Yungu sterility related rpl16 gene and application thereof

By overexpressing the Yugu rpl16 gene in rice, male sterility of rice is achieved, and the problems of long breeding cycle and low efficiency are solved. A new male sterile rice has been created, which has improved breeding efficiency and provided more options for hybrid rice breeding.

CN120118921AActive Publication Date: 2025-06-10JIANGSU ACAD OF AGRI SCI

Patent Information

Application Number
CN202510586627.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-08
Publication Date
2025-06-10
Estimated Expiration
2045-05-08

AI Technical Summary

Technical Problem

The prior art has problems of long breeding cycles and low efficiency in hybrid breeding of genus Wolftail, and lacks effective gene resources related to male sterility.

Method used

By overexpressing the Rpl16 gene associated with Yugu in rice, pollen abortion is caused and male sterility of rice is achieved, thereby shortening the breeding cycle and improving breeding efficiency.

Benefits of technology

A new male sterile rice was successfully created, which significantly shortened the breeding cycle, improved breeding efficiency, and provided more options for hybrid rice breeding, helping to cultivate new varieties of high-yield and high-quality rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118921A_ABST
    Figure CN120118921A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to a Yu-grain rpl16 gene and application thereof, in particular to application of the rpl16 gene in cultivation of a rice sterile line. Overexpression of the Yu-grain rpl16 gene in rice can cause rice pollen abortion, so that rice male sterility is realized, the breeding period is shortened, the breeding efficiency is improved, and theoretical guidance is provided for culturing a new male sterility line.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a pearl millet rpl16 gene and its application. Background Art

[0002] Pearl millet (Pennisetum glaucum (L.) R.Br) is an annual herb of the genus Pennisetum in the family Poaceae. It is native to north-central Africa and is the sixth largest cereal crop in the world. The essential amino acid and unsaturated fat content in pearl millet grains are higher than those in corn and millet. The stem has a high soluble sugar content and good palatability. Using pearl millet sterile lines 'Tift23A' and 'Tift23DA' as female parents, only 2 interspecific hybrids of the genus Pennisetum that have passed national approval are available, namely 'Ningza No. 3' Pennisetum americanum and 'Ningza No. 4' Pennisetum americanum. Using pearl millet sterile line 'Tift23A' as the female parent and elephant grass as the male parent, 2 three-line compatible interspecific hybrids have been developed: 'Hybrid Pennisetum' and 'Bond No. 1' Hybrid Pennisetum. The above 4 three-line compatible intra-specific and inter-specific hybrids of the genus Pennisetum can be used for commercial seed production and all have obvious heterosis. However, since the current national-approved three-line compatible hybrid seed production of the genus Pennisetum mainly uses imported pearl millet sterile lines, it has become a "bottleneck" problem in the hybrid breeding of the genus Pennisetum.

[0003] The anther is the male reproductive organ of a plant, and the normal development of the anther is crucial for plant flowering and seed formation. Mitochondria are the energy factories of plant cells. Deletion, recombination or rearrangement of mitochondrial genes will cause cytoplasmic male sterility. Defects in mitochondrial functional genes usually affect plant respiratory metabolism and then affect reactive oxygen species metabolism. Excessive accumulation or reduction of reactive oxygen species will lead to abnormal programmed death of the tapetum, resulting in pollen abortion. Deletion, recombination or rearrangement of mitochondrial genes may all cause cytoplasmic male sterility. Therefore, exploring sterile genes is of great significance for the creation of sterile materials.

[0004] As a monocotyledonous model plant, rice has a highly efficient genetic transformation system. Transgenic rice can be obtained in 2-3 months, and its genetic background is clear, which can exclude the interference of environmental or epigenetic factors, directly clarify the function of genes, improve the repeatability of experiments, and facilitate phenotypic observation and analysis. Therefore, conducting research on the function of sterile-related genes in the model plant rice first can quickly analyze gene functions in a low-cost, high-efficiency, and highly reliable manner, and rely on mature resources and platforms to quickly transform theory into application. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide a pearl millet sterile-related rpl16(Ribosomal protein L16-like) gene and its applications. The pearl millet rpl16 gene overexpressed in rice results in pollen abortion in rice, thus achieving male sterility in rice, shortening the breeding cycle, improving breeding efficiency, and providing theoretical guidance for cultivating new male sterile germplasms of gramineous plants.

[0006] The present invention is achieved through the following technical solutions:

[0007] In the first aspect, the present invention first provides a use of a pearl millet sterility-related rpl16 gene.

[0008] In a specific embodiment, the present invention provides rpl16 the gene for any one of the following applications (A1)-(A8):

[0009] (A1) Application in reducing plant pollen viability;

[0010] (A2) Application in preparing a product for reducing plant pollen viability;

[0011] (A3) Application in reducing the number of plant spikelets;

[0012] (A4) Application in preparing a product for reducing the number of plant spikelets;

[0013] (A5) Application in reducing the number of grains per plant spike;

[0014] (A6) Application in preparing a product for reducing the number of grains per plant spike;

[0015] (A7) Application in cultivating plant male sterile lines;

[0016] (A8) Application in preparing a product for cultivating plant male sterile lines.

[0017] In a specific embodiment, the plant is a cereal crop.

[0018] In a more specific embodiment, the cereal crop is rice, plants of the genus Pennisetum, etc., more specifically rice, pearl millet, etc.

[0019] The rpl16 gene is any one of the following genes:

[0020] 1) The gene with the nucleotide sequence shown in SEQ ID No.1;

[0021] 2) A gene having 75% or more identity with the nucleotide sequence defined in 1);

[0022] 3) A gene that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions.

[0023] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity to the nucleotide sequences of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences. The above-mentioned identity of 75% or more can be 80%, 85%, 90% or 95% or more identity.

[0024] By overexpressing rpl16 genes, male sterile rice lines were directly obtained, avoiding the multi-generation self-crossing and backcrossing processes of traditional cross-breeding, significantly shortening the breeding cycle, and improving the breeding efficiency.

[0025] rpl16 Successful overexpression of genes created new male sterile rice lines, enriching the types of male sterile rice lines and providing more choices for hybrid rice breeding, which helps to cultivate new high-yield and high-quality rice varieties.

[0026] In a second aspect, the present invention also provides the use of biological materials related to the aforementioned genes in any one of the following (A1)-(A8):

[0027] (A1) Use in reducing the pollen viability of plants;

[0028] (A2) Use in preparing products for reducing the pollen viability of plants;

[0029] (A3) Use in reducing the spikelet number of plants;

[0030] (A4) Use in preparing products for reducing the spikelet number of plants;

[0031] (A5) Use in reducing the grain number per spike of plants;

[0032] (A6) Use in preparing products for reducing the grain number per spike of plants;

[0033] (A7) Use in cultivating plant sterile lines;

[0034] (A8) Use in preparing products for cultivating plant sterile lines.

[0035] In a specific embodiment, the plant is a cereal crop.

[0036] In a more specific embodiment, the cereal crop is rice, Pennisetum plants, etc., more specifically rice, pearl millet, etc.

[0037] In a specific embodiment, the biomaterial is any one of the following:

[0038] (B1) The protein encoded by the aforementioned gene;

[0039] (B2) An expression cassette containing the aforementioned gene;

[0040] (B3) A recombinant vector containing the aforementioned gene, or a recombinant vector containing the expression cassette described in (B2);

[0041] (B4) A recombinant microorganism containing the aforementioned gene, or a recombinant microorganism containing the expression cassette described in (B2), or a recombinant microorganism containing the recombinant vector;

[0042] (B5) A transgenic plant cell line containing the aforementioned gene, or a transgenic plant cell line containing the expression cassette described in (B2);

[0043] (B6) A transgenic plant tissue containing the aforementioned gene, or a transgenic plant tissue containing the expression cassette described in (B2);

[0044] (B7) A transgenic plant organ containing the aforementioned gene, or a transgenic plant organ containing the expression cassette described in (B2).

[0045] In a specific embodiment, the protein is any one of the following proteins:

[0046] (C1) A protein with an amino acid sequence as shown in SEQ ID No. 2;

[0047] (C2) A fusion protein obtained by linking a tag protein to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2;

[0048] (C3) A protein with the same function obtained by substituting and / or deleting and / or adding one or several amino acid residues to the amino acid sequence shown in SEQ ID No. 2;

[0049] (C4) A protein with 75% or more homology to the amino acid sequence shown in SEQ ID No. 2 and having the same function.

[0050] To facilitate the purification or detection of the protein in (C1), a tag protein can be linked to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2.

[0051] In a specific embodiment, the tag protein includes, but is not limited to: GST (glutathione S-transferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, EGFP (enhanced green fluorescent protein), ECFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein), or AviTag tag protein.

[0052] In a more specific embodiment, the present invention uses EGFP as the tag protein.

[0053] In a specific embodiment, in the above (C3), the substitution and / or deletion and / or addition of one or several amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0054] In a specific embodiment, in the above (C3), the protein can be artificially synthesized, or its coding gene can be first synthesized and then obtained by biological expression.

[0055] In a specific embodiment, in the above (C3), the coding gene of the protein can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID No.1, and / or performing a missense mutation of one or several base pairs, and / or ligating the coding sequence of the tag protein shown above at its 5′ end and / or 3′ end.

[0056] In a specific embodiment, "homology" includes amino acid sequences having 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 95% or higher homology with the amino acid sequence shown in SEQ ID No.2 of the present invention.

[0057] In a specific embodiment, the vector is well-known to those skilled in the art and can be a plasmid, cosmid, phage, or viral vector, etc. In the present invention, pEXT06 / g is used as the vector.

[0058] In a specific embodiment, the microorganism can be a fungus or a bacterium, such as Escherichia coli, Agrobacterium, etc. More specifically, it can be Escherichia coli DH5α, Agrobacterium EHA105.

[0059] In a third aspect, the present invention provides a method for cultivating a plant sterile line, which is achieved by increasing the expression level of a rpl16 gene in a target plant, and the rpl16 nucleotide sequence of the gene is as shown in SEQ ID No.1.

[0060] In a fourth aspect, the present invention provides a method for reducing plant pollen vigor, the method comprising increasing rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0061] In a fifth aspect, the present invention provides a method for reducing the number of spikelets in a plant, the method comprising increasing rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0062] In a sixth aspect, the present invention provides a method for reducing the number of grains per ear in a plant, the method comprising increasing rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0063] In a specific embodiment, the plant is a cereal crop.

[0064] In a more specific embodiment, the cereal crop is rice, Pennisetum plant, etc., more specifically rice, pearl millet, etc.

[0065] Beneficial Effects

[0066] A method for treating royal millet sterility provided by the present invention rpl16 Compared with the prior art, the gene and its application have the following beneficial effects:

[0067] 1. Shorten the breeding cycle and improve breeding efficiency. rpl16 Gene, directly obtain male sterile rice, avoiding the multi-generation self-pollination and backcrossing process of traditional hybrid breeding, significantly shortening the breeding cycle and improving breeding efficiency.

[0068] 2. Provide new genetic resources and enrich the types of sterile lines. rpl16 Gene overexpression has successfully created new male sterile rice lines, enriched the types of rice male sterile lines, provided more options for hybrid rice breeding, and helped to cultivate new high-yield, high-quality rice varieties.

[0069] 3. The identification method is simple and the results are stable and reliable. The male sterile rice identification method of the present invention detects the amplification and sequencing of the identification primers through positive plant sequences, is simple to operate, and the results are stable and reliable. It is suitable for large-scale application in laboratories and fields, ensuring the accuracy and success rate of breeding.

[0070] 4. The present invention can reduce the work of emasculation, lower the labor intensity, save human resources and time costs, and improve the economic benefits of breeding. Brief Description of the Drawings

[0071] Figure 1 : rpl16 Schematic diagram of overexpression vector.

[0072] Figure 2 : Gel electrophoresis of overexpressed pearl millet rpl16 gene in rice, where ddH 2 O and wild type (WT) are negative controls, and M is DNA marker.

[0073] Figure 3 : Detection of pearl millet rpl16 gene expression level in transgenic rice lines.

[0074] Figure 4 : Anthers and anther viability of overexpressed pearl millet rpl16 gene in rice; among them, Figure 4 Figure A in Figure 4 is the anther of WT, Figure 4 Figure B in Figure 4 is the anther of transgenic rice;

[0075] Figure 5 : Spikelet number and grain number per panicle of overexpressed pearl millet rpl16 gene in rice; among them, Figure 5 Figure A in Figure 5 shows the spikelet phenotypes of WT and OE, Figure 5 Figure B in Figure 5 is the bar chart of spikelet numbers of WT and OE, Detailed Description of the Embodiments

[0076] The present invention will be further described in detail below through examples. The following examples are only used to illustrate the present invention and do not limit the scope of the present invention. Reagents or equipment not indicating the manufacturer are regarded as conventional products that can be purchased on the market.

[0077] Competent Escherichia coli DH5α, restriction enzyme PstⅠ and other enzymes, and pESI-blunt cloning vector were purchased from Yeasen Biotechnology (Shanghai) Co., Ltd.; the expression vector used was pEXT06 / g, and competent Agrobacterium tumefaciens EHA105 was purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.

[0078] Example 1 Gene Cloning and Vector Construction

[0079] Take the inflorescence of the pearl millet sterile line '23A', and extract the pearl millet mitochondrial genome (mtDNA) using the bioolook plant mitochondrial DNA extraction kit. Use the mtDNA as rpl16 the gene cloning template. According to the mitochondrial genome rpl16 gene sequence of the pearl millet sterile line '23A', use the Bio XM2.7 software to design primer sequences (5'→3') with restriction enzyme sites:

[0080] rpl16-F: cctgttgtttggtgttacttctgcagATGTCAGTTTCGTTATTACA, as shown in SEQ ID NO.3;

[0081] rpl16-R: tcctcgcccttgctcaccatacGGTTTTTAGTGGTATTCC, as shown in SEQ ID NO.4.

[0082] For PCR amplification, use the 2× Hieff Canace® Advance Fast PCR Master Mix(With Dye) high-fidelity enzyme premix from Yeasen Biotech Co., Ltd. The reaction conditions are: 98 °C, 30 s; 98 °C, 10 s, 60 °C, 5 s, 72 °C, 10 s; 35 cycles; 72 °C, 2 min. The reaction system is shown in Table 1.

[0083] Table 1 PCR reaction system

[0084] Detect the PCR products by 1% agarose gel electrophoresis. Cut out the bands with the correct size, recover the target fragments using the gel extraction kit (OMEGA Gel Extraction Kit, product number: D2500-01), and linearize the expression vector pEXT06 / g. Connect the gene fragment with homologous arms rpl16 to the Agrobacterium expression plasmid pEXT06 / g through the cloning reagent Hieff Clone® Universal II One Step Cloning Kit. Transfer the ligation product into DH5α competent cells and identify the positive clones by PCR. Select the pEXT06 / g universal primers:

[0085] HYG-F1: CAAAGATCGTTATGTTTATCGGCACT, as shown in SEQ ID NO.5;

[0086] HYG-R1: TTGGCGACCTCGTATTGGGAA, as shown in SEQ ID NO.6.

[0087] Ten monoclonal colonies were identified by PCR for positivity, and finally the positive recombinant plasmid pEXT06 / g- rpl16 () Figure 1 ). Using the mtDNA of pearl millet as a template, a fragment with a length of approximately 600 bp was amplified, and its sequence was verified by sequencing to obtain the rpl16 sequence. rpl16 The full length of the gene is 558 bp (shown in SEQ ID NO.1), encoding 185 amino acids (shown in SEQ ID NO.2). Multiple sequence alignment and phylogenetic tree analysis of rpl16 showed that rpl16 is most closely related to maize, Aegilops tauschii and wheat; domain analysis of it found that rpl16 the amino acid sequence includes 1 CRAL_TRIO_N domain and 1 FA domain. The CRAL-TRIO domain exists in GTPase-activating proteins (GAPs), guanine nucleotide exchange factors and a series of hydrophobic ligand-binding proteins.

[0088] Example 2 Transformation of rice with the rpl16 gene and identification of its positive seedlings

[0089] (1) Transformation of Agrobacterium with the plasmid. The pEXT06 / g- rpl16 plasmid was transformed into competent Agrobacterium EHA105 according to the instructions. After transformation, 1 mL of LB liquid medium without resistance was added to the competent cells. After mixing, the cells were cultured on a shaker at 28 °C for 1-2 h, then centrifuged to obtain the precipitate, and the precipitate was evenly spread on an LB+Kan+Rif (rifampicin) resistant culture plate and cultured in an incubator at 28 °C for 2-3 days. After the bacteria grew, single colonies were picked onto an LB+Kan+Rif (rifampicin) liquid medium and cultured with gentle shaking for 12 h, and then the bacterial liquid was subjected to PCR verification. The bacterial liquid with the verified positive band was cultured with vigorous shaking, and 0.5 mL of the bacterial liquid was taken and mixed with 0.5 mL of 50% glycerol and stored at -80 °C for later use. The process of Agrobacterium transformation and adding liquid must be sterile throughout.

[0090] (2)Rice genetic transformation. The rice genetic transformation system was carried out according to the method in the literature (Toki S, Hara N, Ono K, Onodera H, Tagiri A, Oka S, Tanaka H. Early infection of scutellum tissue with Agrobacterium allows high - speed transformation of rice. The Plant Journal. 2006, 47(6):969 - 76), and the medium formula is shown in Table 2. Select healthy seeds of wild - type rice (Nipponbare), remove the seed coat, soak them in 70% ethanol for 1 min, wash them once with sterile deionized water, disinfect them with 2.5% NaClO for 15 min, wash them 3 times with sterile water, and dry them with sterile filter paper. Inoculate the seeds on the N6D solid medium, and culture them under light at 27 °C. After the seeds grow callus with a diameter of about 0.5 cm, carry out Agrobacterium transformation. rpl16 For the Agrobacterium tumefaciens strain EHA105 carrying the pEXT06 / g -

[0091] plasmid, adjust the concentration to OD600 = 0.1, centrifuge at 5000 rpm for 10 min, resuspend the cells with the LB + 20 mg / L AS resuspension solution, soak the callus with the resuspended cells for 10 min, then pour out the liquid, dry the surface of the callus with sterile filter paper, and place it on the 2N6 - AS medium padded with sterile filter paper. Co - culture at 25 °C in the dark for 3 days. Wash the co - cultured seeds 6 times with sterile deionized water, wash them 2 times with 200 mg / L ticarcillin in sterile water, dry the surface water and Agrobacterium with sterile filter paper, and place them on the N6D - 50 solid medium with hygromycin. Culture in the dark at 27 °C for 10 - 15 days to screen the callus. Inoculate the positive callus onto the RE–III medium, culture it under light at 27 °C for 20 days. After the shoots with a length of 2 - 5 cm are differentiated, inoculate them onto the HF medium for rooting. After the roots grow, acclimatize the seedlings for 2 - 3 days and then transplant them into the sterilized nutrient soil (Pindstrup, Denmark) + loess matrix for propagation. Only take one plant from each cluster of regenerated seedlings as a strain for subsequent propagation, and finally 5 resistant strains were obtained. rpl16 For the transgenic positive seedling verification, extract the gDNA from the leaves of the regenerated seedlings of the rice strains by the CTAB method, and use

[0092] the gene primer plus the vector primer as the primer for detecting positive plants:

[0093] F: ACATCGCATCAACCTGGGAG, as shown in SEQ ID NO.7;

[0094] Send the amplified target band (528 bp) to the company for sequencing verification.

[0095] Table 2 Formulation of rice transformation medium

[0096]

[0097] Extract rice leaf RNA using the Omega Plant RNA Extraction Kit R6827-01 for expression level detection. The total RNA extraction and qRT-PCR methods were carried out according to the methods in the literature (Zhang X, Xing R, Ding Y, Yu J, Wang R, Li X, Yang Z, Zhuang L. Overexpression of gibberellin 2-oxidase 4 from tall fescue affected plant height, tillering and drought tolerance in rice. Environmental and Experimental Botany. 2023, 205: 105118), select eEF-1α as the internal reference gene for rice, and perform 2 technical replicates for each biological replicate. The formula for calculating gene expression level is: .

[0098] eEF-1α-Forward: TTTCACTCTTGGTGTGAAGCAGAT, as shown in SEQ ID NO.9;

[0099] eEF-1α-Reverse: GACTTCCTTCACGATTTCATCGTAA, as shown in SEQ ID NO.10.

[0100] The results are as Figure 2 shown. Using the wild type (WT) and the plasmid as controls, target bands (528 bp) could be amplified from all 5 resistant strains, which were named OE1 - OE5 respectively, while the WT did not amplify the target band. Send the amplified target band to the company for sequencing verification to obtain 5 transgenic positive lines. Extract the total RNA of WT and 5 transgenic rice leaf lines for expression level detection. The results show that: the gene expression level of the transgenic rice lines rpl16 is significantly higher than that of WT. Among them, the gene expression level in OE1 is rpl16 119.40 times higher than that of WT ( Figure 3 ).

[0101] Example 3 Analysis of transgenic anthers, pollen viability and panicle morphology

[0102] The obtained transgenic positive rice plants and wild-type rice plants (control group) were cultivated under the same conditions. After the positive plants completed heading, the tiller number, plant height, spikelet number, and grain number per spike were counted. During the anthesis stage, the pollen viability was counted using the iodine-potassium iodide staining method, and the anther development was observed under a microscope.

[0103] Iodine-potassium iodide staining method: Take spikes with fully developed pollen. Take 2-3 florets from each spike and place them in 70% alcohol. During observation, use forceps to take out the anthers and place them on a glass slide. Add 1-2 drops of 1% iodine-potassium iodide solution, mix the anthers and mash them, cover with a cover glass, and then observe and count under a microscope. Pollen grains stained blue and round are counted as fertile pollen, while those stained very lightly or incomplete and shrunken are counted as sterile pollen. A total of 10 anthers were examined for each individual plant.

[0104] Detection of anthers and pollen viability of WT and OE1 showed that WT anthers were very plump and light yellow, while the anthers of the rice transgenic line were white ( Figure 4 Figures A and B in Figure 4 ); WT pollen grains were round and plump, while the pollen grains of the OE line were small and irregular in shape ( rpl16 Figures C and D in Figure 5 ). Detection of pollen viability showed that the pollen viability of OE was significantly lower than that of WT during this period. The pollen viabilities of WT and OE were 40.19% and 7.69% respectively. Cultivated under the same conditions, the panicles of the two groups of rice plants were observed during fruiting. The results showed that there was no obvious difference in the panicle type between the two, but the spikelet number and grain number per spike of the OE plants were significantly lower than those of the wild type, and the sterility rate reached 96.8%, indicating that overexpression of

[0105] In summary, in this study, rpl16 gene was cloned from the mitochondria of the pearl millet sterile line, rpl16 which belongs to the mitochondrial ribosomal protein gene, encodes the large subunit of ribosomal protein, is 558 bp in full length, and encodes 186 amino acids. rpl16 The amino acid sequence includes 1 CRAL_TRIO_N domain and 1 FA domain. Through Agrobacterium-mediated genetic transformation, a transgenic line with overexpression of rpl16 in rice was obtained; compared with WT, the anthers and pollen of the transgenic line were abnormally shaped. Overexpression of rpl16 led to a significant decrease in pollen viability of the transgenic line, a significant reduction in spikelet number and grain number per spike, resulting in rice sterility.

[0106] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. rpl16 The gene is used in any of the following (A1)-(A8): (A1) Application in reducing the viability of rice pollen; (A2) Use in the preparation of a product for reducing the viability of rice pollen; (A3) Application in reducing the number of rice spikelets; (A4) Use in the preparation of a product for reducing the number of rice spikelets; (A5) Application in reducing the number of grains per panicle of rice; (A6) Use in the preparation of a product for reducing the number of grains per rice ear; (A7) Application in breeding sterile rice lines; (A8) Use in the preparation of products for breeding sterile rice lines; Said rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: Said rpl16 The gene comes from the corn.

3. As described in claim 1 rpl16 Gene-related biological materials are used in any of the following (A1)-(A8): (A1) Application in reducing the viability of rice pollen; (A2) Use in the preparation of a product for reducing the viability of rice pollen; (A3) Application in reducing the number of rice spikelets; (A4) Use in the preparation of a product for reducing the number of rice spikelets; (A5) Application in reducing the number of grains per panicle of rice; (A6) Use in the preparation of a product for reducing the number of grains per rice ear; (A7) Application in breeding sterile rice lines; (A8) Use in the preparation of products for breeding sterile rice lines; in, The biological material is any one of the following: (B1) As stated in claim 1 rpl16 The protein encoded by the gene; (B2) containing the substance described in claim 1 rpl16 expression cassette of the gene; (B3) containing the substance described in claim 1 rpl16 A recombinant vector of a gene, or a recombinant vector containing the expression cassette described in (B2); (B4) containing the substance described in claim 1 rpl16 A recombinant microorganism containing a gene, or a recombinant microorganism containing the expression cassette described in (B2), or a recombinant microorganism containing the recombinant vector described in (B2); (B5) containing the substance described in claim 1 rpl16 A transgenic plant cell line expressing the gene, or a transgenic plant cell line containing the expression cassette of (B2); (B6) containing the substance described in claim 1 rpl16 A transgenic plant tissue containing the gene, or a transgenic plant tissue containing the expression cassette described in (B2); (B7) containing the substance described in claim 1 rpl16 A transgenic plant organ containing the gene, or a transgenic plant organ containing the expression cassette of (B2); Said rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

4. The use according to claim 3, characterized in that In said (B1), the amino acid sequence of the protein is shown in SEQ ID No.

2.

5. The use according to claim 3, characterized in that: In (B3), the backbone vector of the recombinant vector is pEXT06 / g.

6. The use according to claim 3, characterized in that: In the above (B4), the microorganism is Escherichia coli or Agrobacterium.

7. A method for cultivating a rice sterile line, characterized in that: The method improves the rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

8. A method for reducing the viability of rice pollen, characterized in that: The method improves the rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

9. A method for reducing the number of rice spikelets, characterized in that: The method improves the rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

10. A method for reducing the number of grains per rice ear, characterized in that: The method improves the rpl16 The expression level of the gene is achieved, rpl16 The nucleotide sequence of the gene is shown in SEQ ID No.1.

Citation Information

Patent Citations

  • Application of male sterility gene OsLAP5 and method for recovering rice male sterility

    CN104313034A

  • Application of male-sterility gene OsGEN and method for restoring fertility

    CN105950651A

  • Application of male sterility gene OsDPW2 and rice sterility recovery method

    CN106011167A

  • Rice male sterility gene NSM1 and application thereof

    CN112522288A

  • Application of rice OsRHD1-3 gene in regulation and control of rice pollen fertility

    CN115896084A

Cited By

  • AsMYB19 gene and application thereof

    CN122128322A