference to specific examples.

[0046] The HiScript IV 1st Strand cDNA Synthesis Kit and 2×Phanta Flash MasterMix used are conventional commercial products of Nanjing Novozymes Biotechnology Co., Ltd., the EZNAGel Extraction Kit is a conventional commercial product of Omega Bio-Tek, USA, the T vector is a conventional commercial product of Beijing Solebeau Technology Co., Ltd., the library plasmid pGADT7-VHH, Yeast Colony Rapid Detection Kit, and AH109 yeast are conventional commercial products of Nanjing Ruiyuan Biotechnology Co., Ltd., the X-tremeGENE HP DNA Transfection Reagent is a conventional commercial product of Roche, Switzerland, the Lipo293 transfection reagent and desalting column are conventional commercial products of Beyotime Biotechnology, and the HisSep Ni-NTAMagBeads are conventional commercial products of Yisheng Biotechnology.

[0047] Example 1. Acquisition of PEDV S gene sequence:

[0048] RNA from the porcine epidemic diarrhea virus (PEDV)-JSXH-2021 strain was extracted using the FastPure Viral DNA / RNA Mini Kit and the HiScript IV 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China), and cDNA was obtained by reverse transcription. The PEDV S gene sequence was amplified using 2× Phanta Flash Master Mix (Vazyme, Nanjing, China) using the cDNA as a template. The PEDV S gene sequence was amplified in two parts: the S1 gene and the S2 gene. The S1 gene was amplified using primers S1-2F (SEQ ID No: 9: 5'-TGAAGAATGGTAAGTTGCTAGTGC-3') and S1-7R (SEQ ID No: 10: 5'-TGGGTGAGTAATTGTTTACAACG-3'). The primers for amplifying the S2 gene were L-PEDV-S2-F1 (SEQ ID No: 11: 5'-GGGAGTTGCCTGGTTTCTTC-3') and L-PEDV-S2-R3 (SEQ ID No: 12: 5'-CATTCACTGCACGTGGACC-3'). The amplified products of the S1 and S2 genes were recovered using an EZNA Gel Extraction Kit (Omega Bio-tek, Norcross, GA, USA), ligated into a T vector (SolarbioScience Technology, Beijing, China), and sequenced. The S gene sequence was obtained by sequencing (i.e., by sequencing the amplified S1 and S2 genes separately and then splicing them together). The recombinant plasmid obtained by ligating the S gene sequence into the pGBKT7 vector was designated as the bait plasmid, which was designated pGBKT7-PEDV-S.

[0049] Example 2: Screening of PEDV S-VHHs

[0050] The PEDV-S gene linked to the pGBKT7 vector (i.e., the bait plasmid pGBKT7-PEDV-S prepared in Example 1) was used as bait to screen the pGADT7-VHH library by yeast two-hybrid screening. The steps are as follows:

[0051] First, pGBKT7-PEDV-S and pGBKT7 were transformed into AH109 cells for self-activation testing. The transformation method was as follows: a single AH109 colony was picked from a YPDA plate and inoculated into 4 mL of YPDA liquid medium. The culture was shaken at 30°C, 225 rpm, and incubated overnight for 18-20 hours to an OD600 > 1.5. The culture was then transferred to 50 mL of YPDA liquid medium, with an initial OD600 of 0.2. The culture was shaken at 30°C, 225 rpm, and incubated for 4-5 hours to an OD600 of 0.6. The cells were harvested by centrifugation at 4000 rpm for 5 minutes at room temperature. The cells were resuspended in 20 mL of sterile water, mixed, and harvested by centrifugation at 4000 rpm for 5 minutes at room temperature. The supernatant was discarded. The cells were resuspended in 5 mL of 0.1 mol / L LiAc, mixed, harvested by centrifugation at 4000 rpm for 5 minutes at room temperature, and the supernatant was discarded. Resuspend the cells in 500 μL of 0.1 mol / L LiAc, mix thoroughly, and aliquot into 1.5 mL centrifuge tubes, 50 μL each (for each transformation) for later use. To each 1.5 mL centrifuge tube, add 240 μL of 50% PEG3350, 36 μL of 1 mol / L LiAc, and 5 μL of ssDNA (20 mg / mL, ssDNA is pGBKT7-PEDV-S or pGBKT7 plasmid) in sequence. After addition, pipette to mix thoroughly or shake vigorously for about 1 minute until completely mixed. Incubate in a 30°C water bath for 30 minutes, heat shock in a 42°C water bath for 25 minutes, and resuspend in a 30°C water bath for 30 minutes. Harvest the cells by centrifugation at 4000 rpm for 5 minutes at room temperature, and discard the supernatant. For each transformation, 200 μL of sterile water was used to suspend the bacteria, and the mixture was mixed as gently as possible. The bacteria were spread on SD-T (SD / -Trp) plates and cultured at 30°C for 3-4 days to obtain yeast cells transformed with the bait plasmid pGBKT7-PEDV-S (i.e., the AH109 yeast strain containing the bait plasmid pGBKT7-PEDV-S). Three cloning points were randomly picked and placed on SD-T, SD-TH (SD / -Trp / -His), SD-THA (SD / -Trp / -His / -Ade), and SD-THA+X-α-gal plates and cultured at 30°C for 3-5 days. Among them, pGBKT7 was used as a negative control. The results of the transformation of the bait plasmid pGBKT7-PEDV-S into the recipient bacteria AH109 and its self-activation detection are shown in the figure. Figure 1A As shown. Figure 1A As can be seen, the negative control, pGBKT7, can grow on SD-T plates but cannot grow normally on SD-TH, SD-THA, or SD-THA + X-α-gal plates. Growth in the experimental and control groups is consistent, indicating that the bait plasmid, pGBKT7-PEDV-S, does not self-activate.

[0052] Library screening: The AH109 yeast strain containing the bait plasmid pGBKT7-PEDV-S obtained above was used as the receptor to prepare the competent state, and the library plasmid pGADT7-VHH (Ruiyuan biotechnology, Nanjing, China) was transferred into it, and 20 SD-TLH (SD / -Trp / -Leu / -His) screening plates were coated. Cultured at a constant temperature of 30°C for 3-7 days, and the colony growth was observed. Pick out the grown clone colonies, transfer them to the SD-TLHA (SD / -Trp / -Leu / -His / -Ade) + X-α-gal screening plates and continue to culture for 3-5 days to screen for positive yeast clones. After screening, a total of 288 positive yeast clones were obtained. The positive yeast clones obtained by screening in the SD-TLHA + X-α-gal screening plates are as follows. Figure 1B As shown, Figure 1B The + in the figure is the positive control pGADT7-largeT+pGBKT7-p53 commonly used in yeast two-hybrid assay.

[0053] Yeast positive clone identification and sequencing comparison: The 288 positive yeast clones obtained above were amplified using the Yeast Colony Rapid Detection Kit (Ruiyuan biotechnology, Nanjing, China). The amplification primer pair used for positive yeast clones was T7-F: TAATACGACTCACTATAGG (SEQ ID No: 13), BD-R: GAATTAGCTTGGCTGCAAGC (SEQ ID No: 14). After DNA sequencing and BLAST comparison analysis, 8 different gene sequences were finally obtained (as shown in Table 2). The 8 obtained gene sequences were expressed accordingly, and the 8 corresponding amino acid sequences obtained are shown in Table 1 (wherein "*" in Table 1 corresponds to the terminator in the gene sequence in Table 2), and the 8 different amino acid sequences obtained were uniformly recorded as VHH antibody sequences.

[0054] The yeast positive clones containing the 8 different gene sequences obtained above were rotated and verified: the positive clones streaked on the SD-TLHA+X-α-gal deficiency plate were diluted with sterile water and spotted on SD-TL, SD-TLH, SD-TLHA, and SD-TLHA+X-α-gal deficiency plates, and cultured at 30°C for 3-4 days. The results of the yeast positive clone rotation verification are as follows: Figure 1C As shown. Among them, Figure 1CThe + in the figure is the positive control pGADT7-largeT+pGBKT7-p53, which is commonly used in yeast two-hybrid assays. The - in the figure is the negative control pGADT7-largeT+pGBKT7-laminC, which is commonly used in yeast two-hybrid assays. Figure 1C As can be seen, the positive control can grow on SD-TL, SD-TLH, SD-TLHA, and SD-TLHA+X-α-gal-deficient plates, and appears blue on SD-TLHA+X-α-gal-deficient plates. The negative control can only grow on SD-TL plates and not on other plates. The eight positive yeast clones screened all grow normally on SD-TL, SD-TLH, and SD-TLHA-deficient plates and appear blue on SD-TLHA+X-α-gal plates. Therefore, it was confirmed that the present invention obtained a total of 8 PEDVS-VHHs that interacted with the bait plasmid pGBKT7-PEDV-S through yeast two-hybrid screening, and the obtained PEDV S-VHHs expressed corresponding nanobodies. The expressed nanobodies (ie, PEDV S-VHH expressed proteins) were named VHH1-4 (ie, the first nanobody), VHH1-15 (ie, the second nanobody), VHH1-41 (ie, the third nanobody), VHH1-89 (ie, the fourth nanobody), VHH2-18 (ie, the fifth nanobody), VHH2-28 (ie, the sixth nanobody), VHH2-50 (ie, the seventh nanobody), and VHH2-77 (ie, the eighth nanobody). The amino acid sequences of the eight nanobodies are shown in Table 1.

[0055] Table 1

[0056]

[0057]

[0058]

[0059] Table 2

[0060]

[0061]

[0062]

[0063]

[0064] Example 3, Eukaryotic expression of PEDV S-VHHs:

[0065] The eight PEDV S-VHHs obtained above were expressed in HEK293 T and FreeStyle 293-F cell lines, respectively. (Because subsequent experiments required multiple simultaneous assays for each of the eight PEDV S-VHHs, when parallel assays were performed using the same protocol, they were all referred to as PEDV S-VHHs.) When the HEK293 T cells reached 70%-90% confluence, plasmid DNA (pcDNA3.1-VHH) was transfected into the cells using X-tremeGENE HP DNA Transfection Reagent (Roche, Basel, Switzerland). After 72 hours, the culture supernatant and cell pellet were collected and assayed for expression of the PEDV S-VHHs protein.

[0066] When the density of Freestyle 293-F cells in 50 mL suspension culture reaches about 2×10 6 Cell viability should be >90% at 400 μg / mL. Transfection was performed when the cell viability was >90%. Two clean, sterile centrifuge tubes were each filled with 1.25 mL of antibiotic- and serum-free Freestyle 293-F cell culture medium. 50 μg of plasmid DNA (pCDNA3.1-VHH) was added to one tube, and 100 μL of Lipo293 transfection reagent (Beyotime Biotechnology, Shanghai, China) was added to the other tube. Both tubes were gently pipetted to mix thoroughly. The culture medium containing DNA was then gently added to the culture medium containing Lipo293 transfection reagent using a pipette. Gently invert the centrifuge tube or pipette to mix thoroughly, and the mixture was allowed to stand at room temperature for 15 minutes. 2.5 mL of the Lipo293 transfection reagent-DNA mixture was added to 50 mL of suspension-cultured Freestyle 293-F cells. After incubation for 72 hours in a shaking incubator at 37°C, 125 rpm, and 8% CO2, the cells were harvested and assayed for target protein expression. Figure 2A To detect the expression of PEDV S-VHHs in HEK293T cells by indirect immunofluorescence, mouse anti-his tag monoclonal antibody was used to label VHH1-4, VHH1-15, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77, respectively. Bar = 100 μm; Figure 2BTo detect the expression of PEDV S-VHHs in HEK293T cells by Western blotting, mouse anti-his tag monoclonal antibody was used to label VHH1-4, VHH1-15, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77, respectively. The target protein size was approximately 15 kDa. Figure 2A and Figure 2B As can be seen (the control group consisted of FreeStyle293-F cell pellets transfected with an empty vector), both IFA and Western blotting assays demonstrated successful expression of PEDV S-VHHs. Compared to VHH1-4, VHH1-15, VHH1-41, VHH2-18, and VHH2-28, VHH1-89, VHH2-50, and VHH2-77 showed lower expression levels.

[0067] Example 4: Protein purification and renaturation

[0068] VHHs expressed in FreeStyle 293-F cells were purified using HisSep Ni-NTAMagBeads (Yeasen Biotechnology, Shanghai, China). 50 mL of FreeStyle 293-F cells, 72 hours post-transfection, were harvested and added to a 1:10 (w / v) ratio of cells to lysing buffer. PMSF was added to a final concentration of 1 mmol / L and the cells were disrupted by sonication on ice until the lysate remained essentially clear. Lysing buffer (containing 8 mol / L urea) was added to the lysate to a total volume of 40 mL. The supernatant was mixed overnight at 4°C to completely solubilize the inclusion body proteins. The supernatant was centrifuged at 15,000 × g at 4°C for 15 min, and the supernatant was transferred to a new 50 mL centrifuge tube. Magnetic beads were added to the supernatant and the tube was inverted and mixed overnight at 4°C. After washing five times with Wash Buffer (containing 8 M urea), the protein was eluted with Elution Buffer (containing 8 mol / L urea). The eluted proteins were renatured using a desalting column (Beyotime Biotechnology, Shanghai, China). The concentration of the final renatured PEDV S-VHHs was adjusted to 200 ng / μL for subsequent experiments and stored at -80°C until use. The purified proteins were analyzed by SDS-PAGE (the control group was a FreeStyle 293-F cell pellet sample transfected with an empty vector). Figure 2CAs shown, VHH1-4, VHH1-15, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77 had a single, distinct protein band near the 15 kDa position. The protein sizes were consistent with expectations, indicating that all eight PEDV S-VHHs were successfully purified. After renaturation of the purified antibodies using a desalting column, their concentrations were measured to be 0.914 μg / μL, 0.271 μg / μL, 0.593 μg / μL, 0.359 μg / μL, 0.228 μg / μL, 0.596 μg / μL, 0.322 μg / μL, and 0.386 μg / μL, respectively.

[0069] Verification Example 1: Whether PEDV S-VHHs can bind to PEDV and S protein:

[0070] The binding activity of PEDV S-VHHs to PEDV S protein was evaluated by IFA and Western blotting. In the present invention, the PEDV S protein used to detect the reactivity of PEDV S-VHHs was obtained by expressing the S protein in Sf9 cells using the PEDV S protein recombinant baculovirus expression plasmid pFastBac1-PEDV-S. Figure 3A As shown in Figure 2, the renatured VHH1-4, VHH1-15, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77 were all able to detect the PEDV S protein expressed in Sf9 cells. In addition, Sf9 cell samples expressing the S protein were collected, and after ultrasonic disruption, the supernatant was used for Western blotting experiments. As expected, the PEDV S-VHHs were all able to specifically detect a band of about 180 kDa, indicating that they all bound to the PEDV S protein (see Figure 2). Figure 3B As shown). In order to further confirm whether the purified PEDV S-VHHs specifically bind to PEDV, IFA analysis was performed. The results showed that VHH1-4, VHH1-15, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77 were able to stain Vero cells infected with PEDV-JSXH-2021 strain, but did not react with uninfected control cells, indicating that the purified PEDV S-VHHs specifically bind to PEDV (as shown). Figure 4 shown).

[0071] Verification Example 2: Neutralization of PEDV by PEDV S-VHHs:

[0072] To determine the neutralizing activity of these eight VHHs against PEDV, a neutralization experiment was performed. The concentration of the final renatured PEDVS-VHHs was uniformly adjusted to 200 ng / μL and serially diluted for neutralization testing. Figure 5 As shown in Figure AG, VHH1-4, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77 had neutralizing titers against PEDV-JSXH-2021 strain, with the highest coefficients being 1:2, 1:8, 1:16, 1:4, 1:4, 1:8, and 1:16, respectively, and the corresponding virus neutralization titers were 100 ng / μL, 25 ng / μL, 12.5 ng / μL, 50 ng / μL, 50 ng / μL, 25 ng / μL, and 12.5 ng / μL, respectively. No neutralizing activity was observed for VHH1-15. These results indicate that VHH1-4, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77 have the potential to neutralize viral infection in vitro.

[0073] Application Examples

[0074] The seven VHHs (VHH1-4, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77) detected above with neutralizing activity were prepared into a "cocktail" antibody (each antibody was approximately 30 ng / μL). The results showed that the combination of these nanobodies neutralized viral infection at 6.25 ng / μL, showing a better effect than using nanobodies alone. The specific results are as follows Figure 5 shown. Figure 5 In the figure, the graphs labeled AG correspond to the neutralization activity assays of VHH1-4 (A), VHH1-41 (B), VHH1-89 (C), VHH2-18 (D), VHH2-28 (E), VHH2-50 (F), and VHH2-77 (G) against PEDV-JSXH-2021 strain. The initial concentration of each antibody was uniformly adjusted to 200 ng / μL. Figure 5 In the figure marked H, the neutralizing activity test of VHH1-4, VHH1-41, VHH1-89, VHH2-18, VHH2-28, VHH2-50, and VHH2-77 against the PEDV-JSXH-2021 strain after mixing.

[0075] The present invention uses the PEDV-S gene constructed on the pGBKT7 vector as bait to screen a yeast two-hybrid nanobody library. Positive clones undergo multiple reporter gene assays, DNA sequencing, and BLAST comparison analysis to identify PEDV S-VHHs that interact with pGBKT7-PEDV-S. The binding specificity of these nanobodies to the S protein and PEDV was verified by indirect immunofluorescence staining (IFA) and Western blotting, respectively, and their neutralization efficiency was verified by neutralization experiments. This lays the foundation for the development of VHH-based drugs for the prevention and treatment of PEDV infection.

[0076] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0077] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0078] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A nanobody against porcine epidemic diarrhea virus, characterized in that The nanoantibody is obtained by yeast two-hybrid screening of the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain; and the nanoantibody is a first nanoantibody whose amino acid sequence is as shown in SEQ ID No: 1; or, the nanoantibody is a third nanoantibody whose amino acid sequence is as shown in SEQ ID No: 3; or, the nanoantibody is a fourth nanoantibody whose amino acid sequence is as shown in SEQ ID No: 4; or, the nanoantibody is a fifth nanoantibody whose amino acid sequence is as shown in SEQ ID No: 5; or, the nanoantibody is a sixth nanoantibody whose amino acid sequence is as shown in SEQ ID No: 6; or, the nanoantibody is a seventh nanoantibody whose amino acid sequence is as shown in SEQ ID No: 7; or, the nanoantibody is an eighth nanoantibody whose amino acid sequence is as shown in SEQ ID No: 8; wherein the deposit number of the porcine epidemic diarrhea virus PEDV-JSXH-2021 strain is CGMCC No.46088, and it was deposited in the General Microbiology Center of the China Culture Collection Administration on August 14, 2024.

2. An antibody cocktail for porcine epidemic diarrhea virus, characterized in that: The antibody cocktail comprises at least two of the first, third, fourth, fifth, sixth, seventh and eighth nanobodies as described in claim 1 .

3. The antibody cocktail according to claim 2, characterized in that The antibody cocktail includes a first nanobody, a third nanobody, a fourth nanobody, a fifth nanobody, a sixth nanobody, a seventh nanobody and an eighth nanobody; and the concentration of each nanobody in the antibody cocktail is 25-50 ng / μL.

Citation Information

Patent Citations

  • Porcine epidemic diarrhea virus variant obtained through separation and application thereof

    CN116286679A

  • Nano antibody for resisting porcine epidemic diarrhea virus S1 protein

    CN118126167A

  • Humanized rabies virus nano-antibody, recombinant nano-antibody protein and application of humanized rabies virus nano-antibody and recombinant nano-antibody protein in preparation of rabies prevention and treatment products

    CN118440190A