SiRNA duplex targeting and regulating lpa gene expression and its use in preventing and treating cardiovascular and cerebrovascular diseases

Abstract

The present disclosure provides siRNA duplexes targeting the regulation of LPA gene expression and their use in the prevention and treatment of cardiovascular and cerebrovascular diseases. The present disclosure also relates to corresponding conjugates and pharmaceutical compositions. Cell and animal experiment results show that the oligonucleotide duplexes of the present disclosure can significantly inhibit the expression of LPA genes and can be used to prepare drugs for preventing or treating atherosclerosis and other related diseases.

Description

TECHNICAL FIELD

[0001] The present disclosure belongs to the field of biological medicine, and particularly relates to siRNA duplexes targeting and regulating LPA gene expression and use thereof in preventing and treating cardiovascular and cerebrovascular diseases. BACKGROUND

[0002] Nucleic acid drugs, especially oligonucleotide drugs, are widely used due to their simple synthesis and high activity. Oligonucleotide drugs generally include antisense oligonucleotides (ASO), small interfering RNA (siRNA), microRNA (miRNA) and nucleic acid aptamer, etc.

[0003] Oligonucleotide is a kind of short DNA or RNA molecule, oligomer. Oligonucleotide can bind to the respective complementary oligonucleotide, DNA or RNA in a sequence-specific manner to form a duplex, or in some cases, a higher-order hybrid. Oligonucleotide can bind to complementary RNA strands in a sequence-specific manner, and after hybridization, it can induce RNase H to cleave the target RNA. In natural oligonucleotide, nucleotides are connected by phosphodiester bonds. Under physiological conditions, oligonucleotides are particularly sensitive to nucleases, so when preparing oligonucleotide drugs, natural, unmodified or unmodified oligonucleotides are easily degraded in vivo, so their activity is very limited, and thus their drug properties are poor. Modification of oligonucleotides is an effective way to improve their activity, which can improve their stability to nucleases, affinity to RNA, and better promote endocytosis and tissue targeting, thereby effectively regulating the expression of target genes.

[0004] The basic structure of nucleotide can generally be divided into four parts: base, ribose, phosphate backbone and terminal. Modifications of the four parts can be exemplified as follows:

[0005] 1) Modification of base: mainly divided into three forms of purine modification, pyrimidine modification and base replacement. Purine modification includes N6-methyladenosine, N1-methyladenosine, 7-methylguanosine modification; pyrimidine modification includes 3-methyluracil nucleoside, 5-methyluracil nucleoside, 5-methylcytosine nucleoside, N4-acetylcytosine, pseudouridine, thio-uracil nucleoside, propyne uracil nucleoside and dihydrouracil nucleoside, etc.

[0006] 2) Modification of ribose: mainly divided into modification and replacement of groups at specific positions of ribose ring, etc. Modification of ribose includes but is not limited to 2'-position modification, 4'-position modification, 5'-position modification, isomerization modification, etc. The most common modification of ribose 2'-position is 2'-OMe (2'-methoxy) modification and 2'-F (2'-fluorine) modification. Compared with natural oligonucleotide, oligonucleotide with 2'-OMe and 2'-F modification has higher Tm value, stronger serum stability and better activity.

[0007] 3) Modification of the phosphate backbone: The main modification methods include but are not limited to modification of phosphorothioate; modification of methylphosphonate, selenophosphate, boronophosphate, dithiophosphate, and replacement of the bridging oxygen atom of the phosphodiester bond connection region with a sulfur atom; replacement of the phosphate group between nucleotides with a group containing no phosphorus atom, such as replacement of P atom with C atom, S atom, and N atom, etc., thereby forming guanidyl, S-methyl thiourea, or nitrate, etc.

[0008] 4) Terminal modification: including but not limited to covalently linking specific groups at the 5' end and / or 3' end of the sense strand, 5' end phosphorylation modification of the antisense strand, etc.

[0009] Lipoprotein(a) (Lp(a)) is a special type of lipoprotein particle discovered by immunological methods, which plays a role in the development of cardiovascular diseases and is an important risk factor for cardiovascular diseases. Lp(a) is composed of LDL-like particles containing lipid components such as cholesterol, oxidized phospholipids (OxPL), and apolipoprotein A (Apo(a)) and carrier protein B-100, among which apolipoprotein B-100 is covalently bound to Apo(a). Apo(a) is a highly polymorphic glycoprotein encoded by the LPA gene.

[0010] It is currently believed that Lp(a) promotes the formation of atherosclerotic plaques in multiple ways. Epidemiological and genetic studies have shown that elevated Lp(a) levels are an independent risk factor for cardiovascular disease, and even if LDL-C levels are controlled within the best range specified by current guidelines, cardiovascular risk associated with Lp(a) still exists. Therefore, inhibiting the expression level of LPA gene can reduce the risk of atherosclerosis and its related cardiovascular events. Alternative and combination therapies that can be used for patients with lipoprotein(a)-related diseases are clinically needed. SUMMARY

[0011] In order to solve the technical problem of the lack of a more effective siRNA duplex for targeted regulation of LPA gene expression in the prior art, the present disclosure provides an siRNA duplex for targeted regulation of LPA gene expression and its use in the prevention and treatment of cardiovascular and cerebrovascular related diseases. The present disclosure screens a plurality of siRNA modifiers with significant inhibitory effect on LPA gene expression by modifying the basic sequence of siRNA, and provides corresponding siRNA conjugates.

[0012] The technical solutions of the present disclosure include but are not limited to:

[0013] In one aspect, the present disclosure provides an siRNA duplex comprising an oligonucleotide duplex consisting of a sense strand and an antisense strand.

[0014] In another aspect, the present disclosure provides a conjugate for reducing expression of LPA, comprising the above-mentioned siRNA duplex, and a conjugation group linked thereto.

[0015] In another aspect, the present disclosure provides a nucleic acid-protein complex comprising a duplex region of the above-mentioned siRNA duplex or an antisense strand of the duplex region, and a nuclease.

[0016] In another aspect, the present disclosure provides a recombinant vector comprising a nucleic acid molecule encoding the above-mentioned siRNA duplex.

[0017] In some embodiments, the vector backbone of the recombinant vector is selected from the group consisting of a recombinant virus-derived circular RNA vector, a tRNA, a rRNA scaffold, and a chimeric tRNA / pre-miRNA vector.

[0018] In another aspect, the present disclosure provides a recombinant cell synthesizing and secreting the above-mentioned siRNA duplex.

[0019] In some embodiments, the recombinant cell is selected from the group consisting of a Sulfurospirillum and a ribonuclease III-deficient Corynebacterium glutamicum.

[0020] In another aspect, the present disclosure provides a method of preparing the siRNA duplex, comprising culturing the above-mentioned recombinant cell, or chemical synthesis.

[0021] In another aspect, the present disclosure provides a pharmaceutical composition comprising the above-mentioned siRNA duplex, the above-mentioned conjugate, or the above-mentioned nucleic acid-protein complex, and a pharmaceutically acceptable carrier.

[0022] In another aspect, the present disclosure provides a method of inhibiting expression of LPA gene, comprising contacting the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid-protein complex, or the above-mentioned pharmaceutical composition with a target cell.

[0023] In some embodiments, the method is for non-diagnostic or non-therapeutic purposes.

[0024] In some embodiments, the method is in vivo or in vitro.

[0025] In another aspect, the present disclosure provides use of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid-protein complex, or the above-mentioned pharmaceutical composition in the manufacture of a medicament for treating a disease associated with expression of LPA gene.

[0026] The LPA gene expression related disease is selected from the group consisting of Apo(a) protein overexpression, LPA gene pathogenic mutation, Apo(a) protein metabolism abnormality, and a disease caused by abnormal interaction of LPA or Apo(a) with another substance.

[0027] In some embodiments, the LPA gene expression related disease is selected from the group consisting of Berger’s disease, peripheral arterial disease, coronary arterial disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis, stroke, atherosclerosis, thrombosis, coronary heart disease, or aortic valve stenosis, and / or any other disease associated with elevated levels of Lp(a) particles, and other yet unidentified related conditions, pathologies or syndromes.

[0028] In another aspect, the present disclosure provides a use of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein complex, or the above-mentioned pharmaceutical composition for treating a disease related to LPA gene expression.

[0029] In another aspect, the present disclosure provides a method for treating a disease related to LPA gene expression, comprising administering to a subject in need thereof an effective amount of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein complex, or the above-mentioned pharmaceutical composition.

[0030] In another aspect, the present disclosure provides a use of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein complex, or the above-mentioned pharmaceutical composition in the manufacture of a medicament for preventing or treating atherosclerosis and cardiovascular and cerebrovascular diseases.

[0031] In another aspect, the present disclosure provides a use of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein complex, or the above-mentioned pharmaceutical composition for preventing or treating atherosclerosis and cardiovascular and cerebrovascular diseases.

[0032] In another aspect, the present disclosure provides a method for preventing or treating atherosclerosis and cardiovascular and cerebrovascular diseases, comprising administering to a subject in need thereof an effective amount of the above-mentioned siRNA duplex, the above-mentioned conjugate, the above-mentioned nucleic acid protein complex, or the above-mentioned pharmaceutical composition.

[0033] The beneficial effects achieved by the present disclosure are at least as follows:

[0034] (1) The siRNA base sequence, for example, siRNA B01001, B01023, B01042, B01047, B02417, B06001, B01801, B01012, has a significant inhibitory effect on LPA gene, and the inhibition rate can be more than 50%.

[0035] (2) The siRNA modifier of the present disclosure can inhibit LPA gene by more than 70%. After the modifier is connected with the GalNAc conjugate group to form the corresponding siRNA conjugate, it can be efficiently delivered to the liver of an animal, significantly inhibit LPA gene, and significantly reduce the serum Lp(a) protein level.

[0036] (3) The siRNA of the present disclosure has a small difference from the sequence disclosed in the prior art, and the LPA inhibitory activity is significantly improved by 36.0% at most. BRIEF DESCRIPTION OF DRAWINGS

[0037] In order to more clearly illustrate the technical solutions of the embodiments of the present disclosure, the drawings of the embodiments will be briefly introduced below. Obviously, the drawings described below are only used to exemplarily illustrate some examples of the present disclosure, but not limit the present disclosure.

[0038] Figure 1 The siRNA B01023, B02417, B01801 respectively adopts the template modification and the off-target prevention modification and is connected with the GalNAc conjugate group, and the inhibition effect on the expression level of Lp(a) protein in the serum of cynomolgus monkey ((relative to D-3 before administration)-1 mg / kg).

[0039] Figure 2 The siRNA B01023, B02417, B01801 respectively adopts the template modification and the off-target prevention modification and is connected with the GalNAc conjugate group, and the inhibition effect on the expression level of LPA gene mRNA in the liver tissue of cynomolgus monkey ((relative to D-9 before administration)-1 mg / kg). DETAILED DESCRIPTION

[0040] In order to make the present disclosure easier to understand, first define some terms. In addition, it should be noted that whenever a value or a range of values of a parameter is listed, the purpose is to indicate that the intermediate values of the cited values and the range are also intended to be part of the present disclosure.

[0041] The articles "a" and "an" as used herein mean one or more than one (i.e., at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., multiple elements.

[0042] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0043] The term "or" as used herein is used to refer to the term "and / or" unless otherwise indicated by context.

[0044] As used herein, the term "about" or "approximately," as applied to one or more values of interest, refers to a value that is similar, or close, to that value. In certain embodiments, unless otherwise stated, or otherwise apparent from context, the term "approximately" or "about" means falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) of the stated reference value unless such number would exceed 100% of the possible values.

[0045] "LPA", as used herein, refers to the gene encoding apolipoprotein A or the protein expressed by the gene.

[0046] The term "LPA gene" can be a wild-type LPA gene, or a mutant of the LPA gene in which sequence variations exist. Many sequence variations in the LPA gene have been identified and can be found, for example, in the NCBI dbSNP and UniProt (see, e.g., ncbi.nlm.nih.gov / snp).

[0047] “G,”“C,”“A,” and“U” each generally represent a nucleotide comprising, respectively, guanine, cytosine, adenine, and uracil as the base. “T” and“dT” are used interchangeably herein and refer to a deoxyribonucleotide in which the nucleobase is thymine, such as deoxyribothymine, 2’-deoxythymidine, or thymidine. However, it should be understood that the term“ribonucleotide” or“nucleotide” or“deoxyribonucleotide” can also refer to a modified nucleotide (as further detailed below) or an alternative substituent. The skilled artisan will be well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide, including a nucleotide having such a substituent. For example, without limitation, a nucleotide comprising inosine as its base can pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide comprising uracil, guanine, or adenine can be replaced in a nucleotide sequence of the disclosure by a nucleotide comprising, for example, inosine. Sequences comprising such substituents are suitable for use in, including but not limited to, double-stranded ribonucleic acids, double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates, pharmaceutical compositions, and methods of the disclosure, among others.

[0048] The terms“complementary,”“fully complementary,” and“substantially complementary” can be used herein to refer to base pairing between the sense strand and the antisense strand of an siRNA, or between the antisense strand of an siRNA and a target sequence, as will be understood from the context of their use. In some aspects herein, a first nucleotide sequence can be considered complementary to a second nucleotide sequence if the first nucleotide sequence exhibits at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% degree of sequence complementarity with the second nucleotide sequence. In an exemplary embodiment, 18 of 20 nucleobases of the first nucleotide sequence pair with the corresponding region of the second nucleotide sequence, achieving 90% complementarity.

[0049] The terms“double-stranded ribonucleic acid,”“double-stranded RNA (dsRNA) molecule,”“dsRNA,”“ribonucleic acid duplex” are used interchangeably and refer specifically to a complex of ribonucleic acid molecules having a double-stranded structure comprising two antiparallel, complementary or substantially complementary nucleic acid strands having“sense” and“antisense” orientation with respect to a target gene, e.g., an LPA gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi. In some instances herein,“siRNA duplex” also typically refers to the technical meaning indicated by the above definition.

[0050] As is well known in the art, the term "siRNA duplex," "double-stranded RNAi agent," "RNAi agent," "small interfering ribonucleic acid," or "siRNA" refers to a small interfering ribonucleic acid RNAi molecule. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silencing RNA. An siRNA typically comprises a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand), each strand being from 17 to 30 nucleotides in length, typically from 19 to 25 nucleotides in length, wherein the antisense strand is complementary (such as at least 95% complementary, such as fully complementary) to a target nucleic acid (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand, such that the sense and antisense strands form a duplex or duplex region. The sense and antisense strands of an siRNA can form a blunt end duplex, or can form a duplex comprising a 3' overhang, which can be, for example, 1, 2, or 3 nucleotides in length, similar to the product of Dicer, which can form a RISC substrate in vivo. Efficient extended versions of the Dicer substrate have been described in US 8349809 and US 8513207, incorporated herein by reference. In some embodiments, both the sense and antisense strands have a 3' overhang of 2 nucleotides in length. Thus, the duplex region can be, for example, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, such as 19, 20, 21, 22, or 23 nucleotides in length.

[0051] Also, herein, "siRNA" in some cases also refers to "base sequence". Herein, "base sequence" in some cases specifically refers to an siRNA duplex in which each nucleotide in the double-stranded ribonucleic acid is an unmodified nucleotide, also appearing throughout the text as "motif", "siRNA motif", and the like. Thus, herein, "siRNA", "base sequence", "motif", "siRNA motif" can be used interchangeably, and their meaning also includes the respective nucleotide arrangement order of the siRNA duplex referred to. Herein, the skilled person is able to clearly understand from the technical meaning of the context the exact technical meaning they refer to. In addition, the 5' terminal nucleotide of the antisense strand of the motif can or can not be linked to a 5' phosphate group or a 5' phosphate derivative group.

[0052] In the present context, "siRNA modifier" refers to a double-stranded ribonucleic acid comprising at least one modified nucleotide, in some cases also appearing as "double-stranded ribonucleic acid modifier". In the present context, different modifications of the siRNA motif are made to produce the corresponding siRNA modifier. For example, in some embodiments, the motif is modified with an alternating modification pattern to produce an alternatingly modified siRNA modifier. In other embodiments, the motif is modified with a specific modification pattern to produce a specific modification pattern modified siRNA modifier. In yet other embodiments, the motif is modified with an off-target protection modification pattern in the present context to produce an off-target protection modified siRNA modifier. In some cases, a plurality of different modification patterns can be used to modify the same siRNA motif to produce the corresponding siRNA modifier with a plurality of modification patterns.

[0053] In the present context, "siRNA conjugate" refers to a double-stranded ribonucleic acid conjugate or a conjugate of a double-stranded ribonucleic acid modifier resulting from linking a conjugate group to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modifier. Preferably, "siRNA conjugate" refers to a conjugate of a double-stranded ribonucleic acid modifier.

[0054] In some cases in the present context, "siRNA" refers not only to the unmodified siRNA duplex (or siRNA motif) described above, but also to the corresponding siRNA modifier and / or siRNA conjugate, e.g. in contexts relating to therapeutic methods, therapeutic agents, etc. including but not limited to, siRNA generically refers to at least one of a siRNA motif, a siRNA modifier and / or a siRNA conjugate. The specific technical meaning will be clear to the skilled person in the light of the context.

[0055] The term "antisense strand" refers to the strand of a double-stranded ribonucleic acid (e.g. an RNA duplex in the present context) comprising a region that is substantially complementary to a sequence defined herein (e.g. a target sequence). The term "region of complementarity" as used herein refers to a region on the antisense strand that is substantially complementary to a sequence defined herein (e.g. a target sequence). When the region of complementarity is not perfectly complementary to the target sequence, mismatches can be in the internal region of the molecule or at the terminal region. Generally, the most tolerated mismatches are at the terminal region, e.g. within 5, 4, 3, 2 or 1 nucleotides of the 5' and / or 3' terminus.

[0056] The term "sense strand" as used herein refers to the strand of a double-stranded ribonucleic acid comprising a region that is substantially complementary to a region of the antisense strand as the term is defined herein.

[0057] The term "alternating modification" refers to the use of 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) modifications on the nucleotides in the order of the nucleotide sequence of the double-stranded ribonucleic acid. For example, for the antisense strand of an siRNA, the odd-numbered positions (i.e., positions 1, 3, 5, 7, 11, 13, 15, 17, 19, 21, 23) are modified with 2'-methoxy and the even-numbered positions (i.e., positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22) are modified with 2'-fluoro. For the sense strand complementary to the antisense strand, the corresponding positions to the 2'-methoxy modifications of the antisense strand are modified with 2'-fluoro and the positions on the sense strand that are complementary to the 2'-fluoro modifications on the antisense strand are modified with 2'-methoxy.

[0058] For RNA interference (RNAi), the inhibition of a target gene is achieved by the AGO2 protein loading the antisense strand of an siRNA and forming a silencing complex (RISC) that cleaves the mRNA transcript of the gene. The loading of the silencing complex (RISC) requires the 5' end of the antisense strand to be phosphorylated (5'-phosphate). The 5' end phosphorylation can occur naturally in the cell by the cleavage and polyadenylation factor I subunit 1 (Clp1) or it can be achieved by chemical synthesis. The term "natural 5' end phosphorylation" or "simple direct 5' end phosphorylation" refers to the 5' end phosphorylation of the antisense strand of an siRNA being completed in the cellular environment and not by chemical synthesis.

[0059] In the present context, a "conjugate group" is a GalNAc derivative attached to an oligonucleotide. In some cases, a conjugate group comprises a targeting group (also referred to as a ligand), optionally further comprising a linker, e.g. a GalNAc derivative linked to an oligonucleotide via a linker (e.g. a divalent, trivalent or tetravalent branched linking arm), and further e.g. a GalNAc derivative attached to an oligonucleotide via a monovalent linking arm. In most cases, "ligand" and "conjugate group" have the meaning well known in the art.

[0060] The term "inhibit", as used herein, can be used interchangeably with "reduce", "silence", "down-regulate", "suppress" and other similar terms, and includes inhibition at any level. In the present context, "inhibit" is in some cases used to refer to the meaning of "reduce", and the skilled person will be aware of the specific meaning referred to depending on the context.

[0061] As used herein, the phrase "inhibiting expression of LPA" includes inhibiting expression of any LPA gene (such as, for example, a mouse LPA gene, a rat LPA gene, a monkey LPA gene, or a human LPA gene) as well as variants (e.g., naturally occurring variants) or mutants of LPA genes. Thus, the LPA gene can be a wild-type LPA gene, a mutant LPA gene, or a transgenic LPA gene in the context of a genetically manipulated cell, cell population, or organism.

[0062] "Inhibiting expression of an LPA gene" includes inhibition of an LPA gene at any level, such as at least partial inhibition of expression of an LPA gene, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0063] Expression of an LPA gene can be assessed based on any variable level associated with LPA gene expression, such as LPA mRNA levels or LPA protein levels. The inhibition can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level utilized in the art, such as a pre-dose baseline level or a level determined from a similar untreated or control (e.g., buffer control or inert agent control) treated subject, cell, or sample.

[0064] In some instances herein, the meaning of "modulating" can be the same as "inhibiting"; accordingly, "modulating expression of an LPA gene" can mean "inhibiting expression of an LPA gene". The specific technical meaning will be clear to one of skill in the art in context.

[0065] As used herein, "patient" or "subject" is intended to include a human or non-human animal, preferably a mammal, such as a monkey. More preferably, the subject or patient is a human.

[0066] As used herein, "LPA-associated disease" is intended to include any disease associated with the LPA gene or protein. Such a disease can be caused, for example, by overproduction of LPA protein, by mutation of the LPA gene, by abnormal cleavage of LPA protein, by abnormal interactions between LPA and other proteins or other endogenous or exogenous substances. Exemplary LPA-associated diseases include Buerger's disease, peripheral arterial disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis, stroke, atherosclerosis, thrombosis, coronary heart disease, or aortic valve stenosis and / or any other disease associated with elevated levels of Lp(a) particles as well as other yet unidentified related conditions, pathologies or syndromes.

[0067] As used herein, "therapeutically effective amount" is intended to include the amount of an RNAi agent that, when administered to a patient for treating an LPA-associated disease, is sufficient to effect treatment as measured by attenuation, amelioration, or remission of the existing disease or one or more symptoms of the disease. The "therapeutically effective amount" can vary depending on the RNAi agent, how the agent is administered, the disease and its severity, and the history, age, weight, family history, genetic makeup, stage of the pathological process mediated by LPA expression, type of previous or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0068] As used herein, "prophylactically effective amount" refers to an amount of an RNAi agent that, when administered to a subject who does not yet exhibit or display symptoms of an LPA-associated disease, but who is at risk of developing the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the progression of the disease or reducing the severity of the disease that develops later. The "prophylactically effective amount" can vary depending on the RNAi agent, how the agent is administered, the degree of risk of the disease, and the history, age, weight, family history, genetic makeup, type of previous or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0069] A "therapeutically effective amount" or "prophylactically effective amount" also includes the amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agents used in the methods of the disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0070] As used herein, the term "sample" includes a similar fluid, cell, or tissue isolated from a subject, as well as a collection of fluids, cells, or tissues present in a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluid, lymphatic fluid, urine, saliva, and the like. A tissue sample can include a sample from a tissue, organ, or a localized region. For example, a sample can be derived from a particular organ, organ portion, or fluid or cells within these organs. In certain embodiments, a sample can be derived from a liver (e.g., the entire liver or certain segments of the liver, or certain types of cells in the liver, e.g., hepatocytes). In preferred embodiments, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In other embodiments, a "sample derived from a subject" refers to liver tissue (or a sub- constituent thereof) derived from the subject.

[0071] In this document, any reference to any nucleotide position of any strand of an siRNA motif, siRNA modifier, siRNA conjugate, siRNA duplex, etc. is intended to mean the 5' to 3' direction, unless otherwise specified.

[0072] In one aspect, the disclosure provides an siRNA duplex comprising a sense strand and an antisense strand forming a reverse complementary double-stranded region, the antisense strand comprising at least 15, 16, 17, 18, or 19 contiguous nucleotides fragments or modified fragments thereof of a nucleotide sequence as set forth in SEQ ID NO: 184, as set forth in SEQ ID NO: 76, as set forth in SEQ ID NO: 132, as set forth in SEQ ID NO: 419 (AUGGUAAUGGACAGAGUU), or as set forth in SEQ ID NO: 420 (GACAGAGUUAUCAAGGCA) complementary to a target sequence.

[0073] The target sequence is derived from Homo sapiens lipoprotein(a) (LPA), mRNA with accession number NM_005577.4 in the NCBI database.

[0074] In some embodiments, the antisense strand comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides fragments or modified fragments thereof of a sequence as set forth in any one of SEQ ID NOs: 194, 214, 232, 237, 269, 325, 377, and 379.

[0075] In some embodiments, the reverse complementary double-stranded region has a length of 17 to 21 bp, e.g., 20 or 21 bp.

[0076] In some embodiments, the sense strand comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1, 21, 39, 44, 76, 132, 184, and 186, or a modified fragment thereof.

[0077] In some embodiments, the sense strand and the antisense strand each independently comprise 19-23 nucleotides in length; preferably, the sense strand comprises 19-21 nucleotides, and the antisense strand comprises 21-23 nucleotides.

[0078] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes of sense and antisense strands, optionally each independently comprising at least one modified nucleotide:

[0079] (1) the sense strand has a sequence as set forth in SEQ ID NO: 21, or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 214, or a fragment thereof, or a modified sequence of the sequence or fragment thereof;

[0080] (2) the sense strand has a sequence as set forth in SEQ ID NO: 1, or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 194, or a fragment thereof, or a modified sequence of the sequence or fragment thereof;

[0081] (3) the sense strand has a sequence as set forth in SEQ ID NO: 39, or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 232, or a fragment thereof, or a modified sequence of the sequence or fragment thereof;

[0082] (4) the sense strand has a sequence as set forth in SEQ ID NO: 44, or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 237, or a fragment thereof, or a modified sequence of the sequence or fragment thereof;

[0083] (5) the sense strand has a sequence as set forth in SEQ ID NO: 76, or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the antisense strand has a sequence as set forth in SEQ ID NO: 269, or a fragment thereof, or a modified sequence of the sequence or fragment thereof;

[0084] (6) the sense strand has the sequence as shown in SEQ ID NO: 132 or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 325 or a fragment thereof, or a modified sequence of the sequence or the fragment thereof;

[0085] (7) the sense strand has the sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of the sequence or the fragment thereof;

[0086] (8) the sense strand has the sequence as shown in SEQ ID NO: 186 or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 379 or a fragment thereof, or a modified sequence of the sequence or the fragment thereof.

[0087] In some embodiments, the siRNA duplex is an RNAi agent for inhibiting LPA gene expression.

[0088] In some embodiments, the sense strand differs from any one of SEQ ID NOs: 1, 21, 39, 44, 76, 132, 184, and 186 by 1-3 nucleotides.

[0089] In some embodiments, the antisense strand differs from any one of SEQ ID NOs: 194, 214, 232, 237, 269, 325, 377, and 379 by 1-3 nucleotides.

[0090] In some embodiments, the sense strand has the same number of nucleotides as the antisense strand or a different number of nucleotides than the antisense strand.

[0091] In some embodiments, the sense strand has 19 nucleotides and the antisense strand has 19 nucleotides.

[0092] In some embodiments, the sense strand has 19 nucleotides and the antisense strand has 21 nucleotides.

[0093] In some embodiments, the sense strand has 20 nucleotides and the antisense strand has 20 nucleotides.

[0094] In some embodiments, the sense strand has 20 nucleotides and the antisense strand has 22 nucleotides.

[0095] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 21 nucleotides.

[0096] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 23 nucleotides.

[0097] In some embodiments, the sense strand has 23 nucleotides and the antisense strand has 23 nucleotides.

[0098] In some embodiments, the sense strand and the antisense strand each independently comprise at least one modified nucleotide.

[0099] In some embodiments, the at least one modified nucleotide is selected from any one or a combination of at least two of the group consisting of: a deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, a non-locked nucleotide, a conformationally restricted nucleotide, a restricted ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide comprising a non-natural base, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, and a nucleotide comprising a 5'-phosphate mimic.

[0100] In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide.

[0101] In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0102] In some embodiments, the modification of all nucleotides on the sense strand and the antisense strand is a modification of the 2' position of the ribose of the nucleotide.

[0103] In some embodiments, the modification of the 2' position of the ribose of the nucleotide is selected from any one or a combination of several of a 2'-methoxy modification, a 2'-methoxyethyl modification, a 2'-fluoro modification, a 2'-benzyloxy modification, a 2'-methylcarbonylamino modification, and a 2'-pyridyloxy modification.

[0104] In some embodiments, the modification of the 2' position of the ribose of each nucleotide is selected from a combination of a 2'-methoxy modification and a 2'-fluoro modification.

[0105] In some embodiments, the modification of the 2' position of the ribose of each nucleotide is selected from an alternating combination of a 2'-methoxy modification and a 2'-fluoro modification.

[0106] In some embodiments, the modification pattern of the 2' position of each ribose sugar is: 2'-fluoro modification for all odd positions, and 2'-methoxy modification for all even positions in the sense strand; and 2'-methoxy modification for all odd positions, and 2'-fluoro modification for all even positions in the antisense strand.

[0107] In some embodiments, the nucleotides are connected to each other by 3',5'-phosphodiester bonds.

[0108] In some embodiments, the nucleotides are connected to each other by 3',5'-phosphorothioate diester bonds.

[0109] In some embodiments, the foregoing oligonucleotide has alternating fluorine-oxygen modification or template modification.

[0110] In some embodiments, the antisense strand of the siRNA modification has any one of the following modification patterns A~F:

[0111]

[0112]

[0113] and / or, the sense strand has any one of the following modification patterns a or b:

[0114]

[0115] wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS represents that the nucleotide at this position is connected to its right adjacent nucleotide by 3',5'-phosphorothioate bond from the 5' end; EVP represents 5'-vinyl-(E)-phosphonate.

[0116] In some embodiments, the antisense strand is modified by modification pattern A, and the sense strand is modified by modification pattern a.

[0117] In some embodiments, the antisense strand is modified by modification pattern B, and the sense strand is modified by modification pattern a.

[0118] In some embodiments, the antisense strand is modified by modification pattern C, and the sense strand is modified by modification pattern a.

[0119] In some embodiments, the antisense strand is modified by modification pattern D, and the sense strand is modified by modification pattern a.

[0120] In some embodiments, the antisense strand is modified by modification pattern E, and the sense strand is modified by modification pattern a.

[0121] In some embodiments, the antisense strand is modified by modification pattern F, and the sense strand is modified by modification pattern a.

[0122] In some embodiments, the antisense strand is modified with modification pattern A and the sense strand is modified with modification pattern b.

[0123] In some embodiments, the antisense strand is modified with modification pattern B and the sense strand is modified with modification pattern b.

[0124] In some embodiments, the antisense strand is modified with modification pattern C and the sense strand is modified with modification pattern b.

[0125] In some embodiments, the antisense strand is modified with modification pattern D and the sense strand is modified with modification pattern b.

[0126] In some embodiments, the antisense strand is modified with modification pattern E and the sense strand is modified with modification pattern b.

[0127] In some embodiments, the antisense strand is modified with modification pattern F and the sense strand is modified with modification pattern b.

[0128] In some embodiments, the antisense strand of the siRNA modification has any one of the following modification patterns A’-F’:

[0129]

[0130] and / or the sense strand is modified with modification pattern a’ or b’:

[0131]

[0132] wherein 2’-OMe represents 2’-methoxy; 2’-F represents 2’-fluoro; PS represents a 3’,5’-phosphorothioate linkage between the nucleotide at this position and its right-hand neighboring nucleotide, starting from the 5’ end; and EVP represents a 5’-vinyl-(E)-phosphonate.

[0133] In some embodiments, the antisense strand is modified with modification pattern A’ and the sense strand is modified with modification pattern a’.

[0134] In some embodiments, the antisense strand is modified with modification pattern B’ and the sense strand is modified with modification pattern a’.

[0135] In some embodiments, the antisense strand is modified with modification pattern C’ and the sense strand is modified with modification pattern a’.

[0136] In some embodiments, the antisense strand is modified with modification pattern D’ and the sense strand is modified with modification pattern a’.

[0137] In some embodiments, the antisense strand is modified with modification pattern E', and the sense strand is modified with modification pattern a'.

[0138] In some embodiments, the antisense strand is modified with modification pattern F', and the sense strand is modified with modification pattern a'.

[0139] In some embodiments, the antisense strand is modified with modification pattern A', and the sense strand is modified with modification pattern b'.

[0140] In some embodiments, the antisense strand is modified with modification pattern B', and the sense strand is modified with modification pattern b'.

[0141] In some embodiments, the antisense strand is modified with modification pattern C', and the sense strand is modified with modification pattern b'.

[0142] In some embodiments, the antisense strand is modified with modification pattern D', and the sense strand is modified with modification pattern b'.

[0143] In some embodiments, the antisense strand is modified with modification pattern E', and the sense strand is modified with modification pattern b'.

[0144] In some embodiments, the antisense strand is modified with modification pattern F', and the sense strand is modified with modification pattern b'.

[0145] In some embodiments, the antisense strand has from 2 to 8 nucleotides from the 5' end that are each independently a modified nucleotide that is a UNA or a GNA, or the antisense strand has from 2 to 8 nucleotides from the 5' end that are each independently DNA, wherein UNA and GNA have the following structures:

[0146] ;

[0147] wherein the base is selected from any one of adenine, guanine, cytosine, thymine, and uracil.

[0148] In some embodiments, the phosphorylation of the 5' position carbon atom of the glycoside of the 5' terminal nucleotide of the modified antisense strand includes, but is not limited to, the following 5' phosphorylated groups: 5'-vinylphosphonate group (5'-E-VP), 5'-methylphosphonate group (5'-MP), 5'-C-methylphosphonate group, 5'-phosphorothioate group (5'-PS), and 5'-phosphate group (5'-P), which modified nucleotide structures are as follows:

[0149] ;

[0150] wherein R is hydrogen, hydroxyl, amine, C 1-4 alkyl, aryl, C1-4 alkoxy, C 1-4 alkylcarbonylamino or halogen;

[0151] The base is selected from any one of adenine, guanine, cytosine, thymine and uracil.

[0152] In some embodiments, the 3' end and / or the 5' end of the sense strand and / or the anti sense strand of the siRNA modification is between the 1st~2ndnucleotides of a 3',5'- phosphorothioate linkage, for example, in some embodiments, a chiral pure 3',5'- phosphorothioate linkage is formed. In some embodiments, the 5' end starting 1st~4thnucleotides of the sense strand and / or the 3' end starting 1st~4thnucleotides of the anti sense strand can comprise 1, 2 or 3 3',5'-phosphorothioate linkages.

[0153] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of a sense strand and an anti sense strand:

[0154] (1) the sense strand has a sequence as set forth in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the anti sense strand has a sequence as set forth in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or fragment thereof; wherein the anti sense strand adopts modification manner B, and the sense strand adopts modification manner a;

[0155] (2) the sense strand has a sequence as set forth in SEQ ID NO: 1 or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the anti sense strand has a sequence as set forth in SEQ ID NO: 194 or a fragment thereof, or a modified sequence of the sequence or fragment thereof; wherein the anti sense strand adopts modification manner A, and the sense strand adopts modification manner a;

[0156] (3) the sense strand has a sequence as set forth in SEQ ID NO: 39 or a fragment thereof, or a modified sequence of the sequence or fragment thereof; and the anti sense strand has a sequence as set forth in SEQ ID NO: 232 or a fragment thereof, or a modified sequence of the sequence or fragment thereof; wherein the anti sense strand adopts modification manner C', and the sense strand adopts modification manner a';

[0157] (4) the sense strand has the sequence set forth in SEQ ID NO: 44, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 237, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode C’ and the sense strand adopts a modification mode b’;

[0158] (5) the sense strand has the sequence set forth in SEQ ID NO: 76, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 269, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode E and the sense strand adopts a modification mode b;

[0159] (6) the sense strand has the sequence set forth in SEQ ID NO: 132, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 325, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode B and the sense strand adopts a modification mode a;

[0160] (7) the sense strand has the sequence set forth in SEQ ID NO: 184, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 377, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode C and the sense strand adopts a modification mode a;

[0161] (8) the sense strand has the sequence set forth in SEQ ID NO: 186, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 379, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode E and the sense strand adopts a modification mode b;

[0162] (9) the sense strand has the sequence set forth in SEQ ID NO: 21, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 214, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode A and the sense strand adopts a modification mode a; the 5thand 7thnucleotides of the antisense strand are replaced by DNA, and the nucleotide at the position which is complementary to the 7thnucleotide of the antisense strand in the sense strand is also replaced by DNA;

[0163] (10) the sense strand has the sequence as shown in SEQ ID NO: 184, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 377, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand is modified with modification type C, the sense strand is modified with modification type a; the 5th, 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide in the sense strand which complements to the 7th nucleotide of the antisense strand is also replaced with DNA;

[0164] (11) the sense strand has the sequence as shown in SEQ ID NO: 76, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 269, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand is modified with modification type E, the sense strand is modified with modification type b; the 5th, 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide in the sense strand which complements to the 7th nucleotide of the antisense strand is also replaced with DNA.

[0165] The present disclosure provides an siRNA conjugate comprising an siRNA duplex as described in the present disclosure and a conjugate group linked to the siRNA duplex.

[0166] The double-stranded ribonucleic acid, double-stranded ribonucleic acid modification of the present disclosure can be optionally linked to one or more conjugate groups. The conjugate group can be attached to the sense strand, the antisense strand, or both strands at the 3’ end, 5’ end, or both ends. For example, the conjugate group can be linked to the sense strand. In preferred embodiments, the conjugate group is linked at the 3’ end of the sense strand. In one embodiment, the conjugate group has any GalNAc structure.

[0167] In some embodiments, the conjugate group is linked at the 3’-end or 5’-end of the nucleotide sense strand.

[0168] In some embodiments, the conjugate group is one or more GalNAc derivatives attached with a bivalent or trivalent branched linker arm.

[0169] Typically, the conjugate group comprises at least one pharmaceutically acceptable targeting group, or further comprises a linker, and the siRNA, the linker and the targeting group are sequentially linked. In some embodiments, the targeting group is 1-6. In some embodiments, the targeting group is 2-4. In some embodiments, the targeting group is 3. The conjugate group can be covalently or non-covalently linked to the siRNA molecule, the linkage site can be at the 3' end or 5' end of the sense strand of siRNA, or at the 5' end of the antisense strand, or in the internal sequence of siRNA. In some embodiments, the linkage site is at the 3' end of the sense strand of siRNA.

[0170] In some embodiments, the pharmaceutically acceptable targeting group can be a ligand conventional in the art of siRNA administration, such as various ligands described in WO2009082607A2, incorporated by reference in its entirety.

[0171] In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a liver cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a mammalian cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a human liver cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a liver surface asialoglycoprotein receptor (ASGPR). The classes of such ligands are well known to those skilled in the art, and their function is generally to bind to a specific receptor on the surface of the target cell, mediating delivery of the siRNA linked to the ligand to the target cell.

[0172] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, tetravalent. That is, after the siRNA molecule forms a siRNA conjugate with a conjugate group containing a galactose or N-acetylgalactosamine molecule as a targeting group, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3 or 1:4. In some embodiments, when the siRNA is linked to a conjugate group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0173] The targeting group can be attached to the siRNA molecule via a suitable linker, which can be selected by one skilled in the art depending on the specific type of targeting group. These linkers, types of targeting groups, and ways of attachment to siRNA can be found in the disclosure of WO2015006740A2, which is incorporated by reference in its entirety.

[0174] In some embodiments, the conjugate group has a structure, for example:

[0175] ,

[0176] wherein X is a hydroxyl protecting group selected from acetyl, benzoyl, or isobutyryl, or H; Y is an amine protecting group selected from formyl, acetyl, propionyl, n-butyryl, or isobutyryl, or H; n is an integer from 0 to 20; q, r, and s are each independently an integer from 1 to 7.

[0177] In some embodiments, the conjugate group has a structure, for example:

[0178] .

[0179] In some embodiments, the conjugate group is, for example:

[0180]

[0181] wherein X is oxygen, -N(Y)-, or sulfur;

[0182] Y is C 1-4 alkyl or C 6-10 aryl;

[0183] R1is oxygen or sulfur;

[0184] R2is hydrogen, -NH2, C 1-4 alkyl, C 6-10 aryl, C 1-4 alkoxy, or halogen;

[0185] A is -(CH2) a -, -(CH2CH2O) b -, -((CH2) c NHCO) d - or -((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0186] B is -(CH2) e -, wherein e is an integer from 0 to 7;

[0187] L is -CONH- or -NHCO-;

[0188] X1is -(CH2) f - or -(CH2CH2O) f CH2-, f is an integer from 1 to 5;

[0189] X2is -(CH2) g -, g is an integer from 1 to 6;

[0190] X3is oxygen or sulfur;

[0191] Y1is 0 or 1;

[0192] Y2is 0, 1, or 2;

[0193] X4is CH2when Y3is 1; CH when Y3is 2; and carbon when Y3is 3;

[0194] m is an integer from 0 to 4;

[0195] n is an integer from 0 to 4.

[0196] In some embodiments, the conjugate group has, for example, any of the following structures:

[0197]

[0198]

[0199]

[0200]

[0201] In some embodiments, the siRNA conjugate of the present disclosure can have, for example, any of the following structures:

[0202]

[0203]

[0204]

[0205]

[0206]

[0207] In some embodiments, the conjugate group has, for example, the following structure:

[0208]

[0209] ​​​​​​​​​wherein X is oxygen, -N(Y)-, or sulfur;

[0210] Y is C 1-4 alkyl or C 6-10 aryl;

[0211] R1is oxygen or sulfur;

[0212] R2is hydrogen, -NH2, C 1-4 alkyl, C 6-10 aryl, C 1-4 alkoxy, or halogen;

[0213] A is -(CH2) a -, -(CH2CH2O) b -, -((CH2) c NHCO) d - or -((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0214] B is -(CH2) e -, wherein e is an integer from 0 to 7;

[0215] L is -CONH- or -NHCO-;

[0216] X1is -(CH2) f - or -(CH2CH2O) f CH2-, and f is an integer from 1 to 5;

[0217] X2is -(CH2) g -, and g is an integer from 1 to 6;

[0218] X3is oxygen or sulfur;

[0219] Y1is 0 or 1;

[0220] Y2is 0, 1, or 2;

[0221] X4is CH2when Y3is 1; CH when Y3is 2; and carbon when Y3is 3;

[0222] m is an integer from 0 to 4;

[0223] n is an integer from 0 to 4;

[0224] q is an integer from 0 to 4.

[0225] In some embodiments, the conjugate group has, for example, any of the following structures:

[0226] , , , , or .

[0227] In some embodiments, the siRNA conjugate of the present disclosure has, for example, any one of the following structures:

[0228] ,

[0229] ,

[0230] ,

[0231] , or

[0232] .

[0233] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the oligonucleotide duplexes selected from the group consisting of:

[0234] (1) the sense strand has the sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence thereof; wherein the antisense strand is modified with modification pattern B, and the sense strand is modified with modification pattern a;

[0235] (2) the sense strand has the sequence as shown in SEQ ID NO: 1 or a fragment thereof, or a modified sequence thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 194 or a fragment thereof, or a modified sequence thereof; wherein the antisense strand is modified with modification pattern A, and the sense strand is modified with modification pattern a;

[0236] (3) the sense strand has the sequence as shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 232 or a fragment thereof, or a modified sequence thereof; wherein the antisense strand is modified with modification pattern C', and the sense strand is modified with modification pattern a';

[0237] (4) the sense strand has the sequence set forth in SEQ ID NO: 44, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 237, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode C’ and the sense strand adopts a modification mode b’;

[0238] (5) the sense strand has the sequence set forth in SEQ ID NO: 76, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 269, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode E and the sense strand adopts a modification mode b;

[0239] (6) the sense strand has the sequence set forth in SEQ ID NO: 132, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 325, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode B and the sense strand adopts a modification mode a;

[0240] (7) the sense strand has the sequence set forth in SEQ ID NO: 184, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 377, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode C and the sense strand adopts a modification mode a;

[0241] (8) the sense strand has the sequence set forth in SEQ ID NO: 186, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 379, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode E and the sense strand adopts a modification mode b;

[0242] (9) the sense strand has the sequence set forth in SEQ ID NO: 21, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence set forth in SEQ ID NO: 214, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand adopts a modification mode A and the sense strand adopts a modification mode a; the 5thand 7thnucleotides of the antisense strand are replaced by DNA, and the nucleotide in the sense strand which is complementary to the 7thnucleotide of the antisense strand is also replaced by DNA;

[0243] (10) the sense strand has the sequence as shown in SEQ ID NO: 184, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 377, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand is modified with Modification type C, and the sense strand is modified with Modification type a; the 5th, 7th nucleotides of the antisense strand are replaced by DNA, and the nucleotide in the sense strand, which is complementary to the 7th nucleotide of the antisense strand, is also replaced by DNA;

[0244] (11) the sense strand has the sequence as shown in SEQ ID NO: 76, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; and the antisense strand has the sequence as shown in SEQ ID NO: 269, or a fragment thereof, or a modified sequence of the sequence or the fragment thereof; wherein the antisense strand is modified with Modification type E, and the sense strand is modified with Modification type b; the 5th, 7th nucleotides of the antisense strand are replaced by DNA, and the nucleotide in the sense strand, which is complementary to the 7th nucleotide of the antisense strand, is also replaced by DNA;

[0245] wherein either one or both of the sense strand, the antisense strand can be linked to a conjugate group G4, G5, G6, G7, G101, G102, G103, G105, or G106.

[0246] In some embodiments, either one or both of the sense strand, the antisense strand is linked to a conjugate group G101.

[0247] In some embodiments, the conjugate group is linked to the 3' end of the sense strand.

[0248] The present disclosure also provides a nucleic acid protein complex comprising the double-stranded region of the aforementioned double-stranded RNAi agent or siRNA conjugate or the antisense strand of the double-stranded region, and a nuclease.

[0249] In the present disclosure, the term "nucleic acid protein complex" refers to the binding of siRNA to Argonaute protein (AGO) to form an induced silencing complex (RISC). The siRNA is then unwound into a sense strand and an antisense strand. The sense strand is degraded, and the antisense strand (guide strand) RISC binds to the target mRNA homologous to the siRNA through base pairing. RISC has the function of a nuclease, and siRNA guides RISC to cut the homologous single-stranded mRNA, resulting in the loss of function of the mRNA, i.e., the inability to translate into a protein, i.e., to "silence" the gene.

[0250] The present disclosure also provides a recombinant vector comprising a nucleic acid molecule encoding an siRNA as disclosed.

[0251] In some embodiments, the vector backbone of the recombinant vector is selected from the group consisting of recombinant virus-like derived circular RNA vectors, tRNA, rRNA scaffolds, and chimeric tRNA / pre-miRNA vectors.

[0252] The present disclosure also provides a recombinant cell comprising the aforementioned siRNA or recombinant vector.

[0253] In some embodiments, the recombinant cell is selected from the group consisting of Thiosulphophilic Pseudomonas and ribonuclease III deficient Corynebacterium glutamicum.

[0254] As used herein, a "recombinant vector" is preferably a vector comprising regulatory sequences operably linked to a nucleotide sequence encoding the sense strand comprised in the nucleic acid molecule of the present application. A "recombinant cell" is a cell in which at least one recombinant vector has been introduced that can express the nucleic acid molecule or at least one strand of this nucleic acid molecule.

[0255] The present disclosure also provides a method of preparing the siRNA of the present disclosure, the method comprising culturing the aforementioned recombinant cell, or directly obtaining the siRNA using chemical synthesis and mixing.

[0256] The present disclosure also provides a pharmaceutical composition comprising the aforementioned siRNA duplex or corresponding siRNA conjugate, and a pharmaceutically acceptable carrier.

[0257] In one embodiment, provided herein is a pharmaceutical composition comprising an siRNA duplex as described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition comprising the iRNA can be used to treat or prevent a disease or disorder associated with expression or activity of the LPA gene, such as atherosclerosis. Such pharmaceutical compositions are formulated based on the delivery model. One example is a composition formulated for systemic administration by parenteral delivery, for example, by subcutaneous injection (S.C.) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma, for example, by infusion into the brain, for example, by continuous pump infusion.

[0258] A pharmaceutical composition comprising the RNAi agent of the present disclosure can be, for example, a solution with or without a buffer or a composition containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micelle formulations, emulsions, and gene therapy vectors.

[0259] In the methods of the disclosure, the siRNA can be administered in a solution. A free siRNA can be administered in a non-buffered solution, for example in physiological saline or in water. Alternatively, the free siRNA can also be administered in a suitable buffered solution. The buffered solution can include acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffered solution is phosphate buffered saline (PBS). The pH and the osmolarity of the buffered solution containing the siRNA can be adjusted such that it is suitable for administration to a subject.

[0260] In some embodiments, the buffered solution further comprises an agent for controlling the osmolarity of the solution such that the osmolarity is maintained at a desired value, for example at the physiological value of human blood plasma. Solutes that can be added to the buffered solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolarity of the solution is a salt. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.

[0261] The pharmaceutical compositions of the present disclosure can be administered in a dosage sufficient to inhibit expression of an LPA gene. Generally, a suitable dosage of the siRNA of the present disclosure is in the range of about 0.001 to about 200.0 milligrams per kilogram of body weight of the recipient per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, the siRNA (e.g., siRNA conjugate) can be administered at about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg per single dose.

[0262] The pharmaceutical composition can be administered once a day, or multiple times at different intervals from 1 to 365 days, or the siRNA can be administered in two, three or more sub-doses at appropriate intervals throughout the year, or even continuously by continuous infusion or delivery using a controlled release formulation. In this case, the siRNA contained in each sub-dose must be correspondingly less so as to achieve the total daily dose. Dose units can also be compounded for delivery over several days, for example using conventional sustained release formulations that provide a sustained release of siRNA over a period of several days. Sustained release formulations are well known in the art and are particularly useful for delivering agents at a particular site, and can be used with the agents of the present disclosure. In this embodiment, the dose unit comprises a corresponding plurality of daily doses.

[0263] In other embodiments, a single dose of the pharmaceutical composition can be sustained for a long duration, such that subsequent doses are administered at intervals of no more than 3, 4, or 5 days or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the disclosure, a single dose of the pharmaceutical composition of the disclosure is administered once a week. In other embodiments of the disclosure, a single dose of the pharmaceutical composition of the disclosure is administered once a month.

[0264] Those of skill in the art will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or condition, previous treatments, the general health and / or age of the subject, and other existing diseases. In addition, treatment of a subject with a therapeutically effective dose of the composition can include a single treatment or a series of treatments. Effective doses and in vivo half-lives of the various siRNAs encompassed by the present disclosure can be estimated using conventional methods or based on in vivo testing using appropriate animal models.

[0265] The pharmaceutical compositions of the disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., through a skin patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizers; intratracheal; intranasal; epidermal and transdermal, oral or parenteral. Parenteral administration includes subcutaneous, intracutaneous, intradermal, intramuscular, intraperitoneal or intravenous injection or infusion; subdermal, e.g., via implantation devices; or intracranial, e.g., intracerebral, intrathecal or intraventricular, administration.

[0266] The siRNAs for use in the compositions and methods of the disclosure can be formulated for delivery in a membranous molecular assembly, e.g., a liposome or a micelle. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one lipid bilayer (e.g., one lipid bilayer or multiple lipid bilayers), which has an external membrane formed of lipophilic material and an aqueous interior located inside. The lipophilic material separates the aqueous interior from the aqueous exterior, which typically does not include the siRNA composition (although in some examples, it can). Liposomes are useful for transferring and delivering active ingredients to a site of action. Because the liposome membrane is structurally similar to a biological membrane, when a liposome is administered to a tissue, the liposome bilayer fuses with the bilayer of a cell membrane. As fusion of the liposome with the cell proceeds, the internal aqueous contents, including the siRNA, are delivered into the cell, where the siRNA can specifically bind to a target RNA and can mediate RNA interference (RNAi). In some cases, the liposomes are also specifically targeted, e.g., to direct the siRNA to a particular cell type.

[0267] Liposomes containing siRNA can be prepared by a variety of methods. In one example, the lipid components of the liposome are dissolved in a detergent such that micelles are formed with the lipid components. For example, the lipid components can be amphiphilic cationic lipids or lipid conjugates. The detergent can have a high critical micelle concentration and can be non-ionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The siRNA preparation is then added to the micelles comprising the lipid components. The cationic groups on the lipids interact with the siRNA and condense around the siRNA to form liposomes. After condensation, the detergent is removed, e.g., by dialysis, to obtain the corresponding liposomal preparation of siRNA.

[0268] siRNAs, e.g., RNA duplexes of the disclosure, can be encapsulated in a lipid formulation, e.g., an LNP or other nucleic acid-lipid particle.

[0269] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. LNPs contain a cationic lipid, a non-cationic lipid, and a lipid that prevents the particle from aggregating (e.g., a PEG-lipid conjugate). LNPs are extremely useful for synthetic applications because they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., at sites physically separate from the site of administration).

[0270] In one embodiment, the mass ratio of the lipid to the siRNA duplex is about 1 : 1 to about 50: 1, about 1 : 1 to about 25: 1, about 3: 1 to about 15: 1, about 4: 1 to about 10: 1, about 5: 1 to about 9: 1, or about 6: 1 to about 9: 1.

[0271] In some preferred embodiments, the lipid nanoparticle comprises a cationic lipid, a neutral lipid, a structural lipid, and a polymer-conjugated lipid.

[0272] In some preferred embodiments, the cationic lipid is a compound of structure (I), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein G1is C 1～6 alkylene; G2is C 2～8 alkylene; G3is C 1～3 alkylene; L1is C 6～15 linear alkyl; L2is C 12～25 branched alkyl. For example, YK-009 of structure (I-I), and the like (see patent CN114044741B, the entire contents of which are incorporated herein by reference, including therein the general formula and specific compounds, etc.).

[0273] (I)

[0274] (I-I)

[0275] In some preferred embodiments, the cationic lipid is a compound of structure (II), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein: G1is C 2~8 alkylene; G2is C 2~8 alkylene; L1is -C(O)O- or -OC(O)-; L2is -C(O)O- or -OC(O)-; R1is C 6~25 linear or branched alkyl; R2is C 6~25 linear or branched alkyl; G3is HO(CH2)2- or HO(CH2)3-; G4is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 of structure (II-I), YK-402 of structure (II-II), YK-407 of structure (II-III), and the like (see patent CN115784921B, the entire contents of which are incorporated herein by reference, including therein the general formula and specific compounds, etc.).

[0276] (II)

[0277] (II-I)

[0278] (II-II)

[0279] (II-III)

[0280] In some preferred embodiments, the cationic lipid is a compound of structure (III), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein: G1is C 1~6 alkylene; G2is C 2~8 alkylene; R1is C 6~20 linear or branched alkyl; R2is C 12~25 branched alkyl; G3is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2-, or CH3CH2NH(CH2)2-. For example, YK-201 of structure (III-I), YK-202 of structure (III-II), etc. (see patent CN115677518B, the entire contents of which are incorporated herein by reference, including therein the general formula and specific compounds, etc.).

[0281] (III)

[0282] (III-I)

[0283] (III-II)

[0284] In some preferred embodiments, the cationic lipid is a compound of structure (IV), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein G1is C 1~8 alkylene; G2is C 2~8 alkylene; R1is C 6~25 linear or branched alkyl; R2is C 12~25 linear or branched alkyl; G3is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3is -CH3or -CH2CH3or -CH2CH2OH For example, YK-305 of the structure of Formula (IV-I), YK-310 of the structure of Formula (IV-II), and the like (see patent CN115745820B, the entire contents of which are incorporated herein by reference, including therein the general formulae and specific compounds, etc.).

[0285] (IV)

[0286] (IV-I)

[0287] (IV-II)

[0288] In some preferred embodiments, the cationic lipid is a compound of the structure of Formula (V), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein G 1 and G 2 each independently is unsubstituted C6-C 10 alkylene; G 3 is unsubstituted C1-C 12 alkylene; R 1 and R 2 each independently is C6-C 24 alkyl or C6-C 24 alkenyl; R 3 is OR 5 , N, -C(=O)OR 4 , -OC(=O)R 4 , or -NR 5 C(=O)R 4 ; R 4 is C1-C 12 alkyl; and R 5 is H or C1-C6 alkyl; for example, ALC0315 of the structure of Formula (V-I), and the like (see patent CN108368028B, the entire contents of which are incorporated herein by reference, including therein the general formulae and specific compounds, etc.).

[0289] (V)

[0290] (V-I)

[0291] In some preferred embodiments, the cationic lipid is a compound of the structure of Formula (VI), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof, wherein R4is selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of -OR, -OH, -O(CH2)n N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8, and heterocycle; n is 1, 2, or 3; for example, SM102 of structure (VI-I) (see patent application CN110520409A, the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, etc.).

[0292] (VI)

[0293] (VI-I)

[0294] In some preferred embodiments, the cationic lipid is a compound of structure (VII), or an N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer thereof (see patent CN102625696B, DLIN-MC3-DMA, the entire contents of which are incorporated herein by reference, including in particular the general formulae and specific compounds therein, etc.),

[0295] (VII) (DLIN-MC3-DMA).

[0296] In some more preferred embodiments, the cationic lipid is selected from any one or a combination of at least two of the group consisting of YK-009, YK-407, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.

[0297] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.

[0298] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.

[0299] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymeric conjugated lipid is (25-65):(5-25):(25-70):(0.5-5).

[0300] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65):(5-25):(25-45):(0.5-5).

[0301] In some more preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0302] In some preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol, and derivatives thereof.

[0303] In some more preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of 1,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn- glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-didodecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero- 3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3- phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl- sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), palmitoyloleoyl phosphatidyl ethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl- phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.

[0304] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0305] In some preferred embodiments, the structural lipid is selected from any one or at least two in combination of the group consisting of: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, a-tocopherol, corticosteroids.

[0306] In some more preferred embodiments, the structural lipid is cholesterol.

[0307] In some preferred embodiments, the polymeric conjugated lipid is selected from any one or at least two in combination of the group consisting of: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol.

[0308] In some more preferred embodiments, the polymeric conjugated lipid is selected from any one or at least two in combination of the group consisting of: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG2000), and methoxypolyethylene glycol bimatiryl acetamide (ALC-0159).

[0309] Examples of pharmaceutical compositions of the present disclosure include, but are not limited to, aqueous formulations, emulsion formulations, and liposome-containing formulations. These compositions can be produced from a variety of components, examples of which include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. For example, preferred are formulations that target the liver when treating liver disorders, such as liver cancer.

[0310] Pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product.

[0311] The compositions of the present disclosure can be formulated into any of a number of possible dosage forms, such as, but not limited to, tablets, capsules, gelatin capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions of the present disclosure can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension, such substances including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension can also contain stabilizers.

[0312] Certain compositions of the present disclosure also incorporate a carrier compound into the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid or its analog that is inert (i.e., not biologically active per se) but is considered a nucleic acid in vivo processes, e.g., by degrading or facilitating removal from circulation of biologically active nucleic acids, to reduce bioavailability of biologically active nucleic acids. Co-administration of a nucleic acid and a carrier compound, typically with the latter in excess, can result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidney, or other peripheral reservoirs, presumably due to competition with the carrier compound for a common receptor as compared to the nucleic acid. For example, co-administration with polyinosinic acid, dextran sulfate, polycytidylic acid, or 4-acetamido-4' isothiocyanatostilbene-2,2'-disulfonic acid can reduce recovery of partially phosphorothioated dsRNA in liver tissue (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0313] A "pharmaceutical carrier" or "excipient" in contrast to a carrier compound, is a pharmaceutically acceptable solvent, suspending agent or other vehicle with which a nucleic acid or nucleic acids is administered to an animal. The excipient can be liquid or solid and is selected with the aim of providing an appropriate vehicle for the active ingredient in dosage form. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0314] Pharmaceutically acceptable organic or inorganic excipients that are suitable for parenteral administration that do not produce an adverse, allergic or similar untoward reaction with the nucleic acid can also be used to formulate the compositions of the disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, etc.

[0315] Formulations for topical administration of nucleic acids can include sterile or non-sterile aqueous solutions, non-aqueous solutions or suspensions of the nucleic acid in a liquid or solid oil base. Such solutions also can include buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients that are suitable for parenteral administration that do not produce an adverse, allergic or similar untoward reaction with the nucleic acid can be used.

[0316] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, etc.

[0317] The disclosure also provides methods for treating or preventing diseases and conditions that can be modulated by downregulating LPA gene expression. For example, Buerger's disease, peripheral arterial disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic valve stenosis, aortic valve regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic valve stenosis and / or any other disease associated with elevated levels of Lp(a) particles and other yet unidentified related conditions, pathologies or syndromes.

[0318] The siRNAs of the disclosure can be administered to a subject using any mode of administration known in the art, including, but not limited to, subcutaneously, intravenously, intramuscularly, intraocularly, intrabronchially, intrapleurally, intraperitoneally, intraarterially, translymphatically, trans cerebrospinal, and any combination thereof. In preferred embodiments, the agents are administered subcutaneously.

[0319] In additional embodiments, the siRNA is administered in combination with an additional therapeutic agent. The siRNA and the additional therapeutic agent can be administered in combination in the same composition, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.

[0320] Examples of additional therapeutic agents include agents known to treat LPA- associated diseases or disorders. For example, additional therapeutic agents include: administering to the subject one or more siRNAs of the application; administering to the subject a non-LPA RNAi therapeutic; and performing a behavior modification in the subject. In some embodiments, the non-LPA RNAi therapeutic is one of the additional therapeutic agents such as an HMG Co-A reductase inhibitor (statin), ezetimibe, a PCSK-9 inhibitor, a CTEP inhibitor, a therapy targeting ANGPTL3, a therapy targeting APOC3, and niacin, or a combination of any of the above.

[0321] In one embodiment, the iRNA agent is administered to a patient and subsequently an additional therapeutic agent is administered to the patient (or vice versa). In another embodiment, the iRNA agent and the additional therapeutic agent are administered simultaneously.

[0322] Nucleotide abbreviations are as follows herein:

[0323] A = adenosine-3 '-phosphate

[0324] Am = 2'-methoxyadenosine-3 '-phosphate

[0325] Ams = 2'-methoxyadenosine-3 '-phosphorothioate

[0326] Af = 2'-fluoroadenosine-3 '-phosphate

[0327] Afs = 2'-fluoroadenosine-3 '-phosphorothioate

[0328] G = guanosine-3 '-phosphate

[0329] Gm = 2'-methoxyguanosine-3 '-phosphate

[0330] Gms = 2'-methoxyguanosine-3 '-phosphorothioate

[0331] Gf = 2'-fluoroguanosine-3 '-phosphate

[0332] Gfs = 2'-fluoroguanosine-3 '-phosphorothioate

[0333] C = cytidine-3 '-phosphate

[0334] Cm = 2'-methoxycytidine-3 '-phosphate

[0335] Cms = 2'-methoxycytidine-3 '-phosphorothioate

[0336] Cf = 2'-fluorocytidine-3 '-phosphate

[0337] Cfs = 2'-fluorocytidine-3 '-phosphorothioate

[0338] U = Uridine-3'-phosphate

[0339] Um = 2'-Methoxyuridine-3'-phosphate

[0340] Ums = 2'-Methoxyuridine-3'-thiophosphate

[0341] Uf = 2'-Fluorouridine-3'-phosphate

[0342] Ufs = 2'-Fluorouridine-3'-thiophosphate

[0343] AmsEVP = 5'-Vinyl-(E)-phosphonate-2'-methoxyadenosine-3'- thiophosphate

[0344] UmsEVP = 5'-Vinyl-(E)-phosphonate-2'-methoxyuridine-3'- thiophosphate

[0345] Agna = Adenosine-diol nucleic acid

[0346] Cgna = Cytidine-diol nucleic acid

[0347] Ggna = Guanosine-diol nucleic acid

[0348] Tgna = Thymidine-diol nucleic acid

[0349] Ugna = Uridine-diol nucleic acid

[0350] The Code rules for siRNA motifs (or motif), siRNA modifiers, siRNA conjugates, etc. herein are exemplified as follows:

[0351] A sequence with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) alternating modification, add "-AL" after the motif number. For example, the code for the modified B01023 with alternating modification is B01023-AL.

[0352] For siRNA modifiers in, for example, Examples 4, 6, which involve the use of the modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP disclosed herein, the corresponding code rules are: change the first letter of the code for the corresponding motif of the siRNA modifier from "B" to "C", and add the corresponding template name of the siRNA modifier after. For example, for the motif B01023, the code for the modified obtained after the use of the DV25P template is C01023-DV25P.

[0353] For siRNA modifiers / siRNA conjugates in Examples 7-10, for example, the modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP disclosed herein are used, and at the same time, off-target prevention modification mode can be further used, and conjugate groups are connected at the 3' end of the sense strand. The code mode is to change the first letter of the code of the corresponding motif from "B" to "D", and sequentially add the corresponding template name and / or off-target modification name after the code, and add the conjugate group name such as "G103", "G101" and the like at the end. For example, siRNA motif B01023 is modified using DV25P template, and off-target prevention modification d7B5 is used, and conjugate group G101 is connected, and the corresponding code is D01023-DV25Pd7B5G101.

[0354] Table I Code examples of siRNA duplexes (motifs, modifiers, conjugates) in the present disclosure

[0355]

[0356] Examples

[0357] In the following examples, the experimental data P value for comparison between groups is <0.05, and the difference is statistically significant.

[0358] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it is to be understood that the detailed description and specific examples, while indicating specific embodiments of the present disclosure, are given by way of illustration only since various changes and modifications within the spirit and scope of the present disclosure, will become apparent to those skilled in the art from this detailed description.

[0359] The experimental techniques and experimental methods used in the present embodiment are all conventional techniques and methods, and for example, the experimental methods not specifically mentioned in the following examples are usually performed according to the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through commercial channels, unless otherwise specified.

[0360] As understood by those skilled in the art, in various embodiments of the present disclosure, when the subject in the experiment is an siRNA conjugate, it includes but is not limited to inhibition rate, IC 50 , IC 40The experimental data and results can correspondingly reflect the inhibition rate, IC 50 , IC 40 , etc. of the corresponding siRNA modifier of the siRNA conjugate. There is no obstacle for those skilled in the art to understand.

[0361] Example 1: Inhibition of LPA gene by siRNA motif

[0362] 192 siRNA motifs were designed and synthesized according to the human LPA mRNA sequence (NM_005577.4), and the inhibition of LPA gene by each siRNA motif was detected by a dual luciferase system, as shown in Table 2.

[0363] 1.1 Synthesis of siRNA motif

[0364] Instruments and reagents: Genescript 192 P type DNA / RNA automatic synthesizer, its solid phase carrier is a general carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (cytiva manufacturer).

[0365] Preparation method:

[0366] According to the monomer concentration of 0.15 M, the following nucleotide monomer solutions were prepared with acetonitrile: DMT-A-2'-O-TBDMS phosphoramidite monomer (formula 11), DMT-C-2'-O-TBDMS phosphoramidite monomer (formula 12), DMT-G-2'-O-TBDMS phosphoramidite monomer (formula 13) and DMT-U-2'-O-TBDMS phosphoramidite monomer (formula 14).

[0367] Formula 11 Formula 12

[0368] Formula 13 Formula 14

[0369] By solid phase phosphoramidite method, the nucleotide monomers were connected one by one from 3'-5' direction according to the nucleotide arrangement order. Each connection of a nucleotide monomer includes four steps of deprotection, coupling, oxidation or sulfurization, and hydroxyl protection. Among them, when the phosphate ester is used to connect two nucleotides, the connection of the next nucleotide monomer includes four steps of deprotection, coupling, oxidation, and hydroxyl protection. When the phosphorothioate is used to connect two nucleotides, the connection of the next nucleotide monomer includes four steps of deprotection, coupling, sulfurization, and hydroxyl protection.

[0370] The following steps were used to prepare:

[0371] Load the solid support into the designated position of the synthesizer, and go through several cycles of synthesis to obtain the corresponding product, the synthesis cycle including (1) deprotection, (2) coupling, (3) oxidation / sulfuration, and (4) hydroxyl protection, the cycle process and the reagents used are described as follows:

[0372] (1) Deprotection

[0373] Use 3% dichloroacetic acid toluene solution as deprotection reagent to remove the DMT protecting group, and then use acetonitrile for washing.

[0374] (2) Coupling

[0375] Use 0.25 M 5-ethylthiotetrazole as activating agent to couple the acetonitrile solution of each nucleotide monomer, and then use acetonitrile for washing.

[0376] (3) Oxidation / sulfuration

[0377] Oxidation: use 0.05 M iodine pyridine / water (90 / 10) solution as oxidizing agent for oxidation, and then use acetonitrile for washing.

[0378] Sulfuration: use 3% hydrogen xanthate pyridine solution as sulfuration agent for sulfuration, and then use acetonitrile for washing.

[0379] (4) Hydroxyl protection

[0380] Use 10% acetic anhydride tetrahydrofuran solution (CAP A) tetrahydrofuran / pyridine / N-methyl imidazole 74 / 10 / 16 (v / v / v) (CAP B) as hydroxyl protection reagent for hydroxyl protection, and then use acetonitrile for washing.

[0381] Repeat the above operations, and go through the above steps in the order of the set nucleotide arrangement to obtain the product of the sense strand or the product of the antisense strand with a specific sequence arrangement.

[0382] (5) Use 3% dichloroacetic acid toluene solution as deprotection reagent to remove the DMT protecting group of the last nucleotide, and then use acetonitrile for washing.

[0383] (6) Aminolysis and purification

[0384] Transfer the reacted solid support to the reactor, add concentrated ammonia water (25-28%), keep aminolysis at 60°C for 12 h, then reduce the system to room temperature, filter the mixture, rinse the filter cake with a mixed solution of purified water and ethanol, combine the filtrate, pass through a chromatographic column, concentrate, freeze-dry to obtain the 2'-O-TBDMS protected product.

[0385] (7) De-TBDMS

[0386] To the obtained product, DMSO and triethylamine hydrofluoric acid were added, and the reaction was carried out at 60°C for 2h, then ammonium acetate aqueous solution was added to the reaction solution, and after shaking and mixing, anhydrous ethanol was added, and after shaking and mixing, the product was crystallized at -20°C for 8-12h. After centrifugation, the supernatant was discarded, and the precipitate was washed with anhydrous ethanol to obtain the unmodified single-stranded product.

[0387] (8) Annealing

[0388] The obtained sense strand and antisense strand of the siRNA motif were mixed at a molar ratio of 1:1, heated to 95°C and kept for 3min, and then slowly cooled to room temperature to form the double-stranded siRNA motif.

[0389] According to the above method, 193 siRNAs in Table 2 were synthesized, wherein ANC is a nonsense sequence as a negative control.

[0390] 1.2 Dual luciferase assay for inhibition of LPA gene by siRNA motif

[0391] The experimental materials and experimental methods are as follows:

[0392] 1.2.1 Experimental materials

[0393] Table 1 Experimental materials

[0394]

[0395] psiCHECK2-LPA plasmid construction: The full-length sequence of LPA gene mRNA (NM_007755.4) was cloned into the dual luciferase plasmid psiCHECK(TM)-2, and was constructed by Yunchuan Biotechnology (Guangzhou) Co., Ltd., with the order number VB240227-1779ggq.

[0396] 1.2.2 Experimental methods

[0397] 1) Plasmid transfection and cell plating

[0398] Day 0: Transfection of psiCHECK2-target gene plasmid into Huh7 cells

[0399] The psiCHECK2-target gene plasmid was diluted with Opti-MEM to 10ng / μL. Huh7 cells were taken, washed with DPBS first, then trypsin was added for digestion, and the cell density was adjusted to 1×10 5Cells / mL. Mix according to the Fugene-HD transfection reagent: 10 ng / μL of psiCHECK2-Target gene plasmid dilution = 3:100 (volume ratio), mix well and incubate at room temperature for 10 min, then add to Huh7 cells, then seed into 96-well plates at a density of 10,000 cells per well, with 100 μL of culture solution per well. Place the Huh7 cells in a 5% CO2, 37°C incubator overnight.

[0400] 2) Preparation of siRNA solution and cell transfection

[0401] Day 1: siRNA treatment

[0402] Mix RNAiMAX transfection reagent and Opti-MEM at a ratio of 1.5:48.5 by volume to obtain mixture X, incubate at room temperature for 15 min, mix the siRNA to be tested at a starting concentration of 12 nM with the above mixture X at a ratio of 1:1 by volume to obtain mixture Y, incubate at room temperature for 15 min, then add 20 μL of the resulting mixture Y to 100 μL of fresh DMEM culture medium at a ratio of 1:5 by volume and mix well to obtain mixture Z, the final concentration of the siRNA to be tested is 1 nM. Discard the supernatant of the Huh7 cells cultured overnight in the 96-well plate in step 1), add 120 μL of the above mixture Z to each well of the 96-well plate, then place the 96-well plate in a CO2 cell incubator for 48 h.

[0403] 3) Cell sampling and fluorescence expression detection

[0404] Day 2 / Day 3: Detection of reporter gene

[0405] Reagent preparation:

[0406] Reagent A: Transfer the contents of one bottle of Dual-Glo® Luciferase Buffer to one bottle of Dual-Glo® Luciferase Substrate to prepare the Dual-Glo® Luciferase Reagent. The prepared reagent is aliquoted and stored in a -80°C freezer away from light.

[0407] Reagent B: Calculate the amount of Dual-Glo® Stop & Glo® Reagent required for the experiment. Use a new container, dilute the Dual-Glo® Stop & Glo® Substrate 1:100 into the Dual-Glo® Stop & Glo® Buffer to make the required volume of Dual-Glo® Stop & Glo® Reagent, which is prepared immediately before use.

[0408] Sample addition and detection:

[0409] Remove the cell supernatant with a pipette, add 75 μl of fresh 10% FBS (fetal bovine serum) DMEM medium to each well, equilibrate to room temperature, add 75 μl of reagent A to each well, and shake in a plate shaker for 10 minutes at room temperature to lyse the cells.

[0410] After the cells have been completely lysed under a microscope, detect the Firefly luminescence value of luciferase in a multifunctional enzyme marker. Set the parameters of the enzyme marker to chemiluminescence Lum detection, full wavelength, integration time 1 second, and detection height 1 mm.

[0411] After the detection is complete, add 75 μl of reagent B to each well in the plate from the previous step, shake in a plate shaker for 10 minutes at room temperature, and detect the Renilla luminescence value of luciferase. Set the parameters of the enzyme marker to chemiluminescence Lum detection, full wavelength, integration time 1 second, and detection height 1 mm.

[0412] In the experiment, set a control group in which Opti-MEM is used instead of the siRNA described above, and the rest of the conditions are the same as in the experimental group; a blank group in which Huh7 cells are not transfected with the psiCHECK2-target gene plasmid, and no siRNA is added.

[0413] 4) Calculation of the inhibition rate of siRNA on the target gene

[0414] The ratio of the Renilla luciferase fluorescence value to the Firefly luciferase fluorescence value is denoted as α, and the calculation formula is:

[0415] α = (average Renilla lum value of the test wells - average Renilla lum value of the blank control group) / (average Firefly lum value of the test wells - average Firefly lum value of the blank control group);

[0416] According to the above formula, the ratio of the experimental group is denoted as: α (experimental group), and the ratio of the control group is denoted as: α (transfection reagent control group).

[0417] According to the following formula, the inhibition rate of siRNA on the expression of the target gene is calculated:

[0418] Inhibition rate (%) = [1 - α (average value of the experimental group) / α (average value of the transfection reagent control group)] x 100%.

[0419] After 3 repeated experiments, each with 3 parallel detection wells, the inhibition rates of each siRNA motif on LPA mRNA expression are shown in Table 2 below. Among them, 114 siRNA motifs have an inhibition rate on LPA gene greater than 25%, and have good inhibitory activity.

[0420] Table 2 Inhibition of siRNA basic sequence on LPA gene

[0421]

[0422]

[0423]

[0424]

[0425]

[0426]

[0427]

[0428]

[0429]

[0430]

[0431] Example 2: Synthesis of siRNA modification with alternating modification

[0432] To improve the inhibition rate and stability, the siRNA motif in Table 2 is modified with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) alternately, and 3', 5'-thiophosphodiester bonds are introduced between the nucleotides at the 5' end and / or the 3' end.

[0433] 2.1 Synthesis of siRNA modification with alternating modification

[0434] The rule of alternating modification in the present disclosure is that the nucleotides at the odd point positions of the sense strand and the nucleotides at the even point positions of the antisense strand are both modified with 2'-F, and the nucleotides at the other point positions are modified with 2'-OMe. In addition, there are 3', 5'-thiophosphodiester bonds between the first and second nucleotides and between the second and third nucleotides at the 5' end of the sense strand; there are 3', 5'-thiophosphodiester bonds between the first and second nucleotides and between the second and third nucleotides at the 5' end of the antisense strand, and there are 3', 5'-thiophosphodiester bonds between the first and second nucleotides and between the second and third nucleotides at the 3' end of the antisense strand. The siRNA modification with alternating modification designed according to the rule is represented by adding "-AL" after the original basic sequence number, as shown in Table 3.

[0435] Instrument and reagent: Genesee 192 P type DNA / RNA automatic synthesizer, its solid phase carrier is a general carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (cytiva manufacturer).

[0436] For example, the preparation method can include:

[0437] The following nucleotide monomers were prepared in acetonitrile at a monomer concentration of 0.15 M: DMT-A-OMe phosphoramidite monomer (Formula 1), DMT-C-OMe phosphoramidite monomer (Formula 2), DMT-G-OMe phosphoramidite monomer (Formula 3), and DMT-U-OMe phosphoramidite monomer (Formula 4), DMT-A-F phosphoramidite monomer (Formula 5), DMT-C-F phosphoramidite monomer (Formula 6), DMT-G-F phosphoramidite monomer (Formula 7), and DMT-U-F phosphoramidite monomer (Formula 8).

[0438]

[0439]

[0440]

[0441] The nucleotide monomers were sequentially connected in the order of nucleotide arrangement from 3'-5' direction by solid phase phosphoramidite method. Each connection of a nucleotide monomer includes four steps of deprotection, coupling, oxidation or sulfurization, and hydroxyl protection. When the phosphate ester is used for the connection between two nucleotides, the four steps of deprotection, coupling, oxidation, and hydroxyl protection are included when the next nucleotide monomer is connected. When the phosphorothioate is used for the connection between two nucleotides, the four steps of deprotection, coupling, sulfurization, and hydroxyl protection are included when the next nucleotide monomer is connected.

[0442] (1) Deprotection

[0443] A 3% dichloroacetic acid toluene solution was used as a deprotection reagent to remove the DMT protecting group, and then acetonitrile was used for washing.

[0444] (2) Coupling

[0445] A 0.25 M 5-ethylthiotetrazole was used as an activator for the coupling of the acetonitrile solution of each nucleotide monomer, and then acetonitrile was used for washing.

[0446] (3) Oxidation / Sulfurization

[0447] Oxidation: A 0.05 M iodine solution in pyridine / water (90 / 10) was used as an oxidizing agent for oxidation, and then acetonitrile was used for washing.

[0448] Sulfurization: A 3% hydrogenated xanthate solution in pyridine was used as a sulfurizing agent for sulfurization, and then acetonitrile was used for washing.

[0449] (4) Hydroxyl Protection

[0450] Hydroxyl protection was performed using 10% acetic anhydride tetrahydrofuran solution (CAP A), tetrahydrofuran / pyridine / N-methylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as the hydroxyl protection reagent, followed by washing with acetonitrile.

[0451] The above operation was repeated, and the above steps were cycled according to the set nucleotide arrangement sequence to obtain a product of a sense strand or an antisense strand with a specific sequence arrangement.

[0452] (5) The DMT protection group of the last nucleotide was removed using 3% dichloroacetic acid toluene solution as the deprotection reagent, followed by washing with acetonitrile.

[0453] (6) Amination and purification

[0454] The solid phase carrier was transferred to a reactor, concentrated ammonia water (25%-28%, mass percentage) was added, and amination was performed at 60°C for 12 h. Then the system was cooled to room temperature, and the mixture was transferred to a filter tank for filtration. The filter cake was eluted with a mixed solution of purified water and ethanol, and the filtrate was combined and passed through a chromatography column. After concentration, freeze-drying was performed to obtain a 2'-OMe and 2'-F modified single-stranded product.

[0455] (7) Annealing

[0456] After the purified sense strand and antisense strand were mixed at a molar ratio of 1:1, heating was performed to 95°C and maintained for 3 min, and then slow cooling was performed to room temperature to form an siRNA duplex.

[0457] The sense strands and antisense strands of the siRNAs listed in Table 3 were synthesized according to the above method, and a total of 194 siRNAs were obtained. Among them, APC-AL was a positive control, which was the original sequence of the drug Olpasiran that had entered the clinical phase III (the base sequence of the sense strand was shown as SEQ ID NO: 387, and the base sequence of the antisense strand was shown as SEQ ID NO: 388), which was subjected to the above alternating modification. ANC-AL was a negative control (its base sequence was shown in Table 2), which was an alternatingly modified nonsense sequence.

[0458] SEQ ID NO: 387: CAGCCCCUUAUUGUUAUACGA

[0459] SEQ ID NO: 388: UCGUAUAACAAUAAGGGGCUG

[0460] Example 3: Inhibition of LPA gene by the alternatingly modified siRNA modifier

[0461] The inhibition of LPA gene by the alternatingly modified siRNA modifier synthesized in Example 2 was determined using two methods of dual luciferase system and human primary hepatocyte transfection.

[0462] 3.1 Dual-luciferase assay

[0463] All the 194 alternately modified siRNA modifiers in Table 3 were detected for their inhibitory effects on LPA gene by dual-luciferase assay, and the experimental materials and methods were referred to 1.2.1 and 1.2.2 of Example 1.

[0464] 3.1.1 Experimental results

[0465] The inhibitory effects of the siRNA modifiers in Table 3 on LPA gene were detected by dual-luciferase assay, with 3 repeated experiments, 3 parallel detection holes for each siRNA modifier.

[0466] Table 3 Inhibition of LPA gene by alternately modified siRNA modifiers

[0467]

[0468]

[0469] 3.2 Detection of inhibitory effects of alternately modified siRNA modifiers on LPA gene by human primary hepatocyte transfection

[0470] Eighteen of the 194 alternately modified siRNA modifiers in Table 3 with better activity were selected (see Table 5). After the modifiers were transfected into human primary hepatocytes by liposome (Lipofectamine RNAiMAX), the inhibition rate of each sequence on LPA gene was detected by qPCR technology, and the IC 40 was calculated by fitting the dose-effect relationship curve. The siRNA transfection concentration was set to 10 nM as the starting point, with 3-fold gradient dilution, and a total of 8 concentrations (10 nM, 3.3 nM, 1.1 nM, 0.37 nM, 0.12 nM, 0.04 nM, 14 pM, 5 pM) were used to detect the inhibitory activity on LPA gene.

[0471] 3.2.1 Experimental materials

[0472] Table 4 Experimental materials

[0473]

[0474] Solvent: sterilized RNase-free water.

[0475] 3.2.2 Experimental methods

[0476] 1) Human primary hepatocyte recovery

[0477] Preheat the culture medium at 37°C for at least 30 min. Add 120 μL of PBS to each well of a collagen-coated 96-well plate, shake several times, and then discard the PBS. Remove the cell cryovials from the liquid nitrogen container and place them in a 37°C water bath, gently shaking until only a small amount of ice crystals remain in the tubes. Pour the cell suspension into the resuscitation medium all at once. Rinse the inside of the cryovials 2-3 times with 1 mL of resuscitation medium. Invert the resuscitation medium to mix the cell suspension. Centrifuge at 150 g for 5 min at room temperature, discard the supernatant, and resuspend the cells in preheated plating medium. Count the cells using a cell counter.

[0478] 2) Human primary hepatocyte plating and siRNA transfection

[0479] Preparation of siRNA transfection complex: Mix RNAiMAX transfection reagent and Opti-medium at a volume ratio of 1.5:23.5 to obtain solution A, and incubate at room temperature for 15 minutes; dilute with Opti-MEM according to the transfection concentration to prepare a solution of siRNA modifier, so that the concentration of the prepared modifier is 20 times the final transfection concentration, and the diluted solution is solution B; mix solution A and solution B at a 1:1 ratio to obtain solution C, incubate at room temperature for 15 minutes, and then add 10 μL to each well of a collagen-coated 96-well cell culture plate.

[0480] Cell dilution and plating: After counting PHH cells, plating medium was added to the cell suspension according to the counting results to adjust the cell concentration to 5 × 10⁶ cells / mL. 5 ~6×10 5 Add cells / mL and mix thoroughly; use a multichannel pipette to dispense the cell suspension into the collagen-coated 96-well cell culture plates, adding 90 μL of cell suspension to each well.

[0481] Culture: Place the culture plate in a 5% CO2 incubator, at 95% relative humidity and 37℃, and incubate statically for 48 hours.

[0482] 3) RNA extraction and reverse transcription

[0483] 24 h after transfection, the culture medium was removed and cells were collected for RNA extraction. Total RNA was extracted using the Rneasy Mini Kit (QIAGEN-74106) according to the kit instructions. cDNA was then synthesized using the FastKing RT Kit (With gDNase) (TIANGEN-KR116-02) according to the kit instructions.

[0484] 4) RT-qPCR

[0485] According to the kit instructions, the mRNA of the target gene human LPA gene (Thermo, Hs00916691_m1) and the internal reference gene human GAPDH gene (Thermo, Hs02786624_g1) were amplified respectively using TaqMan Fast Advanced Master Mix (Thermo, 4444557).

[0486] 5) Data analysis

[0487] Using the ΔΔCt relative quantification method, the RNA expression level of the target gene in the sample was calculated according to the Ct value of each sample. The relative expression of the target gene was calculated using 2 -ΔΔCt .

[0488] The calculation formula is as follows:

[0489] ΔCT = Average Ct value of target gene - Average Ct value of internal reference gene;

[0490] ΔΔCT = ΔCT (drug group) - ΔCT (RNAiMAX control group);

[0491] Relative expression of target gene mRNA = 2 -ΔΔCt

[0492] Inhibition rate = (1 - sample relative expression / RNAiMAX control average expression) × 100%

[0493] The dose-effect relationship curve was fitted using GraphPad Prism software (Nonlinear four parameter logistic equations).

[0494] 3.2.3 Experimental results

[0495] After 3 qPCR detections, the inhibition rates of each siRNA modifier on the LPA gene of human primary hepatocytes at different concentrations are shown in Table 5. Each modifier has a certain inhibitory effect on LPA, and the inhibition rate of B01023-AL on LPA at 10 nM reaches 90.0%. In addition, the IC 40 of some modifiers is better than that of the APC-AL of the common sunflower, for example, the IC 40 of B01023-AL is 0.10 nM, which is better than the 10.53 nM of the common sunflower.

[0496] Table 5 Inhibition rate of alternate modifier at different concentrations on LPA of human primary hepatocytes and IC 40 and IC 50

[0497]

[0498] Example 4: Inhibition of LPA gene by the modifiers

[0499] This example modifies the 17 base sequences screened in Example 1 and Example 3, i.e., B01001, B01012, B01023, B01011, B01040, B01042, B01047, B01801, B02460, B02458, B02416, B02417, B02459, B02457, B02434, B06001, and B06029, using the modified templates. Among them, DV25P, DV26P, DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP, DV26SP, DV27SP, DV29SP, DV32SP, DV34SP, DV38SP are new modified templates of the present disclosure, DV22 is an Advanced ESC modified template disclosed in the prior art (Foster, D. J., et al. (2018). "Advanced siRNA Designs Further Improve In Vivo Performance of GalNAc-siRNA Conjugates." Mol Ther 26(3): 708-717.), and DV22S is a modified template for siRNA modifiers or siRNA conjugates with 20 and 22 bases in the antisense and sense strands, respectively, based on DV22.

[0500] DV22 antisense strand 5'-3': starting from the 5' end of the antisense strand, the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, and 22nd nucleotides are 2'-methoxy modified nucleotides, and the 2nd and 6th nucleotides are 2'-fluoro modified nucleotides, and the 1st, 2nd, 21st, and 22nd nucleotides are connected to the adjacent nucleotides on the right by 3', 5'-thiophosphodiester bonds.

[0501] DV22 sense strand 5'-3': starting from the 5' end of the sense strand, the 1st, 2nd, 3rd, 4th, 5th, 6th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides are 2'-methoxy modified nucleotides, and the 7th, 9th, 10th, and 11th nucleotides are 2'-fluoro modified nucleotides, and the 1st and 2nd nucleotides are connected to the adjacent nucleotides on the right by 3', 5'-thiophosphodiester bonds.

[0502] DV22S antisense strand 5'-3': the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd nucleotides from the 5' end of the antisense strand are 2'-methoxy modified nucleotides, and the 2nd, 6th nucleotides are 2'-fluoro modified nucleotides, and the 1st, 2nd, 20th, 21st nucleotides are connected to the right adjacent nucleotides by 3', 5'-thiophosphodiester bond.

[0503] DV22S sense strand 5'-3': the 1st, 2nd, 3rd, 4th, 5th, 7th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th nucleotides from the 5' end of the sense strand are 2'-methoxy modified nucleotides, and the 6th, 8th, 9th, 10th nucleotides are 2'-fluoro modified nucleotides, and the 1st, 2nd nucleotides are connected to the right adjacent nucleotides by 3', 5'-thiophosphodiester bond.

[0504] Natural 5' end phosphorylation or simple direct 5' end phosphorylation can occur dephosphorylation in cells, and 90% of direct 5' end phosphorylated oligonucleotide chains can be dephosphorylated after 2 hours of circulation in blood, and all disappear after 24 hours. 5' end phosphorylation design (5'-E-VP) uses E-vinyl phosphonate to replace the bridging oxygen, which has improved phosphorylation effect and stability. The 5' end of the antisense strand of the modified template DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP of the present disclosure contains a 5'-vinyl phosphonate group.

[0505] 4.1 Sequence synthesis:

[0506] Synthesize siRNA sequences according to the method in Example 1, and use monomers containing phosphonate groups at the 5' end, such as vinyl-(E)-phosphonate-A-OMe phosphoramidite monomer (Formula 9), vinyl-(E)-phosphonate-U-OMe phosphoramidite monomer (Formula 10), for example, when synthesizing the base at the 5' end of the antisense strand (the last base), and the structures are as follows:

[0507] Formula 9 Formula 10

[0508] 4.2 Modified templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP:

[0509] The modification rules of the modified templates of the present disclosure are as follows:

[0510] For siRNA modifications or siRNA conjugates with 21, 23 bases for the sense and antisense strands, respectively:

[0511] The antisense strand has any of the modifications shown in Table 6:

[0512] Table 6 Modifications for Antisense Strand

[0513]

[0514]

[0515] The sense strand has any of the modifications shown in Table 7:

[0516] Table 7 Modifications for Sense Strand

[0517]

[0518] where 2'-OMe means 2'-methoxy; 2'-F means 2'-fluoro; PS means that the nucleotide at this position is linked to its right-hand neighbor nucleotide by a 3',5'-phosphorothioate linkage starting from the 5' end.

[0519] The siRNA modification template with the antisense strand having modification pattern A and the sense strand having modification pattern a is designated DV25P.

[0520] The siRNA modification template with the antisense strand having modification pattern B and the sense strand having modification pattern a is designated DV26P.

[0521] The siRNA modification template with the antisense strand having modification pattern C and the sense strand having modification pattern a is designated DV27P.

[0522] The siRNA modification template with the antisense strand having modification pattern C and the sense strand having modification pattern b is designated DV29P.

[0523] The siRNA modification template with the antisense strand having modification pattern D and the sense strand having modification pattern b is designated DV32P.

[0524] The siRNA modification template with the antisense strand having modification pattern E and the sense strand having modification pattern b is designated DV38P.

[0525] The siRNA modification template with the antisense strand having modification pattern F and the sense strand having modification pattern b is designated DV34P.

[0526] For siRNA modifications or siRNA conjugates with 20, 22 bases for the sense and antisense strands, respectively:

[0527] The antisense strand has any of the modifications set forth in Table 8:

[0528] Table 8 Modifications for Antisense Strand

[0529]

[0530] The sense strand has any of the modifications set forth in Table 9:

[0531] Table 9 Modifications for Sense Strand

[0532]

[0533] wherein 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS represents a 3',5'-phosphorothioate linkage between the nucleotide at this position and its right-hand neighboring nucleotide, starting from the 5' end;

[0534] The siRNA modification template with the antisense strand having modification A' and the sense strand having modification a' is designated as DV25SP;

[0535] The siRNA modification template with the antisense strand having modification B' and the sense strand having modification a' is designated as DV26SP;

[0536] The siRNA modification template with the antisense strand having modification C' and the sense strand having modification a' is designated as DV27SP;

[0537] The siRNA modification template with the antisense strand having modification C' and the sense strand having modification b' is designated as DV29SP;

[0538] The siRNA modification template with the antisense strand having modification D' and the sense strand having modification b' is designated as DV32SP;

[0539] The siRNA modification template with the antisense strand having modification E' and the sense strand having modification b' is designated as DV38SP;

[0540] The siRNA modification template with the antisense strand having modification F' and the sense strand having modification b' is designated as DV34SP.

[0541] The siRNA modification templates with the modifications for the templates are shown in Table 10, and the synthesis method is according to Example 1.

[0542] The siRNA modification templates in Table 10 were tested for their inhibitory effect on the LPA gene using two methods, the dual luciferase system and the human primary hepatocyte transfection method.

[0543] 4.3 Testing the inhibitory effect of the template-modified siRNA modification on the LPA gene using the dual luciferase method

[0544] The 120 template-modified siRNA modifiers in Table 10 were tested for their inhibitory effect on LPA gene using dual-luciferase method. Among them, the positive control APC-OL is the original modification sequence of Olpasiran after removing the GalNAc group, and the negative control ANC-DV29P is a nonsense sequence modified by DV29-modified template.

[0545] The experimental materials and experimental methods refer to 1.2.1 and 1.2.2 in Example 1.

[0546] Each template-modified modifier was tested in triplicate, and the inhibition rate of each template-modified modifier on LPA mRNA expression is shown in Table 10 below.

[0547] Table 10 Inhibition of different template-modified siRNA modifiers on LPA gene

[0548]

[0549]

[0550]

[0551]

[0552]

[0553] APC-OL:

[0554] Sense strand (SEQ ID NO: 389): Cms-Ams-Gm-Cm-Cm-Cm-Cm-Um-Uf-Af-Uf-Um-Gm-Um-Um-Am-Um-Am-Cm-Gms-d'A

[0555] Antisense strand (SEQ ID NO: 390): Ums-Cfs-Gm-Uf-Am-Uf-Am-Am-Cm-Am-Am-Uf-Am-Af-Gm-Gf-Gm-Gf-Cms-Ufs-Gm

[0556] d'A: 3'-3' phosphodiester bond connected DNA.

[0557] The above results show that:

[0558] (1) The 17 siRNA motifs B01001, B01012, B01023, B01011, B01040, B01042, B01047, B01801, B02460, B02458, B02416, B02417, B02459, B02457, B02434, B06001 and B06029 screened out, after being modified by the modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP, the obtained modifiers have a significant inhibitory effect on the expression of LPA gene, and the inhibition rates of the 91 templates modified siRNA modifiers are all above 40%, for example, the inhibition rates of C01023-DV25P, C02417-DV38P and C01801-DV27P are 81.2%, 78.0% and 70.6% respectively.

[0559] (2) The 17 sequences above are modified by the modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP, and compared with the alternating modification sequences, the inhibition rates of the modified sequences on the expression of LPA gene are significantly improved. For example, the inhibition rate of the modifier C01023-DV25P obtained by modifying the siRNA motif B01023 by the template DV25P is 9.9% higher than that of the modifier obtained by alternating modification, and the inhibition rate of the modifier C02417-DV38P obtained by modifying the siRNA motif B02417 by the template DV38P is 15.7% higher than that of the modifier obtained by alternating modification.

[0560] (3) The same sequence is modified by the modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP, and compared with the modification templates disclosed by the prior art, the inhibition rates of the modified sequences on the expression of LPA gene are significantly improved. For example, the siRNA motif B01023 is modified by the modification template DV25P disclosed by the present disclosure, and compared with the modification sequence by the disclosed Advanced ESC template DV22, the inhibition rate is increased by 10.8%, and the siRNA motif B02417 is modified by the modification template DV38P disclosed by the present disclosure, and compared with the modification sequence by the disclosed Advanced ESC template DV22, the inhibition rate is increased by 7.2%.

[0561] (4) The activity of different template modification sequences is greatly different. For example, the inhibition rate of siRNA motif B01023 modified by DV25P is 21.3% higher than that modified by DV34; the inhibition rate of siRNA motif B01801 modified by DV27P is 12.0% higher than that modified by DV32P. Therefore, it is uncertain which modification template can be used to modify siRNA sequence to have high activity.

[0562] 4.4 Detection of the inhibition effect of template modification sequences on LPA gene by human primary hepatocyte transfection method

[0563] The sequences with better activity in the 101 template modification sequences in Table 10 (see Table 11) were detected for the inhibition effect on LPA gene by human primary hepatocyte transfection method.

[0564] After each sequence was transfected into human primary hepatocytes by liposome (Lipofectamine RNAiMAX), the inhibition rate of each sequence on LPA gene was detected by qPCR technology, and the IC 50 was calculated by fitting the dose-effect relationship curve. The siRNA transfection concentration was set to 2.5 nM as the starting point, and 4-fold dilution was performed, with a total of 6 concentration points (2.5 nM, 0.625 nM, 0.156 nM, 0.039 nM, 0.01 nM, 0.002 nM).

[0565] The experimental materials and experimental methods refer to 3.2.1 and 3.2.2 in Example 3.

[0566] After 3 times of qPCR detection, the inhibition rate of each sequence on LPA gene of human primary hepatocytes at different concentrations is shown in Table 11 below. Each sequence modified by the modified template designed in the present disclosure has a certain inhibition effect on LPA, among which 19 sequences have IC 50 values of 0.016-0.417 nM, indicating that these sequences can effectively inhibit the expression of LPA gene at low concentrations. The IC 50 of some sequences is better than that of the positive control APC-OL (Olpasiran sequence original modification sequence), for example, the IC 50 of C01023-DV25P is 0.025 nM, which is less than 2.178 nM of the positive control.

[0567] Compared with the modification template Advanced ESC template DV22 disclosed in the prior art, the same sequence modified by the modified template DV25P-DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP-DV27SP, DV29SP, DV32SP, DV34SP, DV38SP of the present disclosure has significantly improved inhibition effect on LPA gene, and the IC 50Lower than the DV22 template disclosed in the prior art. For example, siRNA motif B01023 adopts the modification template DV25P modification sequence, compared with the modification sequence adopting the disclosed Advanced ESC template DV22 modification, the highest inhibition rate of human primary hepatocytes is increased by 13.2%, IC 50 from 0.067nM to 0.025nM; siRNA motif B02417 adopts the modification template DV38P modification sequence, compared with the modification sequence adopting the disclosed Advanced ESC template DV22 modification, the highest inhibition rate of human primary hepatocytes LPA gene is increased by 10.8%, IC 50 from 0.777nM to 0.041nM.

[0568] Table 11 Inhibition rate of LPA of template modified modification of different concentrations on human primary hepatocytes and IC 50

[0569]

[0570] Example 5: Comparison of LPA gene inhibition effect with prior art disclosed sequence

[0571] This example compares the inhibition rate of LPA gene of the 8 siRNA motifs B01001, B01012, B01023, B01042, B01047, B01801, B02417, B06001 in the present disclosure with the corresponding alternating modification modification and the modification adopting DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP template modification, with the siRNA motif similar to the above 8 sequences and the template modification sequence corresponding to the prior art disclosed sequence.

[0572] 1. Experimental materials

[0573] Test samples:

[0574] (1) Unmodified motif and modification of prior art disclosed, see Table 12.

[0575] Table 12 Prior art disclosed sequence

[0576]

[0577] (2) The sequences in the present application similar to the existing disclosed sequences in Table 12, including the modified siRNA sequences in Example 2 with 2'-OMe and 2'-F alternating modification, siRNA sequences with terminal thio-modification, unmodified siRNA sequences in Example 1, siRNA sequences modified by modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP in Example 4, see Table 13 for sequence numbers.

[0578] 2. Experimental methods and results

[0579] The above siRNA motifs and modified sequences were detected by dual luciferase method for their inhibitory effect on LPA gene at the cellular level.

[0580] The experimental materials and methods refer to 1.2.1 and 1.2.2 in Example 1.

[0581] The experimental results are shown in Table 13.

[0582] Table 13 Inhibition rate of siRNA similar to the siRNA of the present disclosure on LPA gene in the prior art

[0583]

[0584]

[0585]

[0586] The experimental results show that the siRNA motif, the alternating modified siRNA modifier and the siRNA modifier modified by the specific modification template of the present disclosure have significantly improved LPA inhibitory activity compared with the similar siRNA motif disclosed in the prior art. For example, B01023P disclosed in the prior art has 4 additional bases ACTT at the 3' end of the positive strand and 4 additional bases AAGU at the 5' end of the negative strand compared with B01023 of the present disclosure. However, the inhibition rate of B01023 of the present disclosure is increased by 22.7% compared with B01023P, the inhibition rate of the alternating modified modifier B01023-AL is 71.3%, which is increased by 26.1% compared with B01023P, and the inhibition rate of C01023-DV25P modified by the modification template DV25 of the present disclosure is 81.2%, which is increased by 36.0% compared with B01023P.

[0587] Example 6: Off-target effect of the modified substance

[0588] In the practical application of siRNA, there is a case where the expression of non-target mRNA partially complementary to the antisense strand is inhibited. Studies have shown that the hepatotoxicity of GalNAc-conjugated siRNA conjugates is mainly due to the inhibition of the wrong target caused by off-target effects.

[0589] In this example, the siRNA modifiers with higher activity in Example 4 were selected to determine their inhibition rates of potential off-target genes in human primary hepatocytes (PHH) and compared with the drug Olpasiran.

[0590] 1. Experimental materials

[0591] 1) Test samples:

[0592] The 11 siRNA modifiers with higher activity in Example 4 and the positive control APC-OL (see Table 14) were used, wherein APC-OL represents the corresponding sequence of Olpasiran.

[0593] 2. Experimental method

[0594] qRT-PCR was used to detect the inhibition rate of the test samples on the expression of LPA gene and potential off-target genes in PHH cells. Specifically, after each modifier was transfected into PHH cells by liposome (Lipofectamine RNAiMAX), qPCR was used to detect the inhibition rate of each test sample on LPA gene and potential off-target genes.

[0595] The experimental materials and methods of PHH cell recovery, siRNA transfection, RNA extraction and reverse transcription refer to 3.2.2 in Example 3, qPCR amplification of target gene LPA and internal reference gene GAPDH was performed by probe method, and the method refers to 3.2.2 in Example 3. According to the manual of TB Green Premix Ex Taq (Takara, RR420W), qPCR amplification of potential off-target genes in Table 14 was performed.

[0596] 3. Experimental results

[0597] The inhibition rates of the modifiers at concentrations of 40 nM, 10 nM, 2.5 nM and 0.625 nM on LPA gene and potential off-target genes, IC 50 As shown in Table 14.

[0598] Table 14 Inhibition rates and IC of different concentrations of modifiers on LPA gene and potential off-target genes 50

[0599]

[0600]

[0601] Note: IC of each sequence to LPA gene 50 The data is derived from Table 11 of 4.4 in Example 4.

[0602] From the above table, it can be seen that:

[0603] (1) Each of the above sequences can inhibit the LPA gene.

[0604] (2) Only the C01011-DV27P sequence produces off-target effects on the SPICE1 gene, and the IC of the C01011-DV27P sequence to the LPA gene is less than 2.2 times the IC of the C01011-DV27P sequence to the SPICE1 gene. 50

[0605] (3) Except for C01011-DV27P, the inhibition rates of other modified substances to potential off-target genes are less than 40.7% at a concentration of 40 nM, and the IC of other modified substances to potential off-target genes is 167 times higher than the IC of other modified substances to the target gene LPA gene. 50 50 This shows that the off-target effect of the modified substance of the present disclosure is not obvious.

[0606] Example 7: Inhibition of LPA gene and potential off-target genes by siRNA modified substance with off-target prevention modification

[0607] There is such a modification in the prior art that the 7th nucleotide of the antisense strand of siRNA is replaced with glycol nucleic acid (GNA) to disturb the seed region of the antisense strand, thereby significantly reducing the off-target effect and achieving the reduction of hepatotoxicity. In addition, it has been found that replacing all the base pairs of the 1st to 8th nucleotide positions at the 5' end of the antisense strand with the corresponding DNA can significantly reduce the off-target effect of siRNA without affecting the activity of siRNA.

[0608] Therefore, in this embodiment, in order to reduce the off-target effect, the siRNA motifs B01801, B01023 and B02417 are modified by using DV25P-DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP-DV27SP, DV29SP, DV32SP, DV34SP, DV38SP modified templates, replacing the 7th or 5th and 7th nucleotides of the antisense strand with DNA, and replacing the nucleotides at the position complementary to the 7th nucleotide of the antisense strand in the sense strand with DNA to reduce the off-target effect.

[0609] d7B5 off-target prevention: the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotides at the position complementary to the 7th nucleotide of the antisense strand in the sense strand are also replaced with DNA.

[0610] ​​d7B Off-target prevention: the 7th nucleotide of the antisense strand is replaced by DNA, and the nucleotide in the sense strand that is complementary to the 7th nucleotide of the antisense strand is also replaced by DNA.

[0611] The experimental results show that, at a concentration of 30 pM to 30 nM, the modified substance with off-target prevention modification has a significant inhibitory effect on the target gene LPA, and the inhibition rate of the modified substance on the potential off-target gene is significantly lower than that on the target gene. This shows that the use of off-target prevention modification does not affect the inhibitory effect of the modified substance of the present disclosure with alternating modification and template modification on the LPA gene, but can inhibit the off-target effect of part of the sequence.

[0612] 1. Experimental materials

[0613] 1) Test samples:

[0614] The siRNA motifs B01801, B01023 and B02417 are subjected to template modification, or the corresponding conjugates of template modification + off-target prevention modification (sequences are shown in Table 19 in Example 9 below).

[0615] 2) Sequence synthesis:

[0616] I. Synthesis of siRNA modified substances with template modification

[0617] The synthesis method is referred to the synthesis method of the modified substance with alternating modification in Example 2.

[0618] II. siRNA modified substances with DNA off-target prevention modification

[0619] The siRNA is synthesized by a method similar to that in Example 2, but when the 5th or 7th nucleotide at the 5' end of the antisense strand is synthesized, or when the nucleotide on the sense strand that matches the 7th base at the 5' end of the antisense strand is synthesized, a DNA monomer DMT-dA phosphoramidite monomer (Formula 15), a DMT-dT phosphoramidite monomer (Formula 16), a DMT-dC phosphoramidite monomer (Formula 17) or a DMT-dG phosphoramidite monomer (Formula 18) is used, each of which has the following structure:

[0620] Formula 15 Formula 16 Formula 17

[0621] Formula 18

[0622] 2. Experimental method

[0623] The inhibition of the test samples on the mRNA expression of LPA and potential off-target genes of PHH cells is detected by qRT-PCR. The experimental materials and experimental methods are referred to Example 6.

[0624] 3. Experimental results

[0625] (1) After template modification and off-target prevention modification, the LPA gene expression has significant inhibitory activity. For example, after siRNA motif B01023 is modified by template DV25P modification, the conjugate D01023-DV25PG101 has an inhibition rate of 86.2% on the LPA gene expression of human primary hepatocytes. After modification by modified template DV25P modification + off-target prevention modification d7B5, the corresponding conjugate D01023-DV25Pd7B5G101 has an inhibition rate of up to 87.7%.

[0626] At 30nM, 1nM, 0.03nM concentrations, the inhibition rates of each conjugate on LPA gene expression are as follows.

[0627] Table 15 Inhibition rate of conjugate with template modification and off-target prevention modification on LPA gene of human primary hepatocytes

[0628]

[0629] (2) After modification by any one or more of the modified templates of the present disclosure, and off-target prevention modification, the potential off-target genes have significant off-target prevention effect, and the inhibition of siRNA on the potential off-target genes is reduced.

[0630] As shown in Table 16, the experimental results show that:

[0631] The template modification + off-target prevention modification of the present disclosure can reduce the inhibition of off-target genes, i.e. has an off-target prevention effect. The modification material / conjugate using the modified template modification and off-target prevention modification of the present disclosure can significantly reduce the off-target effect, and the inhibition rate of off-target genes can be reduced by up to 50.7%.

[0632] Table 16 Inhibition rate of conjugate with template modification and template modification + off-target prevention modification on LPA and potential off-target genes

[0633]

[0634] 1) Only template modification

[0635] After template modification, some conjugates have certain off-target effects, for example, the corresponding conjugate D01801-DV27PG101 of siRNA motif B01801 after template modification with DV27P modification has an inhibition rate of 50.0% on the potential off-target gene ADCY10; the corresponding conjugate D02417-DV38PG101 of siRNA motif B02417 after template modification with DV38P modification has an inhibition rate of 36.4% on the potential off-target gene TAGLN.

[0636] 2) Template modification + off-target prevention modification (represented by "d7B5" or "d7B" in the siRNA ID number rules of the present disclosure)

[0637] The conjugate with both template modification and off-target prevention modification has a significantly reduced inhibition rate on the potential off-target gene, and has a significant off-target prevention effect. For example, the inhibition rate of D01801-DV27Pd7BG101 on ADCY10 is reduced by 32.9%, which is significantly reduced; the inhibition rate of D02417-DV38Pd7B5G101 on TAGLN is reduced by 41.4%, which is significantly reduced.

[0638] Example 8: Inhibition of LPA in human primary hepatocytes by siRNA modification with template modification according to the present disclosure and the corresponding siRNA conjugate

[0639] This example determines the inhibition rate of the sequences with higher activity in Example 4 on the potential off-target genes in human primary hepatocytes, and compares it with Olpasiran. For the eight motifs B01001, B01012, B01023, B01042, B01801, B02417, B06001 and B01047, the modification templates shown in Table 17 are used for modification, and the conjugate groups are coupled to prepare the corresponding siRNA conjugates. At a concentration range of 0.03 nM to 30 nM, human primary hepatocytes are treated with these siRNA conjugates by lipofection, and the dose-effect relationship curve is fitted and the IC 50 .

[0640] 1. Experimental materials

[0641] 1) Test samples:

[0642] The conjugates in Table 17 include conjugates modified with the templates of the present application and conjugates modified with both the templates of the present application and off-target prevention modification, and the GalNAc conjugate group G103 is connected to the 3' end of the siRNA sense strand:

[0643]

[0644] The method for linking the oligonucleotide to the conjugate group G103 can refer to Example 3 of patent application CN116854754A.

[0645] The oligonucleotide forms a conjugate with the conjugate group as shown in the following scheme:

[0646] .

[0647] The specific list of each conjugate and its corresponding motif is shown in Table 17, and "G103" in siRNA ID indicates the linkage to the GalNAc conjugate group G103.

[0648] Cell type: human primary hepatocytes, provided by Livzon Biotech (Cat. No. LV-PHH001).

[0649] 2. Experimental method

[0650] qRT-PCR was used to detect the inhibition of mRNA expression of LPA gene in human primary hepatocytes by the test sample. The specific experimental materials and methods are shown in Example 1.2.2.

[0651] 3. Experimental results

[0652] The inhibition rates of siRNAs of different concentrations on LPA are shown in Table 17 below. It can be seen that they all have obvious inhibitory effect on LPA, and the IC 50 is between 0.005 nM and 0.030 nM. For example, the inhibition rate of D01023-DV25Pd7B5G103 on LPA reached 86.4% at a concentration of 30 nM, and the IC 50 is 0.016 nM. In addition, the IC 50 of some sequences is better than that of the positive control Olpasiran. For example, the IC 50 of D01023-DV25Pd7B5G103 is 0.016 nM, which is better than the 0.027 nM of the positive control.

[0653] Table 17 Inhibition rate of siRNAs of different concentrations on LPA in human primary hepatocytes and IC 50

[0654]

[0655] Example 9: Inhibition of LPA in mouse serum by the corresponding conjugate of the modifier modified by the template modified modifier of the present disclosure

[0656] The present example exemplarily selects some sequences, including siRNA motifs B01001, B01012, B01023, B01042, B01047, B01801, B02417, B06001, modifies these motifs, for example, only uses the templates of the present application for modification, or simultaneously uses the templates of the present application for modification + off-target prevention modification. The positive control is Olpasiran, which is a candidate drug currently in the clinical III stage. Using transgenic mice expressing human LPA genes, the inhibitory effect on LPA in serum at different time points was detected by ELISA.

[0657] 1. Experimental materials

[0658] Test drugs:

[0659] Each sequence in Tables 18 and 19 is a sequence modified using a template and a sequence modified using a template and an off-target prevention design, and the 3' end of the sense strand of each sequence is connected to a GalNAc conjugate group G101 or G103:

[0660] , .

[0661] The method for connecting the oligonucleotide to G101 or G103 is described in Example 3 of patent application CN116854754A.

[0662] The oligonucleotide and the conjugate group form a conjugate as shown in the following scheme:

[0663] ,

[0664] .

[0665] The specific list of each conjugate is shown in Tables 18 and 19. "G103" in the siRNA ID indicates that the sequence is connected to the GalNAc conjugate group G103, and G101 in the sequence number indicates that the sequence is connected to the GalNAc conjugate group G101. The sequence of Olpasiran is connected to the GalNAc conjugate group NAG25 (i.e. GR1) at the 5' end of the sense strand of APC-OL. The structure of the conjugate group NAG25 can be found, for example, in the disclosure of CN113507920A.

[0666] In this experiment, the motif B01047 is template-modified, off-target-preventing conjugate corresponding to the existing technology disclosed conjugate sequence Geno-1-107M (see Qian Li et al., Application of improved GalNAc conjugation in development of cost-effective siRNA therapies targeting cardiovascular diseases, Molecular Therapy, Vol. 32, No. 3, 2024) similar to the B01047 base sequence. The in vivo effect is compared.

[0667] Table 18. Conjugate design examples connecting G103

[0668]

[0669]

[0670] Table 19. Conjugate design examples connecting G101

[0671]

[0672] Solvent: sterile PBS

[0673] 2. Experimental method

[0674] 6-8 week old C57BL / 6-hLPA transgenic mice (provided by Shanghai Nanfang Model Organism Technology Co., Ltd.) were male, after entering the feeding facility and adaptive feeding for 7 days, blood was collected and serum was separated, and the content of hLPA protein in serum was detected using an ELISA kit (Abeam, ab212165), and the content of hLPA protein in serum was used as an index for random grouping, 6 in each group, and a single dose of 1 mg / kg or 0.5 mg / kg was administered to the mice subcutaneously (the day of administration was recorded as day 0, D0). After administration, the mouse serum was collected every 7 days to detect the expression of hLPA protein in serum, and the inhibition rate of hLPA protein expression was calculated according to the following formula:

[0675] Inhibition rate % = [LPA content (PBS group) - LPA content (dose group)] / LPA content (PBS group) x 100%

[0676] 3. Experimental results

[0677] Table 20. hLPA transgenic mice 1 mg / kg experiment-inhibition rate

[0678]

[0679]

[0680] As can be seen from the above table, the conjugates formed by conjugating the modifiers with the conjugating groups have significant inhibitory effect on LPA protein expression in serum after subcutaneous administration of a single dose of 1 mg / kg. For example, D01023-DV25Pd7B5G103 achieved an inhibition rate of 76.1%, 72.0% and 73.4% on day 7, day 14 and day 21, respectively.

[0681] Compared with the prior art disclosed Geno-1-107M, the corresponding conjugates D01047-DV26SPG103, D01047-DV29SPd7BG103 and D01047-DV29SPG103 of the motif B01047 of the present disclosure have significantly improved inhibitory effect in mice.

[0682] Table 21 Inhibition rate of hLPA transgenic mice 0.5 mg / kg experiment

[0683]

[0684] As can be seen from the above table, after subcutaneous administration of a single dose of 0.5 mg / kg, each conjugate has significant inhibitory effect on LPA protein expression in serum. For example, D01023-DV25Pd7B5G101 achieved an inhibition rate of 67.0%, 73.5% and 77.4% on day 7, day 14 and day 21, respectively.

[0685] The above in vivo experimental results show that the siRNA motifs of the present disclosure, such as B01001, B01012, B01023, B01042, B01047, B01801, B02417 and B06001, after being modified by the template modification of the present disclosure, or after being modified by the template + off-target prevention modification of the present disclosure, and being connected with the GalNAc conjugating group, the conjugates formed can be efficiently delivered to the liver of animals and significantly inhibit LPA expression.

[0686] Example 10: Inhibitory effect of sequences modified by the modification template of the present disclosure on LPA in serum of cynomolgus monkeys

[0687] In this example, some sequences are exemplarily selected, including siRNA motifs B01023, B01801, B02417, and these sequences are modified, for example, only by template modification, or by template modification and off-target prevention design at the same time. The positive control drug uses the siRNA drug Olpasiran which is currently in the clinical phase III. After administration in vivo of cynomolgus monkeys, ELISA is used to detect the inhibitory effect of each sequence on LPA in serum at different time points.

[0688] 1. Experimental materials

[0689] Test drug: D01023-DV25Pd7B5G101, D01801-DV27PG101, D01801-DV27Pd7BG101, D02417-DV38PG101, D02417-DV38Pd7B5G101 and positive control Olpasiran, the above 6 compounds, the specific sequence design rules are shown in Table 19. The synthesis method is shown in Example 9.

[0690] Solvent: sterile normal saline.

[0691] 2. Experimental method

[0692] 18 cynomolgus monkeys, 2.5-6 weeks old, male, weighing 2-6 kg, were introduced into the feeding facility, and after adaptive feeding for 7 days, blood was collected and serum was separated, and the LPA protein content in the serum was detected by ELISA kit (Mercodia, Cat No. 10-1106-01). The serum LPA content was used as an index for random grouping, 3 in each group, and a single dose of 1 mg / kg was subcutaneously administered (the day of administration was recorded as day 0, D0). Cynomolgus monkey serum was collected every 7 days after administration to detect the expression of LPA protein in serum, and the inhibition rate of LPA protein expression was calculated according to the following formula:

[0693] Inhibition rate % = [LPA content (before administration) - LPA content (after administration)] / LPA content (before administration) x 100%

[0694] On the 9th day before administration (Day -9) and the 28th and 53rd days after administration, the animals were anesthetized, the puncture area was disinfected with iodophor and alcohol in turn, the liver and puncture needle position were determined using a B-ultrasound instrument, the biopsy puncture needle was inserted, the liver tissue was collected, the total RNA of the liver tissue was extracted, the LPA mRNA and the mRNA of the internal reference gene GAPDH of the liver tissue were amplified by qPCR, and the inhibition rate of LPA gene mRNA expression in the liver tissue of the cynomolgus monkey was calculated according to the following formula:

[0695] ΔCT = average Ct value of target gene - average Ct value of internal reference gene;

[0696] ΔΔCT = ΔCT (after administration) - ΔCT (before administration);

[0697] Relative expression of target gene mRNA = 2 -ΔΔCT

[0698] Inhibition rate = (1 - relative expression after administration / relative expression before administration) x 100%

[0699] 3. Experimental results

[0700] Inhibition rate detection results are shown in Table 22, Figure 1 .

[0701] Table 22 Inhibition rate - serum

[0702]

[0703] As can be seen from the above table, the conjugates formed by conjugating each sequence with the GalNAc compound have a significant inhibitory effect on LPA protein expression in serum after a single dose of 1 mg / kg subcutaneous administration. For example, D01023-DV25Pd7B5G103 has an inhibition rate of 92.9% on serum LPA at day 21, and the inhibition rate on serum LPA is still 92.0% at day 70 after administration, indicating that the sequence has a long duration of efficacy in cynomolgus monkeys. Compared with the highest inhibition rate of 83.4% of the positive control, it has a significant advantage in efficacy.

[0704] The data of each group of test substances on the inhibition of LPA mRNA expression in the liver of cynomolgus monkeys is shown in Table 23 and Figure 2 .

[0705] Table 23 Inhibition rate - liver

[0706]

[0707] The results show that five test substances produced significant inhibition of LPA mRNA expression in liver tissue of cynomolgus monkeys at days 28 and 53 (D28, D53) after administration, relative to before administration (D-9). For example, D01023-DV25Pd7B5G101 has an inhibition rate of 93.4% on LPA at D28 after administration, and an inhibition rate of 95.5% at D53, which is significantly better than the inhibition rate of the positive control at the same time point (the LPA inhibition rate of the positive control Olpasiran at D28 is 62.8%, and the inhibition rate at D53 is 78.7%).

[0708] The above in vivo experiment results in cynomolgus monkeys show that the siRNA motifs of the present disclosure, such as B01023, B01801 and B02417, whether they are siRNA modifiers obtained by modification of the templates of the present disclosure, or siRNA modifiers obtained by further off-target prevention modification, can be efficiently delivered to the liver of cynomolgus monkeys after conjugation with the conjugation group, and significantly inhibit the expression of LPA gene.

Claims

1. A siRNA duplex, characterized in that, The siRNA duplex comprises a sense strand and an antisense strand forming a region of reverse complementary double strands; The siRNA duplex comprises any one or a combination of both of the following oligonucleotide duplexes paired by a sense strand and an antisense strand: (1) the sequence of the sense strand is as shown in SEQ ID NO: 21; and the sequence of the antisense strand is as shown in SEQ ID NO: 214; and, (2) the sequence of the sense strand is as shown in SEQ ID NO: 186; and the sequence of the antisense strand is as shown in SEQ ID NO:

379.

2. A siRNA duplex, characterized in that, The siRNA duplex comprises a sense strand and an antisense strand forming a region of reverse complementary double strands; The siRNA duplex comprises any one or a combination of both of the following oligonucleotide duplexes paired by a sense strand and an antisense strand: (1) the sequence of the sense strand is as shown in SEQ ID NO: 21; and the sequence of the antisense strand is as shown in SEQ ID NO: 214; and, (2) the sequence of the sense strand is as shown in SEQ ID NO: 186; and the sequence of the antisense strand is as shown in SEQ ID NO:

379.

3. A siRNA duplex, characterized in that, The siRNA duplex comprises a sense strand and an antisense strand forming a region of reverse complementary double strands; The siRNA duplex comprises any one or a combination of both of the following oligonucleotide duplexes paired by a sense strand and an antisense strand: (1) the sequence of the sense strand is as shown in SEQ ID NO: 21; and the sequence of the antisense strand is as shown in SEQ ID NO: 214; and, ， ， ， (2) the sequence of the sense strand is as shown in SEQ ID NO: 186; and the sequence of the antisense strand is as shown in SEQ ID NO:

379. The siRNA duplex comprises a sense strand and an antisense strand forming a region of reverse complementary double strands; The siRNA duplex has the following modifications: The antisense strand has any one of the following modification patterns A~F: The sense strand has any one of the following modification patterns a or b: ， wherein 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS represents that the nucleotide at this position is connected with its right adjacent nucleotide by 3',5'-phosphorothioate bond from 5' end; EVP represents 5'-vinyl-(E)-phosphonate; The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes formed by pairing of the following sense strand and antisense strand: (1) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode B, and the sense strand adopts modification mode a; (2) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand adopts modification mode E, and the sense strand adopts modification mode b; (3) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode A, and the sense strand adopts modification mode a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA; (4) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode A, and the sense strand adopts modification mode a; (5) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode C, and the sense strand adopts modification mode a; (6) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode C, and the sense strand adopts modification mode b; (7) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode D, and the sense strand adopts modification mode b; (8) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode E, and the sense strand adopts modification mode b; (9) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand is modified with modification type B, the sense strand is modified with modification type a; the 5th, 7th nucleotides of the antisense strand are replaced by DNA, and the nucleotides of the sense strand which are complementary to the 7th nucleotide of the antisense strand are also replaced by DNA; (10) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand is modified with modification type B, the sense strand is modified with modification type a; the 7th nucleotide of the antisense strand is replaced by DNA, and the nucleotides of the sense strand which are complementary to the 7th nucleotide of the antisense strand are also replaced by DNA; (11) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand is modified with modification type A, the sense strand is modified with modification type a; (12) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand is modified with modification type B, the sense strand is modified with modification type a; (13) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand is modified with modification type C, the sense strand is modified with modification type a; (14) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand is modified with modification type C, the sense strand is modified with modification type b; (15) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand is modified with modification type D, the sense strand is modified with modification type b; and, (16) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand is modified with modification type F, the sense strand is modified with modification type b.

4. A siRNA duplex, characterized in that, the siRNA duplex comprises a sense strand and an antisense strand forming a region of complementary base pairing; the siRNA duplex comprises any one or a combination of both of the following oligonucleotide duplexes: (1) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd nucleotides from the 5' terminus of the antisense strand are 2'-methoxy modified nucleotides, and the 2nd, 6th, 14th, 16th nucleotides are 2'-fluoro modified nucleotides, and the 1st, 2nd, 21st, 22nd nucleotides from the 5' terminus of the antisense strand are connected to the right adjacent nucleotide by 3', 5'- phosphorothioate linkage; the 1st, 2nd, 3rd, 4th, 5th, 6th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st nucleotides from the 5' terminus of the sense strand are 2'-methoxy modified nucleotides, and the 7th, 9th, 10th, 11th nucleotides are 2'-fluoro modified nucleotides, and the 1st, 2nd nucleotides from the 5' terminus of the sense strand are connected to the right adjacent nucleotide by 3', 5'- phosphorothioate linkage; and, (1) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd nucleotides from the 5' terminus of the antisense strand are 2'-methoxy modified nucleotides, and the 2nd, 6th, 14th, 16th nucleotides are 2'-fluoro modified nucleotides, and the 1st, 2nd, 21st, 22nd nucleotides from the 5' terminus of the antisense strand are connected to the right adjacent nucleotide by 3', 5'- phosphorothioate linkage; the 1st, 2nd, 3rd, 4th, 5th, 6th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st nucleotides from the 5' terminus of the sense strand are 2'-methoxy modified nucleotides, and the 7th, 9th, 10th, 11th nucleotides are 2'-fluoro modified nucleotides, and the 1st, 2nd nucleotides from the 5' terminus of the sense strand are connected to the right adjacent nucleotide by 3', 5'- phosphorothioate linkage.

5. A conjugate of siRNA, characterized by, The conjugate comprises the siRNA duplex as described in any one of claims 1-4, and a conjugate group attached thereto; The conjugate group is a GalNAc derivative attached using a bivalent or trivalent branched linker arm.

6. The conjugate of claim 5, wherein, The conjugate group is attached to the 3'-end or 5'-end of the sense strand of the oligonucleotide.

7. The conjugate of claim 5, wherein, The conjugate group is: ， wherein X is a hydroxyl protecting group or H, the hydroxyl protecting group is selected from acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, the amine protecting group is selected from formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer from 0 to 20; q, r and s are independently an integer from 1 to 7.

8. The conjugate of claim 7, wherein, The conjugate group is: 。 9. The conjugate of claim 5, wherein, The conjugate group is: ， wherein X is oxygen, -N(Y)- or sulfur; Y is C 1-4 alkyl or C 6-10 aryl; R1is oxygen or sulfur; R2is hydrogen, -NH2, C 1-4 alkyl, C 6-10 aryl, C 1-4 alkoxy or halogen; A is -(CH2) a -, -(CH2CH2O) b -, -((CH2) c NHCO) d - or -((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e - wherein e is an integer from 0 to 7; L is -CONH- or -NHCO-; X1is -(CH2) f - or -(CH2CH2O) f CH2- and f is an integer from 1 to 5; X2 is -(CH2) g - and g is an integer from 1 to 6; Y1is 0 or 1; Y2is 0, 1 or 2; X3 is CH2 when Y3 is 1; X3 is CH when Y3 is 2; X3 is carbon when Y3 is 3; m is an integer from 0 to 4; n is an integer from 0 to 4.

10. The conjugate of claim 9, wherein, The conjugate group is G4, G5, G6, or G7, which has the following structure: ， ， ， 。 11. The conjugate of claim 5, wherein, The conjugate has any one of the following structures: ， ， ， , and 。 12. The conjugate of claim 5, wherein, The conjugate group is: ， X is oxygen, -N(Y)-, or sulfur; Y is C 1-4 alkyl or C 6-10 aryl; R1 is oxygen or sulfur; R2is hydrogen, -NH2, C 1-4 alkyl, C 6-10 aryl, C 1-4 alkoxy or halogen; A is -(CH2) a -, -(CH2CH2O) b -, -((CH2) c NHCO) d - or -((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e - wherein e is an integer from 0 to 7; L is -CONH- or -NHCO-; X1is -(CH2) f - or -(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2is -(CH2) g - and g is an integer from 1 to 6; X3 is oxygen or sulfur; Y1 is 0 or 1; Y2 is 0, 1, or 2; X4 is CH2 when Y3 is 1; X4 is CH when Y3 is 2; X3 is carbon when Y3 is 3; m is an integer from 0 to 4; n is an integer from 0 to 4; q is an integer from 0 to 4.

13. The conjugate of claim 12, wherein, The conjugate group is G101, G102, G103, G105, or G106: , , , , or .

14. The conjugate of claim 13, wherein, The conjugate has any one of the following structures: ， ， ， or 。 15. The conjugate of claim 5, wherein, The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of a sense strand and an antisense strand pair: (1) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode B, and the sense strand adopts modification mode a; (2) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 186; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 379; wherein the antisense strand adopts modification mode E, and the sense strand adopts modification mode b; (3) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode A, and the sense strand adopts modification mode a; the 5thand 7thnucleotides of the antisense strand are replaced with DNA, and the nucleotide at the position complementary to the 7thnucleotide of the antisense strand in the sense strand is also replaced with DNA; (4) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode A, and the sense strand adopts modification mode a; (5) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode B, and the sense strand adopts modification mode a; the 5thand 7thnucleotides of the antisense strand are replaced with DNA, and the nucleotide at the position complementary to the 7thnucleotide of the antisense strand in the sense strand is also replaced with DNA; and, (6) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand adopts modification mode B, and the sense strand adopts modification mode a; the 5thand 7thnucleotides of the antisense strand are replaced with DNA, and the nucleotide at the position complementary to the 7thnucleotide of the antisense strand in the sense strand is also replaced with DNA. (6) the sense strand is a modified sequence of the sequence set forth in SEQ ID NO: 21; and the antisense strand is a modified sequence of the sequence set forth in SEQ ID NO: 214; wherein the antisense strand is modified with modification type B, and the sense strand is modified with modification type a; the 7th nucleotide of the antisense strand is replaced by DNA, and the nucleotide of the sense strand which is complementary to the 7th nucleotide of the antisense strand is also replaced by DNA; wherein either one or both of the sense strand and the antisense strand is linked to a conjugate group G4, G5, G6, G7, G101, G102, G103, G105, or G106.

16. The conjugate of claim 15, wherein, the conjugate group is linked to the 3' end of the sense strand.

17. A nucleic acid protein complex, characterized in that, the nucleic acid protein complex comprises the double-stranded region of the siRNA duplex as described in any one of claims 1-4, and a nuclease; or, the nucleic acid protein complex comprises the antisense strand of the double-stranded region of the siRNA duplex as described in any one of claims 1-4, and a nuclease; the nuclease is an AGO protein.

18. A pharmaceutical composition, characterized by, the pharmaceutical composition comprises the siRNA duplex as described in any one of claims 1-4, the conjugate as described in any one of claims 5-16, or the nucleic acid protein complex as described in claim 17, and a pharmaceutically acceptable carrier.

19. Use of the siRNA duplex as described in any one of claims 1-4, the conjugate as described in any one of claims 5-16, the nucleic acid protein complex as described in claim 17, or the pharmaceutical composition as described in claim 18, in the preparation of a medicament for preventing or treating a disease associated with LPA gene expression. the disease associated with LPA gene expression is a cardiovascular and cerebrovascular disease caused by overexpression of Apo(a) protein.

20. The use of claim 19, wherein, the cardiovascular and cerebrovascular disease is atherosclerosis.

Images