Packaging helper plasmid for high-yield production of aav and application thereof
By designing high-yield AAV packaging helper plasmids containing sequences such as Rep expression cassettes and Cap expression cassettes, the problem of low AAV yield has been solved, resulting in a significant increase in AAV yield and a reduction in cost, supporting the economical production of gene therapy.
Patent Information
- Application Number
- CN202510256787.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2045-03-05
AI Technical Summary
The low yield of AAV in existing technologies leads to high costs for gene therapy, which limits the widespread application of gene therapy products.
Design a high-yield AAV packaging helper plasmid containing recombinant sequences, including a Rep expression cassette, a Cap expression cassette, adenovirus E2A sequence, adenovirus E4 truncated sequence, and VA RNA sequence, and combine a DA' sequence in a single helper plasmid to optimize plasmid combination to improve AAV yield.
This significantly increased the yield of single-cell AAV, reduced production costs, and provided a new direction for GMP production of AAV.
Smart Images

Figure CN120118956B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a high-yield AAV packaging helper plasmid and its application. Background Technology
[0002] Adeno-associated virus (AAV) possesses numerous advantages that make it a favored gene therapy delivery vector. First, AAV replication requires the participation of helper viruses, thus it is considered non-pathogenic. Second, once inside the cell, the genome enclosed by its ITR structure can circularize to form a free-body structure, reducing the probability of recombination with the genome and consequently decreasing genomic toxicity. Furthermore, AAV has 12 different serotypes and hundreds of derived variants, greatly expanding its application scope.
[0003] rAAV-based vectors can target both dividing and non-dividing cells, including the retina, liver, heart, muscle, and central nervous system (CNS), to achieve long-term expression of therapeutic genes. To date, over 200 clinical trials have been conducted to treat various diseases, such as hemophilia A and B, Parkinson's disease, wet age-related macular degeneration, mucopolysaccharidosis (MPS), and Barton's disease. Despite the success of rAAV-based gene therapy in clinical trials, high manufacturing costs remain a bottleneck in the field due to low yields and the high dosage requirements for certain disease indications, thus limiting patient access to these promising products. This, in turn, intensifies the need to reduce AAV production costs and establish flexible, GMP-compliant AAV production systems.
[0004] Therefore, the bottleneck in AAV production urgently needs to be overcome. Improving and innovating upstream production to increase AAV yield is one of the key points for reducing gene therapy production costs. Transient transfection of human embryonic kidney (HEK)293 cells with plasmids is a common strategy for adeno-associated virus (AAV) vector preparation, offering advantages such as short production cycles, ease of operation, and high flexibility. The three-plasmid transfection method is currently the most commonly used rAAV production method. This method uses three plasmids to co-transfect HEK293 cells: a helper plasmid pADhelper, providing adenovirus E2A, E4, and VA RNA elements; a packaging plasmid pRC, providing the Rep and Cap protein coding sequences for AAV, where the Rep protein is responsible for AAV genome replication and assists in AAV genome particle assembly, and the Cap protein forms the AAV coat; and a plasmid containing the target sequence, abbreviated as pGOI, with a 5' ITR and 3' ITR sequence from the natural AAV genome upstream and downstream of the target sequence. Grimm D and Tang Q et al. combined the packaging plasmid and helper plasmid from the three plasmids into a single plasmid, specifically by combining the AAV rep / cap and Ad helper genes into a single helper plasmid pDG. This allows AAV preparation to be performed using only two plasmids. By using two plasmids instead of three for AAV preparation, the transfection process is simplified, the number of components required for AAV production is reduced, and the cost of plasmid production is lowered, resulting in significant cost savings in GMP production of rAAV. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a high-yield AAV packaging auxiliary plasmid and its application.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] In a first aspect, the present invention provides a high-yield AAV packaging helper plasmid, wherein a recombinant sequence is inserted into the backbone plasmid, and the recombinant sequence comprises, from 5' to 3', a Rep expression cassette, a Cap expression cassette, an adenovirus E2A sequence, an adenovirus E4 truncated sequence, an adenovirus VA RNA sequence, and at least one DA' sequence.
[0008] In a preferred embodiment of the high-yield AAV packaging aid plasmid of the present invention, the recombinant sequence from 5' to 3' includes any of the following sequences:
[0009] i. Rep protein coding sequence, Cap protein coding sequence, adenovirus E2A sequence, adenovirus E4 truncated sequence, adenovirus VA RNA sequence, DA' sequence, promoter sequence;
[0010] ii. Rep protein coding sequence, first promoter sequence, intron sequence, Cap protein coding sequence, adenovirus E2A sequence, adenovirus E4 truncated sequence, VA RNA sequence, DA' sequence, second promoter sequence;
[0011] iii. Rep truncated sequence, first promoter sequence, intron sequence, Cap protein coding sequence, adenovirus E2A sequence, adenovirus E4 truncated sequence, VA RNA sequence, DA' sequence, second promoter sequence.
[0012] More preferably, the promoter includes a P5 promoter sequence and / or a CMV-p40 promoter.
[0013] As a preferred embodiment of the packaging helper plasmid for high-yield AAV as described in this invention, the Rep truncated sequence is shown in SEQ ID No. 7; the E4 truncated sequence of the adenovirus is shown in SEQ ID No. 10.
[0014] Secondly, the present invention provides a high-yield AAV plasmid set, including AAV plasmids and the high-yield AAV packaging aid plasmids.
[0015] As a preferred embodiment of the high-yield AAV plasmid set described in this invention, the AAV plasmid is an AAV plasmid pAAV.CAG.EGFP vector of a fluorescent protein driven by the CAG promoter.
[0016] Thirdly, the present invention provides a reagent for high-yield AAV production, comprising the aforementioned high-yield AAV plasmid group.
[0017] Fourthly, the present invention provides a cell that produces high levels of AAV, comprising the aforementioned high-AAV-producing plasmid group.
[0018] As a preferred embodiment of the high-AAV-producing cell described in this invention, the cell includes at least one of HeLa, HEK293, and insect Sf9 cells.
[0019] Fifthly, the present invention provides a kit for high-yield AAV production, comprising the reagents or the cells described herein.
[0020] In a sixth aspect, the present invention provides a method for high-yield AAV production, wherein the plasmid group is transformed into a host cell and then the host cell is cultured; or the cell is cultured directly.
[0021] In a seventh aspect, the present invention applies the high-yield AAV packaging helper plasmid, the plasmid group, the reagent, the cells, and the kit to the production of recombinant adeno-associated virus.
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0023] This invention proposes a packaging helper plasmid encoding Rep / Cap (including all its serotypes), E2A, a truncated E4, and VA RNA. Adding the DA' sequence enhances AAV production in single cells. Furthermore, replacing the Cap expression cassette promoter with the CMV-p40-intron dual promoter further increases rAAV viral yield, significantly improving AAV production in single cells. This provides a new direction for AAV production. Attached Figure Description
[0024] Figure 1 This is a schematic diagram of the packaging auxiliary plasmid design in the embodiment.
[0025] Figure 2 This is a schematic diagram of the structural elements of the plasmid framework in the embodiment.
[0026] Figure 3 The results show the comparison between the viral titers of the lysates of each group of packaging helper plasmids detected in the examples and the control vector. Detailed Implementation
[0027] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0028] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0029] Example 1: Construction of packaging helper plasmid pRCHelper
[0030] By designing combinations containing multiple Rep promoters, Rep coding sequences, Cap promoters, Cap coding sequences, DA' sequences, E2A sequences, E4 truncated sequences, and VA RNA sequences, different candidate packaging helper plasmids were constructed based on the backbone vector sequences using conventional molecular cloning methods (see...). Figure 1 Then, the AAV packaging titers of each packaging auxiliary carrier in the two plasmid transfection system were compared in parallel.
[0031] Among them, plasmid backbone (such as Figure 2The sequences shown are as follows: P5 promoter sequence as shown in SEQ ID No. 1; CMV-p40 promoter sequence as shown in SEQ ID No. 2; Intron sequence as shown in SEQ ID No. 3; DA' sequence as shown in SEQ ID No. 4; Rep from adeno-associated virus type 2, sequence as shown in SEQ ID No. 6; Rep truncated sequence from adeno-associated virus type 2, sequence as shown in SEQ ID No. 7; Cap from adeno-associated virus type 9, sequence as shown in SEQ ID No. 8; E2A from adeno-associated virus type 5, sequence as shown in SEQ ID No. 9; E4 truncated sequence from adeno-associated virus type 5, sequence as shown in SEQ ID No. 10; VARNA from adeno-associated virus type 5, sequence as shown in SEQ ID No. 11.
[0032] The specific steps for plasmid construction are as follows:
[0033] (1) Using a plasmid containing the RepCap gene as a template, the Rep sequence, Cap sequence, DA' sequence, P5 promoter sequence, p40 promoter sequence, and Intron sequence were obtained by PCR amplification or enzyme digestion; using a plasmid containing the E2A / E4 / VA RNA gene as a template, the E2A sequence, E4 truncated sequence, and VA RNA sequence were obtained by PCR amplification or enzyme digestion; using a plasmid containing the CMV promoter as a template, the CMV promoter sequence was amplified.
[0034] The PCR reaction system is shown in Table 1:
[0035] Table 1 PCR reaction system
[0036]
[0037] The enzyme digestion reaction system is shown in Table 2:
[0038] Table 2 Enzyme digestion reaction system
[0039]
[0040]
[0041] PCR reaction conditions are shown in Table 3:
[0042] Table 3 PCR reaction conditions
[0043]
[0044] The enzyme digestion reaction conditions are shown in Table 4:
[0045] Table 4 Enzyme digestion reaction conditions
[0046] Reaction steps reaction temperature reaction time Digestion 37℃ 30min Hold 8℃
[0047] The primers used for plasmid construction are shown below:
[0048] Forward primer 1: atggctgccgatggttatc;
[0049] Reverse primer 1: acgtaatccgtagatgtacctgg;
[0050] Forward primer 2: aggtacatctacggattacgtaagccgaattctgcagatatcc;
[0051] Reverse primer 2: gtgacctctaatacaggacctagctcccccgataccgtc;
[0052] Forward primer 3: aggtcctgtattagaggtcacg;
[0053] Reverse primer 3: accatcggcagccatacctgatttaaatcatttattgttcaaagatg;
[0054] Forward primer 4: gcggtctcatgaggtttaaaccgccatcgataagcttggga;
[0055] Reverse primer 4: ccttaattaaggcaattacagattacgagtcagg;
[0056] Forward primer 5: agcgagacgaaatacgcgat;
[0057] Reverse primer 5: aagcttatcgatggcggtttttattgttcaaagatgcagtcatcca.
[0058] (2) The PCR amplified bands were detected by agarose gel electrophoresis, and the target fragment was recovered using a gel recovery kit.
[0059] (3) Use a seamless cloning kit to perform multi-fragment ligation. Use T4 ligase for digestion and ligation.
[0060] The seamless cloning reaction system is shown in Table 5:
[0061] Table 5 Reaction System
[0062]
[0063]
[0064] The reaction conditions were: 50℃ for 1 hour.
[0065] The T4 connection reaction system is shown in Table 6:
[0066] Table 6 Reaction System
[0067] Reactive components Volume (μL) T4 DNA Ligase Buffer (10X) 1 Vector DNA 25ng Insert DNA 75ng T4 DNA Ligase 1 Nuclease-free Water to 10
[0068] The reaction conditions were: room temperature for 1 hour.
[0069] (4) The product after the reaction was transformed into E. coli and plated on a plate containing the resistance. The next day, clones were picked for colony PCR identification. Positive clones were sent to Guangzhou Genewiz Company for sequencing to select the correct plasmids.
[0070] Example 2: Production of AAV by Two-Plasmid Transfection
[0071] (1) Seedling 293T cells (293T, derived from...) CRL-3216TM cells were cultured in 3E+05 to 6-well plates in high-glucose DMEM medium containing 10% newborn calf serum and 1% Penicillin / Streptomycin at 37°C in a 5% CO2 cell culture incubator for about 48 hours. The cell density at transfection was about 60-70%.
[0072] (2) The packaging helper plasmid pRCHelper from Example 1 and the AAV plasmid pAAV.CAG.EGFP vector of the CAG promoter-driven fluorescent protein were added to 0.5 mL DMEM at a ratio of 1 μg:0.5 μg. The conventional three-plasmid group was added to 0.5 mL DMEM at a ratio of 0.5 μg:0.5 μg:0.5 μg. Then, 3 μL of PEI (1 μg / μL) was added, vortexed, and incubated at room temperature for 10 minutes. The mixture was then added to 1.5 mL of transfection medium and vortexed. The medium was removed from the 6-well plate, and the transfection mixed medium was added. The plate was then returned to a 37°C cell culture incubator (5% CO2 concentration) for culture.
[0073] After culturing for 72 hours, add 15 μL of cell lysis buffer, collect the cells and supernatant into a 2 mL centrifuge tube, lyse at 37°C and 250 rpm for 1 hour, and centrifuge at 10000g for 10 minutes to obtain the crude AAV extract.
[0074] Example 3: Determination of AAV titer
[0075] (1) The sequences of all types of AAV vector WPRE obtained in Example 2 were specifically detected using primers FWD WPRE (5'-TGCTTCCCGTATGGCTTTCA) and REV WPRE (5'-ACGGAATTGTCAGTGCCCAA). The group settings are shown in Table 7.
[0076] Table 7 Group Settings
[0077]
[0078] (2) The sample was digested with DNase I, and the composition of the reaction system is shown in Table 8:
[0079] Table 8 Reaction System
[0080] Reagent X1 Nuclease-free Water 15.8μL 10×Reaction Buffer 2μL DNase I, RNase free (70 U / μL) 0.2μl Sample 2μL
[0081] Take 5 μL of sample and dilute it 20-fold. Take the corresponding number of PCR tubes, aliquot 18 μL of digestion solution into each tube, add 2 μL of the diluted sample and 2 μL of plasmid standard (containing 4E+08 AAV copies (Genome Copies, GC), as a DNase I digestion control) to each tube, which is equivalent to a 10-fold dilution. Incubate at 37°C for 30 min. After digestion, take 5 μL of sample and add it to 95 μL of water, and dilute twice consecutively, for a total dilution of 80,000 times. The Ref AAV (plasmid standard) is diluted a total of 4,000 times.
[0082] (3) Perform SYBR Green qPCR
[0083] Preparation of standards: Take plasmid standards containing 2E+08 AAV copies / μL and perform six serial dilutions at a concentration of 8μL plasmid standard + 72μL water. The first gradient concentration is 2E+08GC / μL, which is set to 8E+14GC / mL in the software to reflect the dilution gradient of the sample. The subsequent gradients are 8E+13GC / mL, 8E+12GC / mL, 8E+11GC / mL, 8E+10GC / mL, and 8E+09GC / mL, respectively.
[0084] The composition of the reaction system is shown in Table 9:
[0085] Table 9 Reaction System
[0086]
[0087]
[0088] Calculate three replicate wells for each sample, prepare the corresponding volume of mixture, divide 18 μL into each well, and then add 2 μL of sample to each well.
[0089] The SYBR Green qPCR conditions were: pre-denaturation: 95℃ for 10 min; cycling: 40 cycles: 95℃ for 15 sec; 60℃ for 1 min.
[0090] After converting all titer test results into a fold relationship with the three-plasmid control vector P5+RC, as follows: Figure 3 As shown in the figure. The results indicate that, compared with conventional packaging vectors, the packaging helper plasmid (RepCap+E2A+E4truncated sequence+VA RNA+p5) increases rAAV viral yield after the addition of the DA' sequence. Furthermore, replacing the Cap expression cassette promoter with the CMV-p40-intron dual promoter significantly increases rAAV viral yield.
[0091] In the embodiments of the present invention, a specific serotype (Rep2Cap9) helper plasmid is used. Those skilled in the art should understand that the present invention is not limited to this specific serotype, but can be implemented using other serotype helper plasmids that are currently known and may be discovered in the future.
[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A plasmid array for high AAV production transfection using two plasmids, characterized in that, It consists of an AAV plasmid and a packaging helper plasmid; the packaging helper plasmid backbone plasmid contains a recombinant sequence inserted, and the recombinant sequence from 5' to 3' includes any of the following: i. Rep protein-coding sequence, CMV-p40 promoter sequence, Intron sequence, Cap protein-coding sequence, adenovirus E2A sequence, adenovirus E4 truncated sequence, VA RNA sequence, DA' sequence, and P5 promoter sequence; or ii. Rep truncated sequence, CMV-p40 promoter sequence, Intron sequence, Cap protein coding sequence, adenovirus E2A sequence, adenovirus E4 truncated sequence, VA RNA sequence, DA' sequence and P5 promoter sequence; The Rep truncated sequence is shown in SEQ ID No. 7; the E4 truncated sequence of the adenovirus is shown in SEQ ID No. 10; the Intron sequence is shown in SEQ ID No. 4; The P5 promoter sequence is shown in SEQ ID No. 2; the CMV-p40 promoter sequence is shown in SEQ ID No. 3; the DA' sequence is shown in SEQ ID No. 5; the Rep protein coding sequence is shown in SEQ ID No. 6; the Cap protein coding sequence is shown in SEQ ID No. 8; the adenovirus E2A sequence is shown in SEQ ID No. 9; and the VA RNA sequence is shown in SEQ ID No.
11.
2. A reagent for high-yield AAV transfection using two plasmids, characterized in that, The plasmid group comprising the high-yield AAV as described in claim 1.
3. A cell line transfected with two plasmids to produce high levels of AAV, characterized in that, The plasmid group comprising the high-yield AAV as described in claim 1.
4. The cell line transfected with two plasmids according to claim 3, characterized in that, The cells include at least one of HeLa, HEK293, and insect Sf9 cells.
5. A kit for high-yield AAV transfection using two plasmids, characterized in that, Includes the reagent of claim 2 or the cells of claim 3 or 4.
6. A method for high-yield AAV transfection using two plasmids, characterized in that, Transform the plasmid group according to claim 1 into a host cell and then culture the host cell; or culture the cell according to claim 3 or 4.
7. The use of the plasmid group of claim 1, the reagent of claim 2, the cell of claim 3 or 4, and the kit of claim 5 in the production of recombinant adeno-associated virus.