Soybean GmPO1 gene and application of protein encoded by soybean GmPO1 gene in regulation and control of content of grease and / or protein

By cloning and utilizing the soybean GmPO1 gene, building knockout vectors and performing genetic transformation, the problem that traditional breeding methods are difficult to increase soybean protein and reduce oil and fat content is solved, and the protein content of soybean seeds is increased and the oil and fat content is reduced, providing new genetic resources and strategies for soybean breeding.

CN120118948APending Publication Date: 2025-06-10SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510404319.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2025-06-10

AI Technical Summary

Technical Problem

Traditional soybean breeding methods are difficult to effectively increase the protein and fat content of soybean seeds, especially in balancing the relationship between fat and protein content.

Method used

By cloning and studying the soybean GmPO1 gene and its encoding protein, the GmPO1 gene knockout vector was constructed, and it was introduced into soybean through Agrobacterium-mediated genetic transformation technology, resulting in an increase in protein content and a decrease in oil content.

Benefits of technology

The significant increase in protein content of soybean seeds and a significant reduction in oil content have been achieved, providing a key genetic resource for regulating soybean oil and protein content, and providing a new strategy for soybean breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005340698530000081
    Figure BDA0005340698530000081
  • Figure BDA0005340698530000091
    Figure BDA0005340698530000091
  • Figure BDA0005340698530000092
    Figure BDA0005340698530000092
Patent Text Reader

Abstract

The invention discloses an application of a soybean GmPO1 gene and an encoded protein thereof in regulating and controlling the content of grease and / or protein, the CDS sequence of the soybean GmPO1 gene is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein of the soybean GmPO1 gene is shown as SEQ ID NO.2. The invention further discloses a preparation method of the soybean GmPO1 gene and an application of the soybean GmPO1 gene and the encoded protein of the soybean GmPO1 gene in regulating and controlling the content of grease and / or protein. The invention discloses the biological function of the soybean GmPO1 gene in regulating and controlling the oil content and the protein content of leguminous plants for the first time, valuable gene resources and theoretical basis are provided for breeding of leguminous crops, the soybean GmPO1 gene can be widely applied to high-yield and high-quality breeding of leguminous crops, and seeds with high protein content and low oil content can be obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology, and particularly relates to the application of soybean GmPO1 gene and its encoded protein in regulating soybean oil content and protein content. Background Art

[0002] Soybean (Glycine max) is an important crop for both food and oil, as well as forage. It was domesticated from wild soybean (Glycine soja Sieb. & Zucc.) in East Asia about 6000 - 9000 years ago. The domestication and improvement of soybean have made it the most important dual - function crop providing high - value seed protein and oil, and these two together constitute its high economic value. Soybean seeds contain about 40% protein and 20% oil, accounting for nearly 60% of the global oilseed production and more than 25% of the global food and animal feed protein consumption, making it a major cash crop for vegetable oil and protein production.

[0003] With the increase in population and the demand for soybean products, increasing food production is crucial in soybean breeding. The protein and oil content in soybean seeds are key factors determining soybean quality and economic value. The changes in protein and oil content are mainly achieved by the diversification of some protein or oil synthesis regulatory genes. Seed oil and seed protein have always been the ideal targets in modern soybean breeding practices. However, traditional breeding methods have limitations in improving these traits. Therefore, it is crucial to identify the key genes regulating protein and oil content in soybean, analyze the genetic mechanisms defining soybean oil and protein content, especially the genetic network balancing the relationship between oil and protein content. This will also promote in - depth understanding of the regulatory mechanism of soybean seed protein and oil, and at the same time provide important gene resources, breeding materials and molecular design schemes for soybean quality improvement and molecular design breeding. Summary of the Invention

[0004] The object of the present invention is to provide an application of soybean GmPO1 gene and its encoded protein, and the GmPO1 gene and its encoded protein can be used to increase soybean protein content and reduce soybean oil content.

[0005] In the first aspect of the present invention, there is provided an application of soybean GmPO1 gene in reducing the oil content and / or increasing the protein content of leguminous plants, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein with an amino acid sequence as shown in SEQ ID NO.2.

[0006] In a second aspect of the present invention, there is provided the use of the encoded protein of the soybean GmPO1 gene in reducing the oil content and / or increasing the protein content of leguminous plants, wherein the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2.

[0007] In a third aspect of the present invention, there is provided the use of a soybean GmPO1 gene knockout vector in reducing the oil content and / or increasing the protein content of leguminous plants, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein with an amino acid sequence as shown in SEQ ID NO.2.

[0008] In some of these embodiments, the vector is a plasmid, preferably the plasmid is Escherichia coli.

[0009] In a fourth aspect of the present invention, there is provided the use of Agrobacterium carrying the soybean GmPO1 gene knockout vector in reducing the oil content and / or increasing the protein content of leguminous plants, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein with an amino acid sequence as shown in SEQ ID NO.5.

[0010] In a fifth aspect of the present invention, there is provided a method for increasing the protein content of leguminous plants, comprising the following steps: constructing the soybean GmPO1 gene knockout vector to disable the function of the encoded protein of the soybean GmPO1 gene;

[0011] contacting and transfecting a biological agent carrying the soybean GmPO1 gene knockout vector with leguminous plants.

[0012] In a sixth aspect of the present invention, there is provided a method for reducing the oil content of leguminous plants, comprising the following steps: constructing a soybean GmPO1 gene knockout vector to disable the function of the encoded protein of the soybean GmPO1 gene; contacting and transfecting a biological agent carrying the soybean GmPO1 gene knockout vector with leguminous plants.

[0013] In some of these embodiments, the leguminous plants are plants of the subfamily Papilionoideae, preferably soybean, peanut, broad bean, mung bean, adzuki bean, pea, cowpea, kidney bean.

[0014] In some of these embodiments, the knockout target of the GmPO1 gene is as shown in SEQ ID NO.5.

[0015] In some of these embodiments, constructing the soybean GmPO1 gene knockout vector comprises the following steps:

[0016] Using the pHLW-gRNA-tRNA vector as a template, SEQ ID NO.6 and SEQ ID NO.7 as primers for PCR amplification and purification, digesting the PCR product and the pPTG-gRNA-Cas9 vector plasmid, ligating the digested products after circular digestion, transforming into plasmids, picking positive clones and extracting plasmids to obtain the product.

[0017] In the seventh aspect of the present invention, there is provided the use of the soybean GmPO1 gene or its encoded protein in the breeding of leguminous plants for reducing oil content and / or increasing protein content, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein with an amino acid sequence as shown in SEQ ID NO.2.

[0018] In the present invention, through the study of the GmPO1 gene cloned from soybeans, it was found that a knockout vector containing the knockout of the GmPO1 gene (CDS sequence as shown in SEQ ID NO.1) was transferred into the cultivated soybean Williams82, and the soybean cells were regenerated into plants. Homozygous mutant plants resistant to herbicides were screened starting from the T0 generation. Compared with the cultivated soybean Williams82, the soybean protein content of the homozygous mutant plants was significantly increased and the oil content was significantly decreased. Therefore, the GmPO1 gene is a key regulatory gene for soybean oil content and protein content.

[0019] The present invention first reveals the biological function of the soybean GmPO1 gene in regulating soybean oil content and protein content, provides valuable gene resources and theoretical basis for crop breeding, and can widely apply the soybean GmPO1 gene to high-yield and high-quality breeding of soybeans, and seeds with high protein content and low oil content can be obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 For the whole-genome QTL scan of the TK780×TH03 F2 population; the red line represents the detection threshold; the ICIM-ADD model is used to detect QTL.

[0021] Figure 2 For the map-based cloning of the PO1 locus, wherein, (A) the position of PO1 on chromosome 20; (B) the phenotypes of oil and protein contents of the parents TK780 and TH03; (C) the fine mapping of the PO1 locus, the recombinants between adjacent markers are shown below the linkage map, and PO1 is located in a 146 kb region, (D) A: Homozygous line of the TK780 allele; B: Homozygous line of the TH03 allele; H: Heterozygous type, the segregation of the offspring protein content is shown by the box plot on the right, and the mean value and the range of variation of the protein content are represented by the bold vertical line and the horizontal line in the box plot respectively.

[0022] Figure 3Phenotypes of oil and protein content for near-isogenic lines (NILs).

[0023] Figure 4 Two mutant types of homozygous knockout lines of soybean GmPO1 (gmpo1-1, gmpo1-2).

[0024] Figure 5 Oil content and protein content of seeds of Williams82 and homozygous knockout lines of GmPO1 (gmpo1-1, gmpo1-2). Detailed implementation manners

[0025] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosed content of the present invention more thorough and comprehensive.

[0026] For the experimental methods without specific conditions indicated in the following embodiments, they are usually in accordance with conventional conditions, such as the fourth edition of "Molecular Cloning: A Laboratory Manual" edited by Green and Sambrook, which was published in 2013, or in accordance with the conditions recommended by the manufacturer. All common chemical reagents used in the embodiments are commercially available products.

[0027] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not used to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0028] Quantitative Trait Locus: QTL

[0029] In some embodiments of the present invention, it relates to the application of soybean GmPO1 gene in regulating soybean oil content and protein content, or in cultivating high-yield and high-quality soybean varieties. The CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2.

[0030] SEQ ID NO.1 (543bp)

[0031] ATGTTCTATCTCTGGTTCGACCCCACTAGAAACTTCCACGCTTATTCTATCATTTGGAAGCGCCAGCACATCATACCTATGTTTTGGAAAATAAAGAAGCACGGATCTACGGAAGATTTCTCAAGCCTTCCTTACATTTGCACATTGCTTAATTGCTCCTTATGGACTTACTATGGAATCATAAAGGCTAGAGAGTACCTCGTGGCTACTGTCGATGGCTTTGGCATTGTGGTGGAGACAATCTATGTTATTCTATTTCTCATATATGCTCCAAAAGGGATAAGGGGTAGAACTCTCATTTTGGCTGTGATTTTGGATGTGGCAATTTCGGCAGTAGCAGTAGTTACTACTCAATTAGCATTGCAAAGAGAAGCTCATGGTGGTGTTGTTGGTGTTATGGGAGCAGGCTTAAACATTGTTATGTATTTCTCACCTCTCTCTGCCATGTTGGATATATTGGTTCTGCACGGTTTCTTTCATGTTAGAGGATGGCTGATGGAATCCATAAAGATCTTTGTTGCTTTGCGTCTCGGGTATCTCTAA

[0032] SEQ ID NO.2(180aa)

[0033] MFYLWFDPTRNFHAYSIIWKRQHIIPMFWKIKKHGSTEDFSSLPYICTLLNCSLWTYYGIIKAREYLVATVDGFGIVVETIYVILFLIYAPKGIRGRTLILAVILDVAISAVAVVTTQLALQREAHGGVVGVMGAGLNIVMYFSPLSAMLDILVLHGFFHVRGWLMESIKIFVALRLGYL

[0034] In some other embodiments of the present invention, the application of the soybean GmPO1 gene knockout vector in regulating the oil content and protein content of soybeans and / or in cultivating high-yield and high-quality soybean varieties is disclosed, and the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1.

[0035] In some of these embodiments, the knockout target sequence of the soybean GmPO1 gene knockout vector is as shown in SEQ ID NO.5.

[0036] In some of these embodiments, the soybean GmPO1 gene knockout vector is constructed through the following steps: using the pHLW-gRNA-tRNA vector as a template, SEQ ID NO.6 and SEQ ID NO.7 as primers for PCR amplification and purification, digesting the PCR product and the pPTG-gRNA-Cas9 vector plasmid with BsaI enzyme, then performing temperature-variable cycle enzymatic digestion and ligation using T4 DNA ligase, transforming Escherichia coli competent cells, picking positive clones, and extracting the plasmid from the bacterial solution with correct sequencing to obtain the vector.

[0037] In some other embodiments of the present invention, a method for increasing the protein content of soybeans is disclosed, including the following steps: constructing a soybean GmPO1 gene knockout vector to render the coding protein function of the soybean GmPO1 gene lost; the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1.

[0038] In some other embodiments of the present invention, a method for reducing the oil content of soybeans is disclosed, including the following steps: constructing a soybean GmPO1 gene knockout vector to render the coding protein function of the soybean GmPO1 gene lost; the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1.

[0039] Taking soybeans as an example, the present invention exemplifies the role of the soybean GmPO1 gene in increasing the protein content and reducing the oil content. According to common knowledge, those skilled in the art can apply this technology to crops in the Papilionoideae subfamily that belong to the same genus as soybeans, such as peanuts, broad beans, mung beans, adzuki beans, peas, cowpeas, kidney beans, etc., to increase the protein content and reduce the oil content of these crops and to cultivate excellent seeds.

[0040] Unless otherwise specified, the methods used in the following examples are all conventional methods. The synthesis and sequencing of the primers used can be completed independently or entrusted to a third-party gene company, and the vectors and reagents used are all commercially available.

[0041] The following further elaborates on the present invention in detail with reference to the accompanying drawings and specific examples.

[0042] Example 1 Localization of the GmPO1 Gene

[0043] To identify genes regulating soybean oil content, we used the recombinant inbred line offspring individual TH03 (semi-wild soybean, low-oil and high-protein variety) of TK780 (cultivated soybean, high-oil and low-protein) and H4 (wild soybean, low-oil and high-protein), which was backcrossed with TK780 to obtain the F6 generation residual heterozygous line population, and detected the QTL loci of oil content. At the same time, we also used the constructed DN50×Williams 82 RIL population to detect the QTL loci of oil content. Through QTL analysis of the two populations, we located the QTL loci of oil content at the same position on chromosome 20. The associated locus on chromosome 20 was a locus that stably appeared in this study, indicating that there are indeed important loci in this interval involved in the regulation of oil content. We named this QTL locus PO1. See Figure 1 。

[0044] To further finely map PO1, we designed promoter insertion-deletion InDel markers and single-base substitution dCAPS markers within this interval using the resequencing data of TK780 and H4 to densify the constructed map. At the same time, according to the phenotypes of protein and oil content and their corresponding genotypes of the offspring of 7 recombinants, the candidate gene of PO1 was located within a 146 kb interval between SNP marker M5 and SNP marker M7. See Figure 2 。

[0045] According to the Williams 82 genomic database, there are 5 predicted genes within this range. Sequencing analysis was performed on the CDS regions of these 5 genes, and it was found that one of the candidate genes encodes a member of the SWEET family of sugar transporters, and there is an SNP between the parents that causes premature termination of protein coding. There are no non-synonymous mutations in the coding regions of the other 4 candidate genes between the parental varieties. According to its annotated gene function and mutation type, it was used as a candidate gene and named GmPO1.

[0046] Example 2 Localization of GmPO1 Gene

[0047] Next, to further verify the function of GmPO1 in regulating oil content in soybean varieties. Based on the major effect QTL locus PO1 mapped in the previous stage, we constructed a pair of near-isogenic lines (NILs), that is, using the finely mapped population F 6 The remaining fragment heterozygous plant lines at the PO1 locus in the offspring were used to construct NIL-PO1 H4 (low-oil and high-protein type, corresponding to the allele (gmpo1) on chromosome 20 in this study; and NIL-PO1 TK780In contrast, there is a SNP site (W165X) at the 165th base at the N-terminus, resulting in a change in the encoded protein sequence and premature termination of protein translation.) and NIL-PO1 TK780 (Near-isogenic lines of the high-oil and low-protein type, corresponding to GmPO1 on chromosome 20 in this study), and directly verified its phenotypic effect by comparing allelic differences. See Figure 3 .

[0048] Through phenotypic analysis of seed oil content and protein content, we found that compared with the isogenic control NIL-PO1 H4 NIL-PO1 TK780 had a higher seed oil content, and the seed protein content decreased correspondingly, indicating that GmPO1 can regulate the seed oil content of soybeans. See Figure 3 .

[0049] Example 3 Cloning of the GmPO1 Gene

[0050] In this example, the GmPO1 gene was cloned, and the specific steps are as follows:

[0051] 1. Use the RNAprep Pure Plant Kit kit to extract total RNA from Williams82 soybean seeds, and reverse transcribe it using the PrimeScriptTMⅡ 1st strand cDNA Synthesis (TaKaRa) kit to obtain cDNA as a cloning template.

[0053] 2. Perform PCR amplification using primers GmPO1-F (SEQ ID NO.3) and GmPO1-R (SEQ ID NO.4) respectively. The reaction system is shown in Table 1. The PCR amplification program is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec; annealing at 56°C for 30 sec; extension at 72°C for 1 min; 34 cycles; extension at 72°C for 5 min.

[0054] GmPO1-F (SEQ ID NO.3): ATGTTCTATCTCTGGTTCGACCCC

[0055] GmPO1-R (SEQ ID NO.4): TTAGAGATACCCGAGACGCAAAGC

[0056] Table 1

[0057]

[0058]

[0059] 3. After the PCR products were recovered by gel extraction, TA cloning was performed, and then the products were transformed into Top10 competent cells. The clones identified as positive by colony PCR were sent to the company for sequencing.

[0060] The sequencing results showed that the CDS length of GmPO1 was 543 bp (SEQ ID NO.1), encoding 180 amino acids (SEQ ID NO.2).

[0061] Example 4 Construction of the GmPO1 gene knockout vector

[0062] In this example, the knockout vector of the GmPO1 gene was constructed, and the specific steps were as follows:

[0063] 1. The knockout target of the GmPO1 gene was (ATAAGCGTGGAAGTTTCTAGTGG, SEQ ID NO.5);

[0064] 2. Using the intermediate vector pHLW - gRNA - tRNA as the template, PCR amplification was performed with the forward adapter primer GmPO1 - Cas9 - F (SEQ ID NO.6) and the reverse adapter primer GmPO1 - Cas9 - R (SEQ ID NO.7). The reaction system was shown in Table 2. The amplification program was: pre - denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec; annealing at 55°C for 30 sec; extension at 72°C for 20 s, for 34 cycles; extension at 72°C for 5 min.

[0065] GmPO1 - Cas9 - F (SEQ ID NO.6): GGTCTCTTGCAATAAGCGTGGAAGTTTCTAGGTTTCAGAGCTATGCTGGA

[0066] GmPO1 - Cas9 - R (SEQ ID NO.7): GGTCTCTAAACCTAGAAACTTCCACGCTTATTGCACCAGCCGGGAATCGA

[0067] Table 2

[0068]

[0069]

[0070] 3. Purify the PCR products according to the kit instructions.

[0071] 4. Circular enzyme digestion and ligation

[0072] Add about 20 - 70 ng of PCR product and about 80 - 100 ng of pPTG - gRNA - Cas9 vector plasmid. In a 15 μL reaction system, digest with 10 U BsaI at 37 °C for 15 min. Subsequently, add 0.5 μl of 10×NEB T4 DNA ligase buffer and 0.1 μL of 35 U ligase, and perform temperature - cycling enzymatic digestion and ligation for 12 cycles: 37 °C for 2 min, 10 °C for 3 min, 20 °C for 5 min; finally, incubate at 37 °C for 2 h.

[0073] 5. Transformation of competent cells and identification

[0074] Transfer the ligation product to Escherichia coli top10 competent cells and plate for culture. Pick positive clones for expanded culture in LB containing the corresponding antibiotic. After PCR identification with primers SP - F (SEQ ID NO.8) and SP - R (SEQ ID NO.9), verify by sequencing to obtain the knockout vector of the GmPO1 gene.

[0075] SP - F (SEQ ID NO.8): GTCGTGCTCCACATGTTGACCGG

[0076] SP - R (SEQ ID NO.9): CCCGACATAGATGCAATAACTTC

[0077] Example 5. Transformation of soybean by Agrobacterium - mediated method

[0078] The Agrobacterium - mediated method for transforming soybean described in this example includes the following steps:

[0079] 1. Obtaining soybean explants

[0080] Sterilize Williams82 soybean seeds with smooth surface, no cracks, no disease spots, and no molds with chlorine gas for 10 - 14 h, and then place them in MS basal medium for dark culture. After germination, cut the two cotyledons along the mid - axis in a laminar flow hood, remove the two original leaf buds, and make a wound about 3 mm long at the junction of the cotyledon and the hypocotyl.

[0081] 2. Genetic transformation of soybean

[0082] Use Agrobacterium - mediated genetic transformation to infect the cotyledon wound with strain EHA105 carrying the GmPO1 gene knockout vector of Example 4, and obtain transgenic plants after induction culture.

[0083] 3. Screening of heritable transgenic plants

[0084] T0 transgenic seedlings were screened by spraying 160 mg / L glufosinate ammonium (Basta), and PCR identification was carried out to obtain positive plants, and then T1 plants were obtained by propagation. Total DNA was extracted from the leaves of T2 transgenic plants, and the sequences before and after the target site were amplified using the F primer (AGGTTGCTTTAGCATTGATTATTG, SEQ ID NO.10) and the R primer (GAGTTCTACCCTGAAATCC, SEQ ID NO.11). After sequencing verification, homozygous lines gmpo1-1 and gmpo1-2 of two editing types were obtained. The specific editing methods are as Figure 4 shown.

[0085] 4. Quality evaluation of transgenic plants

[0086] The oil content and protein content of soybean seeds of two editing types were measured, and the results are as Figure 5 shown.

[0087] Figure 5 The results showed that compared with the cultivated soybean Williams82 (W82), the soybeans of both editing types (gmpo1-1 and gmpo1-2) showed a significant increase in protein content and a significant decrease in oil content.

[0088] The above results indicate that the GmPO1 gene plays an important role in regulating the accumulation of oil content and protein content in soybeans.

[0089] The above embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. Application of soybean GmPO1 gene in reducing the oil content and / or increasing the protein content of legumes, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein having an amino acid sequence as shown in SEQ ID NO.

2.

2. Application of the protein encoded by soybean GmPO1 gene in reducing the oil content and / or increasing the protein content of legumes, wherein the amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. Application of soybean GmPO1 gene knockout vector in reducing the oil content and / or increasing the protein content of legumes, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein having an amino acid sequence as shown in SEQ ID NO.

2.

4. Use of Agrobacterium carrying the soybean GmPO1 gene knockout vector of claim 3 in reducing the oil content and / or increasing the protein content of legumes, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein having an amino acid sequence as shown in SEQ ID NO.

5.

5. Application of soybean GmPO1 gene or its encoded protein in breeding of leguminous plants with reduced oil content and / or increased protein content, wherein the CDS sequence of the soybean GmPO1 gene is as shown in SEQ ID NO.1, or the soybean GmPO1 gene is a nucleic acid sequence encoding a protein with an amino acid sequence as shown in SEQ ID NO.

2.

6. The use according to any one of claims 1 to 5, wherein the leguminous plant is a plant of the Fabaceae subfamily, preferably soybean, peanut, broad bean, mung bean, red bean, pea, cowpea, and kidney bean.

7. A method for increasing the protein content of leguminous plants, characterized in that: The method comprises the following steps: constructing the soybean GmPO1 gene knockout vector according to claim 3, so that the protein encoding function of the soybean GmPO1 gene is lost; The biological preparation carrying the soybean GmPO1 gene knockout vector is brought into contact with leguminous plants for transfection.

8. A method for reducing the oil content of leguminous plants, characterized in that: The method comprises the following steps: constructing the soybean GmPO1 gene knockout vector according to claim 3 to make the protein encoding function of the soybean GmPO1 gene lose; contacting the biological preparation carrying the soybean GmPO1 gene knockout vector with leguminous plants for transfection.

9. The method according to claim 7 or 8, characterized in that: The knockout target of the GmPO1 gene is shown in SEQ ID NO.

5.

10. The method according to claim 7 or 8, characterized in that: The construction of soybean GmPO1 gene knockout vector includes the following steps: Using pHLW-gRNA-tRNA vector as template and SEQ ID NO.6 and SEQ ID NO.7 as primers, PCR amplification and purification were performed. The PCR product and pPTG-gRNA-Cas9 vector plasmid were digested with enzymes, and then transformed into plasmid after circular enzyme digestion and connection. Positive clones were picked and plasmids were extracted to obtain the product.