Application of ailanone in preparation of medicine for resisting porcine epidemic diarrhea virus

By using ailanthus ketone to inhibit the ribosomal frameshift process of PEDV, a drug against porcine epidemic diarrhea virus (PEDV) that is insensitive to viral mutations has been developed. This solves the problem of difficulty in controlling PEDV variants in existing technologies and achieves effective inhibition and treatment of multiple genotypes.

CN121360113APending Publication Date: 2026-01-20GIANTSTAR FARMING & ANIMAL HUSBANDRY CORP LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511807025.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-03
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively suppress variants of porcine epidemic diarrhea virus (PEDV), leading to increased difficulty in prevention and control, and existing vaccines face the challenge of high mutation rates.

Method used

By using ailanthus ketone as the active ingredient, a broad-spectrum antiviral drug is developed that blocks viral replication and proliferation by inhibiting the -1 ribosomal frameshift process of PEDV.

Benefits of technology

Ailanthone exhibits significant inhibitory effects against multiple genotypes of PEDV and is insensitive to viral mutations, thus effectively preventing and treating porcine epidemic diarrhea.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121360113A_ABST
    Figure CN121360113A_ABST
Patent Text Reader

Abstract

The invention provides application of ailanone in preparation of a medicine for resisting porcine epidemic diarrhea virus, and belongs to the technical field of chemical medicines. Experimental results show that the ailanone has remarkable inhibiting and blocking effects on a-1 ribosomal Frameshift process of a porcine epidemic diarrhea virus (PEDV), can effectively inhibit replication and proliferation of the PEDV, and has an inhibiting effect on a plurality of common strains of the PEDV; the ailanone can be used for preparing anti-PEDV medicines and medicines for preventing and treating porcine epidemic diarrhea caused by PEDV, and the medicines are wide-spectrum antiviral medicines, are insensitive to variation of PEDV and have wide application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of chemical medicine, specifically relating to the application of ailanthus ketone in the preparation of drugs against porcine epidemic diarrhea virus. Background Technology

[0002] Porcine epidemic diarrhea virus (PEDV) is a highly contagious coronavirus belonging to the genus *Alpha* of the family Coronaviridae. It primarily infects pigs, especially newborn piglets, where mortality rates are extremely high, often resulting in significant economic losses for the poultry industry. The PEDV genome is a single-stranded, positive-sense RNA of approximately 28 kb, encoding various structural and non-structural proteins. In recent years, PEDV has seen continuous mutations, with some strains exhibiting significantly enhanced pathogenicity and transmissibility, further increasing the difficulty of control. Current research on PEDV mainly focuses on viral receptor recognition, immune evasion mechanisms, and vaccine development. Although some candidate vaccines have entered the trial stage, the high mutation rate of the virus remains a major challenge for control. Therefore, there is an urgent need to develop an antiviral drug that is insensitive to viral mutations. Summary of the Invention

[0003] To address the shortcomings of the existing technology, the present invention aims to provide the application of ailanthus ketone in the preparation of drugs against porcine epidemic diarrhea virus.

[0004] The technical solution adopted in this invention is as follows:

[0005] Application of ailanthus ketone in the preparation of drugs against swine epidemic diarrhea virus.

[0006] Ailanthone is a natural component of the ailanthus tree, extracted from its bark. It has been reported to exhibit strong cytotoxicity against liver cancer cells, potentially exerting its effects through regulation of the cell cycle and androgen receptor pathways.

[0007] The molecular formula of ailanthophyllone is: C 20 H 24 O7;

[0008] The structural formula of ailanthus ketone is:

[0009] .

[0010] In one embodiment of this application, the drug is a drug for preventing and / or treating porcine epidemic diarrhea disease caused by porcine epidemic diarrhea virus infection.

[0011] In one embodiment of this application, the drug is a drug that inhibits the replication of porcine epidemic diarrhea virus.

[0012] In one embodiment of this application, the drug is a drug that inhibits the proliferation of porcine epidemic diarrhea virus.

[0013] In one embodiment of this application, the porcine epidemic diarrhea virus includes one or more genotype strains selected from G1a, G1b, G2a, G2b, and G2c.

[0014] In one embodiment of this application, the drug comprises ailanthus ketone and pharmaceutically acceptable excipients.

[0015] In one embodiment of this application, the ailanthus ketone inhibits the replication, proliferation, or prevention of porcine epidemic diarrhea virus by inhibiting the -1 ribosome frameshift process of the porcine epidemic diarrhea virus.

[0016] In one embodiment of this application, the drug is an oral preparation or an injection.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] A ribosomal frameshift element exists in the middle of the open reading frame 1 (ORF1) of the PEDV genome. The virus precisely regulates the expression of genes following ORF1 through this element, including RdRP (RNA-dependent RNA polymerase), a key component of the viral replication complex. Inhibiting the ribosomal frameshift effectively prevents PEDV amplification; therefore, the ribosomal frameshift element is an ideal target for small molecule drugs. Furthermore, this ribosomal frameshift element has a low mutation rate, making inhibitors targeting it insensitive to mutations.

[0019] This application discovers a novel application of ailanthus ketone in inhibiting PEDV. Experiments have demonstrated that ailanthus ketone exhibits a highly significant inhibitory and blocking effect on the -1 ribosomal frameshifting process of PEDV, effectively suppressing PEDV replication and thus inhibiting PEDV proliferation. Furthermore, it shows inhibitory effects against multiple genotypes of PEDV, indicating that the inhibition of PEDV proliferation by ailanthus ketone is insensitive to PEDV mutations. Therefore, ailanthus ketone can be used to treat and prevent porcine epidemic diarrhea caused by PEDV infection, to prepare anti-PEDV drugs, and to prepare drugs for treating and preventing porcine epidemic diarrhea caused by PEDV infection. These drugs are broad-spectrum antiviral agents, insensitive to PEDV mutations, and have promising application prospects.

[0020] PEDV is mainly divided into two genotypes: G1 (classical strain) and G2 (mutant strain). G1 is further divided into two subgroups, G1a and G1b, while G2 is divided into three subgroups: G2a, G2b, and G2c. The ailanthus ketone discovered in this application has a highly significant inhibitory effect on all five subgroups of PEDV strains (G1a, G1b, G2a, G2b, and G2c). Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0022] Figure 1 A schematic diagram (a), a schematic diagram (b), and experimental results (c) illustrate the design principle of ailanthophyll in inhibiting the PEDV ribosomal frameshift process in a luciferase reporter system.

[0023] Figure 2 The diagram shows the design principle (a), experimental procedure (b), and experimental results (c) for ailanthus ketone to inhibit the PEDV ribosome frameshift process in a fluorescent protein reporter system.

[0024] Figure 3 The results of experiments on the toxicity of different concentrations of alpinone to Vero cells and the results of experiments on its antiviral activity against intracellular PEDV are presented.

[0025] Figure 4 This is the experimental result of the inhibitory effect of ethiophene on CPE (cytopathic effect) induced by PEDV G2c strain in Vero cells.

[0026] Figure 5 The results of antiviral experiments using aralia elata ketone against PEDV (G1a, G1b, G2a, G2b, and G2c strains) were obtained by RT-PCR.

[0027] Figure 6 This is the result of an antiviral experiment on PEDV in live pigs using ailanthus ketone. Detailed Implementation

[0028] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0029] Example 1

[0030] Evaluation of the inhibitory effect of ailanthoides on the -1 Ribosomal Frameshifting process of PEDV (luciferase reporter system).

[0031] 1. Experimental Methods

[0032] The inhibitory effect of ailanthone on the -1 ribosomal frameshifting process of PEDV was investigated using in vitro cell culture. First, a lentiviral vector containing the PEDV viral genome sliding sequence was constructed, and the drug's effect was detected in the porcine kidney cell line PK15. The initial screening concentration of the drug was 10 μM.

[0033] 1.1. Construction of luciferase reporter gene vector

[0034] (1) Synthesis of PEDV virus-1 Ribosomal Frameshift sliding region gene sequence (frameshift elements of 5 strains were synthesized respectively: G1a, G1b, G2a, G2b, G2c). The lentiviral backbone vector was double-digested with EcoRI+BamHI. Digestion conditions: 37℃, 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PEDV virus-1 Ribosomal Frameshift sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealing product was mixed with the digestion product at a ratio of annealing product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture and ligated in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PEDV virus-1 Ribosomal Frameshift gene sequence was added to every 100 μL of competent cells, and the mixture was incubated on ice for 30 minutes. The mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the solid LB medium using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB medium. After incubation at 37°C for 8 hours, the plaques were sent to a commercial sequencing company for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.

[0035] (2) By homologous recombination, the luciferase of Renidae was constructed upstream of the -1 Ribosomal Frameshift region, and the luciferase of Firefly was constructed downstream of the -1 Ribosomal Frameshift region.

[0036] The specific method is as follows: The gene sequences of Renidae luciferase and firefly luciferase were amplified by PCR, and homologous arms were added upstream and downstream of the sequences, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel recovery products of Renidae luciferase and firefly luciferase and the linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel recovery products of Renidae luciferase and firefly luciferase and the linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombination enzyme were added. The mixture was reacted at 37°C for 15 minutes.

[0037] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).

[0038] 1.2. Establishing a luciferase reporter gene screening cell system

[0039] (1) The viral backbone vector containing dual luciferase and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector were mixed with PEI (polyethyleneimine) in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.

[0040] (2) Collect the culture supernatant of 293T cells 48h and 72h after transfection with viral plasmid, centrifuge at 12000g for 10min to remove cell impurities, and then collect lentivirus particles by cesium chloride gradient centrifugation.

[0041] (3) Lentiviral particles were added to PK15 cells. After 7 days of infection, positive cells were screened by Puro. Single-cell suspensions were prepared by trypsin digestion of the cells and single-clone sorting was performed by flow cytometry.

[0042] (4) Genotyping of the cultured monoclonal cells and expansion culture of positive clones to obtain PK15 cells (CMV-Renilla-framshift-Firefly) containing the -1 Ribosomal Frameshift region.

[0043] 1.3. Drug screening based on luciferase reporter genes

[0044] (1) Five types of PK15 cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After 24 hours, different test compounds (control group: DMSO; experimental group: ailanthus ketone) were added to the plate, with a drug concentration of 10 μM.

[0045] (2) After culturing for 8 hours, the cells were lysed, and firefly luciferase substrate was added to the lysate. After 0.5 hours, the luminescence value was detected by an enzyme-linked immunosorbent assay (ELISA) reader.

[0046] (3) Add the Renaissance luciferase substrate and detect the luminescence value using an enzyme-linked immunosorbent assay (ELISA) reader.

[0047] (4) The ratio of firefly luciferase to Renilla luciferase is used as a reference for the -1 Ribosomal Frameshift efficiency. A larger ratio indicates a higher -1 Ribosomal Frameshift efficiency, and a lower ratio indicates a lower -1 Ribosomal Frameshift efficiency. In other words, a lower ratio indicates a higher efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and a better ability to inhibit the -1 Ribosomal Frameshift process.

[0048] 2. Experimental Results

[0049] Experimental results are as follows Figure 1 As shown, Figure 1 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by ailanthophyll in a luciferase reporter system. Specifically, Figure 1 In the 'a' section, the reporter gene design scheme is as follows: when ribosome frameshift occurs normally, both the reporter genes Renilla and Firefly are expressed. However, when ribosome frameshift is blocked, the reporter gene Renilla is expressed, while Firefly is not expressed. Figure 1 The workflow of the multivariate mixed screening reporter system is as follows: First, the reporter vector is stably integrated into the host cell (porcine kidney cell line PK15) via a lentiviral vector. The mixed system of 5 positive monoclonal cells is then treated with compounds (control group: DMSO; experimental group: ailanthus ketone). The effect of the compounds on the PEDV ribosome frameshift process is determined by a dual-luciferase reporter gene assay kit and an enzyme-linked immunosorbent assay (ELISA) reader. Figure 1 In the image, 'c' represents the results of the luciferase reporter gene screening experiment. (From...) Figure 1 As shown in Figure c, 10 μM ailanthoone significantly inhibited the -1 ribosomal frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (* indicates P < 0.05).

[0050] Example 2

[0051] Evaluation of the inhibitory effect of ailanthus ketone on the -1 Ribosomal Frameshifting process of PEDV (fluorescent protein reporter system).

[0052] 1. Experimental Methods

[0053] 1.1. Construction of fluorescent protein reporter gene vector

[0054] (1) Synthesis of PEDV virus-1 Ribosomal Frameshift sliding region gene sequence (frameshift elements of 5 strains were synthesized respectively: G1a, G1b, G2a, G2b, G2c). The lentiviral backbone vector was double-digested with EcoRI+BamHI. Digestion conditions: 37℃, 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PEDV virus-1 Ribosomal Frameshift sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealing product was mixed with the digestion product at a ratio of annealing product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture and ligated in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PEDV virus-1 Ribosomal Frameshift gene sequence was added to every 100 μL of competent cells, and the mixture was incubated on ice for 30 minutes. The mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the solid LB medium using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB medium. After incubation at 37°C for 8 hours, the plaques were sent to a commercial sequencing company for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.

[0055] (2) By homologous recombination, ubiquitin-green fluorescent protein (Ub-GFP) was constructed upstream of the -1 Ribosomal Frameshift region, and red fluorescent protein (RFP) was constructed downstream of the -1 Frameshift region.

[0056] The specific method is as follows: The Ub-GFP and RFP gene sequences were amplified by PCR, and homologous arms were added upstream and downstream of the sequences, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel-recovered products of Ub-GFP and RFP and the linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel-recovered products of Ub-GFP and RFP and the gel-recovered product of linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombinase was added. The mixture was reacted at 37°C for 15 minutes.

[0057] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).

[0058] 1.2. Establishing a fluorescent protein reporter gene screening cell system

[0059] (1) The viral backbone vector containing dual fluorescent protein and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector were mixed with PEI in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.

[0060] (2) Collect the culture supernatant of 293T cells 48h and 72h after transfection with viral plasmid, centrifuge at 12000g for 10min to remove cell impurities, and then collect lentivirus particles by cesium chloride gradient centrifugation.

[0061] (3) Lentiviral particles were added to PK15 cells. After 7 days of infection, positive cells were screened by Puro. Single-cell suspensions were prepared by trypsin digestion of the cells and single-clone sorting was performed by flow cytometry.

[0062] (4) Genotyping of cultured monoclonal cells and expansion culture of positive clones to obtain PK15 cells (CMV-Ub-GFP-framshift-RFP) containing -1Ribosomal Frameshift region.

[0063] 1.3. Drug screening based on fluorescent protein reporter genes

[0064] (1) Five PK15 fluorescent reporter gene cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After the cells were plated for 24 hours, different test compounds (control group: DMSO; experimental group: ailanthus ketone) were added to the plates. The drug concentration was 10 μM for all of them, and autofluorescent compounds were excluded.

[0065] (2) After culturing for 8 hours, MG132 was added, and after culturing for 4 hours, the changes in fluorescence signal were observed under a high-content fluorescence microscope.

[0066] (3) The ratio of RFP to GFP is used as a reference for the efficiency of -1 Ribosomal Frameshift. The larger the ratio, the higher the efficiency of -1 Ribosomal Frameshift; the lower the ratio, the lower the efficiency of -1 Ribosomal Frameshift. In other words, the lower the ratio, the higher the efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and the better it can inhibit the -1 Ribosomal Frameshift process.

[0067] 2. Experimental Results

[0068] Experimental results are as follows Figure 2 As shown, Figure 2 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by ailanthus ketone in a fluorescent protein reporter system. Specifically, Figure 2 In the middle 'a', a fluorescent protein reporter system design scheme is used. When ribosome frameshift occurs, both the reporter genes GFP and RFP are expressed. When ribosome frameshift is blocked, the reporter gene GFP is expressed, but RFP is not expressed. Figure 2 In section b, the workflow of the fluorescent protein reporter system is as follows: First, the reporter vector is stably integrated into the host cell (PK15 cell) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: ailanthus ketone). Fluorescence images are acquired using a high-content fluorescence microscope, and the inhibitory effect of the compounds on the PEDV ribosome frameshift process is determined by fluorescence signal analysis. Figure 2 In the figure, c represents the experimental results of the fluorescent protein reporter system. (From...) Figure 2 As shown in Figure c, 10 μM ailanthoides significantly inhibited the -1 ribosome frameshifting process of PEDV (G1a, G1b, G2a, G2b, and G2c strains) (* indicates P < 0.05).

[0069] Example 3

[0070] Evaluation of the in vitro antiviral activity and cytotoxicity of ailanthus ketone

[0071] 1. Experimental Methods

[0072] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and ailanthus ketone was added at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM. Lesions were observed after 48 hours. Viral replication levels were detected using quantitative real-time PCR. The relationship between drug concentration and viral inhibition rate was calculated, and the viral inhibition rate (EC50) was determined by fitting a curve. 50 Cells were treated with ailanthus ketone at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM individually. Cell viability was determined by the CCK8 assay, and the cytotoxicity rate (CC) was calculated using a fitted curve. 50 The calculation of the selection index SI is CC. 50 / EC 50 .

[0073] 2. Experimental Results

[0074] Experimental results are as follows Figure 3 As shown, the toxicity marker CC of ailanthus in Vero cells 50 The concentration was 9.05 μM, which is the half-maximal cytotoxic concentration (CMC) of ethosone to Vero cells. 50 The concentration was 9.05 μM; ailanthophyll inhibited the -1 Ribosomal Frameshifting process of PEDV, with a half-maximal effective concentration (EC50) of 9.05 μM. 50 The concentration was 0.22 μM; the selectivity index (SI) was 41.14. An SI value greater than 5.00 indicates that the drug is effective and has high safety, and the larger the value, the wider the safety range of the drug.

[0075] Example 4

[0076] To evaluate the antiviral effect of ailanthus ketone in cultured cells in vitro.

[0077] 1. Experimental Methods

[0078] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (DMSO or ethiophene) was added at a concentration of 1 μM. After 48 hours, images were taken under a bright-field microscope.

[0079] 2. Experimental Results

[0080] Experimental results are as follows Figure 4As shown, Vero cells uninfected with PEDV (i.e., PEDV-) exhibited good growth and showed no cytopathic effect (CPE) induced by the virus. After PEDV infection, the solvent-treated group (DMSO) showed extensive CPE and extremely poor cell condition, while the ailanthus ketone-treated group showed significantly reduced CPE, with cell condition closer to that of the uninfected group. This indicates that ailanthus ketone has a significant inhibitory effect on PEDV G2c-induced CPE in Vero cells.

[0081] Example 5

[0082] To evaluate the antiviral effects of ailanthus ketone against different PEDV strains (G1a, G1b, G2a, G2b, and G2c).

[0083] 1. Experimental Methods

[0084] Experiments were conducted under P2 laboratory conditions. PEDV virus (G1a, G1b, G2a, G2b, and G2c strains) were cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium and 1 μM ailanthus was added. Viral replication levels were detected by quantitative real-time PCR after 48 hours.

[0085] The qPCR primers are as follows:

[0086] PEDV MF GGTTGCTACTGGCGTACAGGTA,

[0087] PEDV MR GAAGCATTGACTGAACGACCAACA;

[0088] GAPDH-F GAAGGTGAAGGTCGGAGTCA,

[0089] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.

[0090] 2. Experimental Results

[0091] Experimental results are as follows Figure 5 As shown. Figure 5 The antiviral results of ailanthus ketone against PEDV strains G1a, G1b, G2a, G2b, and G2c were determined by RT-PCR. Figure 5 It is evident that ailanthus ketone exhibits highly significant antiviral effects against PEDV strains G1a, G1b, G2a, G2b, and G2c (*** indicates P < 0.001), suggesting that ailanthus ketone has a broad-spectrum antiviral effect against PEDV.

[0092] Example 6

[0093] To evaluate the antiviral effect of ailanthone against PEDV in live pigs.

[0094] 1. Experimental Methods

[0095] Alpinia odorata (the drug) was dissolved in DMSO. Ten 21-day-old PEDV antibody-negative weaned piglets were selected and divided into an experimental group (challenge + drug treatment), a positive control group (challenge + DMSO), and a negative control group (no challenge). After 7 days of pre-feeding, the piglets were orally inoculated with 10.0 TCID50 (median infectious dose of tissue culture) of PEDV-G2c strain. The administration method was intramuscular injection at a dose of 10 mg / kg body weight, once a day. Diarrhea score, body temperature, and feed intake were recorded. Seven days after challenge, jejunal tissue was collected to detect viral load. Biosafety measures (glutaraldehyde disinfection, protective clothing operation) were performed throughout the experiment.

[0096] 2. Experimental Results

[0097] Experimental results are as follows Figure 6 As shown, Figure 6 The viral load in the jejunal tissue of the experimental group and the positive control group was determined by... Figure 6 It is evident that ailanthus ketone has a highly significant antiviral effect against PEDV (*** indicates P < 0.001).

Claims

1. Application of ailanthus ketone in the preparation of drugs against porcine epidemic diarrhea virus.

2. The use of ailanthus ketone according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is a drug for the prevention and / or treatment of porcine epidemic diarrhea caused by porcine epidemic diarrhea virus infection.

3. The use of ailanthus ketone according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the replication of porcine epidemic diarrhea virus.

4. The use of ailanthus ketone according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the proliferation of porcine epidemic diarrhea virus.

5. The use of ailanthus ketone according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The porcine epidemic diarrhea virus includes one or more genotypes of the strains G1a, G1b, G2a, G2b, and G2c.

6. The use of ailanthus ketone according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug comprises ethiocarbamate and pharmaceutically acceptable excipients.

7. The use of ailanthus ketone according to any one of claims 1 to 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The ailanthus ketone inhibits the replication and proliferation of porcine epidemic diarrhea virus (PEDV) or prevents PED by inhibiting the -1 ribosome frameshift process of PEDV.

8. The use of ailanthus ketone according to any one of claims 1, 2, or 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The drug is an oral preparation or an injection.