Composition for detecting klebsiella pneumoniae based on PCR-CRISPR-Cas13a and application of composition

Abstract

The invention discloses a composition for detecting klebsiella pneumoniae based on PCR-CRISPR-Cas13a and application of the composition, and belongs to the technical field of determination or detection methods of nucleic acid or microorganisms. The invention discloses a composition comprising a primer pair for specifically amplifying a specific DNA (Deoxyribose Nucleic Acid) fragment of klebsiella pneumoniae and crRNA (Complementary Ribonucleic Acid) for identifying the specific DNA fragment of the klebsiella pneumoniae. The invention also discloses a kit containing the composition and a method for nucleic acid detection by using the composition. The method for detecting the klebsiella pneumoniae by combining the PCR technology with the CRISPR-Cas13a technology is simple, convenient and rapid, has relatively high sensitivity and specificity, can be used for clinically and rapidly identifying the klebsiella pneumoniae, and has very important clinical application prospects and development values.

Description

Technical Field

[0001] The present invention belongs to the technical field of methods for the determination or detection of nucleic acids or microorganisms, and particularly relates to a composition for detecting Klebsiella pneumoniae based on PCR-CRISPR-Cas13a and its application. Background Art

[0002] Klebsiella pneumoniae is a Gram-negative bacterium that can be widely distributed on the mucosal surfaces of the human body, including the nasopharynx, respiratory tract, and gastrointestinal tract, and can cause human urinary tract infections, pneumonia, bloodstream infections, and sepsis. In recent years, Klebsiella pneumoniae has become the main opportunistic pathogen second only to Escherichia coli. Klebsiella pneumoniae can produce a large amount of broad-spectrum β-lactamases and carbapenemases, so it has strong resistance to antibiotics. The World Health Organization designated it as a "serious threat" bacterium in 2017. Studies have shown that the colonization rate of Klebsiella pneumoniae in the colon of inpatients in an intensive care unit of a hospital in the United States is as high as 23%.

[0003] Currently, the commonly used method for detecting Klebsiella pneumoniae in the laboratory is still to obtain isolated colonies through traditional bacterial culture and then use a time-of-flight laser mass spectrometer for identification. The detection process is cumbersome, slow, and relies on large-scale instrument equipment. The development of molecular diagnostic techniques has greatly improved the efficiency of pathogen detection. Quantitative real-time PCR (qPCR) has been used as a daily diagnostic tool for detecting pathogens due to its good sensitivity and specificity. However, when the concentration of the target pathogen is very low, the accuracy of qPCR may be poor. In addition, the quality of the standard product may affect the accuracy of the diagnosis. There is an urgent need for an effective detection method to accurately, sensitively, simply, and rapidly detect whether the sample to be tested is (or contains) Klebsiella pneumoniae. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to accurately, sensitively, simply, and rapidly detect whether the sample to be tested is or contains Klebsiella pneumoniae.

[0005] To solve the above technical problems, the present invention first provides a composition for detecting Klebsiella pneumoniae, the composition comprising a primer pair and a crRNA that specifically amplify a specific DNA fragment of Klebsiella pneumoniae, the sequence of the crRNA comprising an anchoring sequence that binds to the Cas13a protein and a guide sequence that targets the specific DNA fragment of Klebsiella pneumoniae, the guide sequence being positions 39-66 of SEQ ID No. 4, the primer pair may consist of primer KP-F3 and primer KP-R3, the primer KP-F3 may be a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No. 2; the primer KP-R3 may be a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No. 3.

[0006] Further, in the composition, the nucleotide sequence of the specific DNA fragment of Klebsiella pneumoniae is SEQ ID No. 1.

[0007] Further, in the composition, the anchoring sequence that binds to the Cas13a protein is positions 1-38 of SEQ ID No. 4.

[0008] Further, in the composition, the nucleotide sequence of the crRNA may be SEQ ID No. 4.

[0009] The present invention also provides a kit for detecting Klebsiella pneumoniae, the kit comprising any one of the above compositions.

[0010] Further, the kit further comprises a Cas13a protein.

[0011] Further, in the kit, the Cas13a protein may exist independently or in the form of a complex with the crRNA of the present invention.

[0012] Further, the Cas13a protein may be an LwCas13a protein.

[0013] Further, the kit further comprises a reporter RNA.

[0014] Further, the reporter RNA is an RNA molecule with a signal reporting function, and when the RNA molecule is degraded, it can report a positive signal and be detected.

[0015] The reporter RNA is a single-stranded RNA linked to a reporter group. The reporter group may be a fluorescent group. The fluorescent group is selected from at least one of FAM, 6-FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 or Texas Red.

[0016] In one embodiment of the present invention, the reporter RNA is RNaseAlert TM QC system v2 (Invitrogen TM product, catalog number 4479769).

[0017] Furthermore, the kit may further include one or more of T7 transcriptase, NTP (such as NTP Mix), RNase inhibitor, RNase-free water, and PCR amplification buffer.

[0018] In one embodiment of the present invention, the PCR amplification buffer is a product of Beijing Bomed Gene Technology Co., Ltd., with the catalog number MT211-02.

[0019] Furthermore, the kit further includes a readable carrier recording the method for detecting Klebsiella pneumoniae described herein. The readable carrier may be an instruction manual for the kit for practicing the method of the present invention (such as a printed instruction manual) or a computer-readable medium (such as a floppy disk, CD, etc.) on which information has been recorded.

[0020] The various reagent components of the kit may be present in separate containers, or may be pre-combined in whole or in part into a reagent mixture.

[0021] The crRNA described herein or the complex of the crRNA and Cas13a protein is also within the scope of protection of the present invention.

[0022] The present invention also provides a method for detecting Klebsiella pneumoniae, the method comprising the following steps:

[0023] A1) Extracting the DNA of the sample to be tested;

[0024] A2) Using the DNA as a template, performing PCR amplification with the primer KP-F3 and the primer KP-R3 to obtain an amplification product;

[0025] A3) Detecting using the CRISPR-Cas13a detection system;

[0026] The CRISPR-Cas13a detection system includes the crRNA.

[0027] In the above method, the CRISPR-Cas13a detection system further includes Cas13a protein and / or transcriptase.

[0028] Furthermore, the CRISPR-Cas13a detection system further includes a reporter RNA, NTP (such as NTP Mix), T7 transcriptase, RNase inhibitor, RNase-free water, and a transcription and CRISPR-Cas13a detection reaction buffer;

[0029] Furthermore, in step A2), the reaction conditions for performing the PCR amplification may be: pre-denaturation at 95°C for 5 min; 95°C for 30 s, 55°C for 30 s, 72°C for 45 s, for 35 cycles; extension at 72°C for 10 min.

[0030] Furthermore, the method for detection using the CRISPR-Cas13a detection system in step A3) is as follows:

[0031] ① Prepare a transcription and CRISPR-Cas13a detection system containing the following components: the PCR amplification product obtained in step A2), Cas13a protein, crRNA, reporter RNA, NTP, T7 transcriptase, RNase inhibitor, RNase-free water, and a transcription and CRISPR-Cas13a detection reaction buffer; ② Perform the reaction; ③ Detect the positive signal.

[0032] Furthermore, in step ②, the reaction conditions may be: 37°C, and in step ③, the detection of the positive signal may be: detect the positive signal once every 2 min, for a total of 30 detections.

[0033] Furthermore, the method further includes determining whether Klebsiella pneumoniae is present in the test sample based on the presence or absence of a positive signal, and / or determining the concentration of Klebsiella pneumoniae in the test sample based on the strength of the positive signal.

[0034] The determination of whether Klebsiella pneumoniae is present in the test sample based on the presence or absence of a positive signal is as follows: if there is a positive signal, it is determined that Klebsiella pneumoniae is present or candidate present in the test sample; if there is no positive signal, it is determined that Klebsiella pneumoniae is not present or candidate not present in the test sample.

[0035] The determination of the concentration of Klebsiella pneumoniae in the test sample based on the strength of the positive signal is as follows: the stronger the positive signal, the higher the content of Klebsiella pneumoniae in the test sample; the weaker the positive signal, the lower the content of Klebsiella pneumoniae in the test sample.

[0036] In this article, the positive signal may be a fluorescence signal. Within the same detection time, if the fluorescence intensity value of the experimental group is more than 1 time higher than that of the negative control (ddH 2 O), it is determined as a positive result (positive signal).

[0037] The present invention also provides the above-mentioned composition, and / or, the above-mentioned crRNA or complex for use in any of the following applications:

[0038] B1) Use in detecting Klebsiella pneumoniae;

[0039] B2) Use in preparing a product for detecting Klebsiella pneumoniae;

[0040] B3) Use in identifying or assisting in the identification of Klebsiella pneumoniae;

[0041] B4) Use in preparing a product for identifying or assisting in the identification of Klebsiella pneumoniae;

[0042] B5) Use in identifying or assisting in the identification of whether a test sample is or contains Klebsiella pneumoniae;

[0043] B6) Use in preparing a product for identifying or assisting in the identification of whether a test sample is or contains Klebsiella pneumoniae;

[0044] B7) Use in screening or assisting in the screening of drugs for preventing and treating Klebsiella pneumoniae;

[0045] B8) Use in preparing a product for screening or assisting in the screening of drugs for preventing and treating Klebsiella pneumoniae;

[0046] B9) Use in diagnosing or assisting in the diagnosis of diseases caused by Klebsiella pneumoniae infection;

[0047] B10) Use in preparing a product for diagnosing or assisting in the diagnosis of diseases caused by Klebsiella pneumoniae infection;

[0048] B11) Use in the treatment monitoring of diseases caused by Klebsiella pneumoniae infection;

[0049] B12) Use in preparing a product for the treatment monitoring of diseases caused by Klebsiella pneumoniae infection.

[0050] The purposes of the above applications and methods may be disease diagnosis purposes, disease prognosis purposes and / or disease treatment purposes, and their purposes may also be non-disease diagnosis purposes, non-disease prognosis purposes and non-disease treatment purposes; their direct purposes may be to obtain information on intermediate results of disease diagnosis results, disease prognosis results and / or disease treatment results; their direct purposes may be non-disease diagnosis purposes, non-disease prognosis purposes and / or non-disease treatment purposes.

[0051] Furthermore, the test sample may be a purified colony.

[0052] Further, the sample to be tested can be a sputum sample, a blood sample, a tissue sample, an environmental sample (such as air), clothing or a towel, or an animal tissue and / or organ as food, etc.

[0053] The beneficial technical effects achieved by the present invention are as follows:

[0054] The method for detecting Klebsiella pneumoniae by combining PCR technology and CRISPR-Cas13a technology in the present invention, through design, construction, and screening, finally provides a primer pair for amplifying a specific DNA fragment of Klebsiella pneumoniae, and a specific crRNA for detecting Klebsiella pneumoniae. The method provided by the present invention is simple, fast, and has high sensitivity and specificity. It can be used for rapid clinical identification of Klebsiella, so as to carry out reasonable treatment for patients to shorten the treatment cycle. It has very important clinical application prospects and development value. Description of the Drawings

[0055] Figure 1 It is a gel electrophoresis detection result diagram of the PCR amplification product in step four of Example 1.

[0056] Figure 2 It is a screening result diagram of specific crRNAs (crRNA1, crRNA2, crRNA3, crRNA4, crRNA5) of Klebsiella pneumoniae.

[0057] Figure 3 It is a sensitivity result diagram of the primer pair and crRNA for detecting Klebsiella pneumoniae.

[0058] Figure 4 It is a specificity result diagram of the primer pair and crRNA for detecting Klebsiella pneumoniae. Detailed Embodiments

[0059] The following further describes the present invention in detail in combination with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0060] The experimental methods in the following embodiments, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0061] The genomic extraction kit in the following embodiments is a product of Tiangen Company, and the DNA purification and recovery kit (product number DP315), 2×Taq mix (product number MT211-02) and ddH 2O is a product of Bomed Company.

[0062] In the quantitative tests in the following examples, unless otherwise specified, three replicates were set, and the results were averaged.

[0063] Example 1 Preparation of plasmid standard, design and screening of primers

[0064] The basic principle of the method for detecting Klebsiella pneumoniae based on PCR-CRISPR-cas13a provided by the present invention is as follows: First, the specific DNA fragment of Klebsiella pneumoniae is transcribed into single-stranded RNA, and then the crRNA of CRISPR specifically binds to the target fragment to activate any nuclease activity of Cas13a. Finally, Cas13a is used to cleave the reporter RNA with a fluorescent signal to release the fluorescent signal, and whether the test sample is or contains Klebsiella pneumoniae is judged by the fluorescent signal. The difficulties of the present invention are: 1. Screening of the specific DNA fragment of Klebsiella pneumoniae to ensure sensitivity and specificity; 2. Screening of highly efficient crRNA guide sequences and screening of PCR amplification primer pairs for the specific DNA fragment of Klebsiella pneumoniae to achieve rapid and sensitive detection.

[0065] I. Analysis of specific DNA fragment of Klebsiella pneumoniae and preparation of plasmid standard

[0066] First, the DNA sequence of Klebsiella pneumoniae was analyzed for conservation and specificity, and then specific analysis was carried out with other bacteria to obtain the specific DNA fragment of Klebsiella pneumoniae, which is not present in other bacteria. The specific DNA fragment of Klebsiella pneumoniae is a DNA molecule with the nucleotide sequence of SEQ ID NO.1.

[0067] SEQ ID No.1

[0068]

[0069] The present invention uses a recombinant plasmid (plasmid pUC57-KP) carrying the specific fragment of Klebsiella pneumoniae with the nucleotide sequence of SEQ ID No.1 as the detection template (plasmid standard).

[0070] The recombinant plasmid pUC57-KP is a recombinant vector obtained by inserting the DNA fragment shown in SEQ ID No.1 in the sequence listing into the EcoRV restriction endonuclease cleavage site of the pUC57 vector, while keeping other nucleotide sequences of the pUC57 vector unchanged.

[0071] The Klebsiella pneumoniae plasmid pUC57-KP was synthesized by Bomed Biotechnology Company, and the plasmid concentration was: 200 ng / μL. The plasmid length was 3076 bp.

[0072] Copy number calculation formula: 6.02×10 23 ×200 (ng / μL) ×10 -9 / 3076×660=5.9×10 10 copies / μL

[0073] Dilution: According to the converted copy numbers, gradient dilutions are performed to 10 9 copies / μL, 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0074] II. Design of PCR primers

[0075] Design a primer pair for specifically amplifying the specific DNA fragment of Klebsiella pneumoniae against the specific DNA fragment of Klebsiella pneumoniae (SEQ ID No. 1).

[0076] Have a T7 transcription sequence (T7 phage promoter fragment) at the 5' end of the primer, so that the double-stranded DNA (dsDNA) obtained by PCR amplification can be recognized by T7 RNA polymerase and transcribed. The primer sequences are shown in Table 1 and are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0077] Table 1. PCR amplification primers for the specific DNA fragment of Klebsiella pneumoniae

[0078] Name Sequence (5’-3’) KP-F1 <![CDATA aattctaatacgactcactataggg caccagcagacgaacttcc]]> KP-F2 <![CDATA aattctaatacgactcactataggg cccaccaccagcagacgaa]]> KP-F3 <![CDATA aattctaatacgactcactataggg tcttgttggcctcgcccacc(SEQ ID No.2)]]> KP-R1 Atgctacttatcccgacagc KP-R2 ccgacagcccggagcgtttt KP-R3 ggagcgtttttcaatcggcg(SEQ ID No.3)

[0079] Note: The underlined part in Table 1 is the T7 transcription sequence.

[0080] III. PCR amplification

[0081] Using the plasmid standard pUC57-KP obtained in Step 1 as a template, perform PCR amplification with the 3 pairs of primers designed in Table 1 to obtain the PCR amplification product (KP amplification product). The PCR amplification system is shown in Table 2.

[0082] Table 2. PCR amplification system

[0083] Name Volume Template pUC57-KP 1μL KP-F (10μM) 2μL KP-R (10μM) 2μL 2×Taq mix 14.5μL <![CDATA[ddH 2 O]]> 5.5μL Total volume 25μL

[0084] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, with 35 cycles, and final extension at 72°C for 10 min. The PCR amplification product was the KP amplification product.

[0085] IV. Screening of PCR Primers

[0086] Using the plasmid standard pUC57-KP obtained in Step 1 at a concentration of 10 3 copies / μL as a template, PCR amplification was performed using the method described in Step 3. The primers were the primer combinations shown in Table 1, in the forms of F1R1 (primer KP-F1 and primer KP-R1), F2R2 (primer KP-F2 and primer KP-R2), and F3R3 (primer KP-F3 and primer KP-R3), to obtain PCR amplification products. An amplification product with water as a template was set as a negative control.

[0087] After PCR, 5 μL of the amplification product was taken, 1 μL of 6× Loading Buffer was added, and after mixing, agarose gel electrophoresis was performed for detection.

[0088] The detection results were as Figure 1 shown. Figure 1 In the lanes from left to right in the figure were F1R1 (primer KP-F1 and primer KP-R1), normal control (water), F2R2 (primer KP-F2 and primer KP-R2), normal control (water), F3R3 (primer KP-F3 and primer KP-R3), normal control (water), showing the agarose gel electrophoresis results of the PCR amplification products. The results showed that the primer combination (primer pair) of primer KP-F3 and primer KP-R3 had a higher amplification efficiency. Primer KP-F3 and primer KP-R3 were used as the best amplification primer pair for the amplification of the specific DNA fragment of Klebsiella pneumoniae KP.

[0089] The primer pair screened for the specific amplification of the specific DNA fragment of Klebsiella pneumoniae was composed of primer KP-F3 and primer KP-R3. The primer KP-F3 was a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No.2; the primer KP-R3 was a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No.3.

[0090] Example 2 Design and Screening of crRNA

[0091] I. Design of crRNA

[0092] According to the PCR amplification primers (primer KP-F3 and primer KP-R3) screened in Example 1 and the sequence alignment analysis results, 5 crRNAs were designed for the Klebsiella pneumoniae specific DNA fragment (SEQ ID No.1): KP-crRNA-1, KP-crRNA-2, KP-crRNA-3, KP-crRNA-4, KP-crRNA-5.

[0093] Among them, the target sequence of KP-crRNA-1 is: cacacttctggatagccctccagcacgt, which is located in the Klebsiella pneumoniae specific DNA fragment; the target sequence of KP-crRNA-2 is: acttctggatagccctccagcacgtaga, which is located in the Klebsiella pneumoniae specific DNA fragment; the target sequence of KP-crRNA-3 is: tccacacttctggatagccctccagcac, which is located in the Klebsiella pneumoniae specific DNA fragment; the target sequence of KP-crRNA-4 is: cttctggatagccctccagcacgtagat, which is located in the Klebsiella pneumoniae specific DNA fragment; the target sequence of KP-crRNA-5 is: cacttctggatagccctccagcacgtag, which is located in the Klebsiella pneumoniae specific DNA fragment.

[0094] The crRNAs named KP-crRNA-1 (crRNA1), KP-crRNA-2 (crRNA2), KP-crRNA-3 (crRNA3), KP-crRNA-4 (crRNA4) and KP-crRNA-5 (crRNA5) were prepared by in vitro transcription through PCR amplification. The amplification primer pairs for the KP-crRNA-1 gene are T7-crRNA-F and KP-crRNA1-R, the amplification primer pairs for the KP-crRNA-2 gene are T7-crRNA-F and KP-crRNA2-R, the amplification primer pairs for the KP-crRNA-3 gene are T7-crRNA-F and KP-crRNA3-R, the amplification primer pairs for the KP-crRNA-4 gene are T7-crRNA-F and KP-crRNA4-R, and the amplification primer pairs for the KP-crRNA-5 gene are T7-crRNA-F and KP-crRNA5-R. The templates and primers required for the preparation of the 5 crRNAs are shown in Table 3 below.

[0095] Table 3. Templates and primer sequences required for the preparation of crRNA

[0096]

[0097] II. Preparation of crRNA

[0098] 1. PCR Amplification

[0099] Dilute the primers synthesized in Table 3 with ddH 2 O to 10 μM and prepare the PCR reaction system. The PCR reaction system is shown in Table 4 as follows.

[0100] Table 4. PCR Amplification System

[0101]

[0102]

[0103] When KP-crRNA (template) is KP-crRNA-1 template, KP-crRNA-R is KP-crRNA1-R; when KP-crRNA (template) is KP-crRNA-2 template, KP-crRNA-R is KP-crRNA2-R; when KP-crRNA (template) is KP-crRNA-3 template, KP-crRNA-R is KP-crRNA3-R; when KP-crRNA (template) is KP-crRNA-4 template, KP-crRNA-R is KP-crRNA4-R; when KP-crRNA (template) is KP-crRNA-5 template, KP-crRNA-R is KP-crRNA5-R.

[0104] The PCR reaction conditions are as follows: heat denaturation at 95 °C for 5 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, for a total of 35 cycles; automatic extension at 72 °C for 10 min; store the PCR product at 4 °C.

[0105] 2. Purification of PCR Products

[0106] Purify the PCR products obtained in Step 1 using Tris-buffered phenol. The specific steps are as follows: Take 500 μL of Tris-buffered phenol (HaoYang Bio), add an equal volume of chloroform, mix well by shaking and then centrifuge briefly, discard the supernatant to obtain the phenol-chloroform mixture; Take 130 μL of the phenol-chloroform mixture and add it to the PCR products, mix well and centrifuge at 12,000 rpm for 1 min; Take the supernatant to a new 1.5 mL centrifuge tube, add absolute ethanol so that the volume ratio of supernatant to ethanol is 3:7, shake, centrifuge at 12,000 rpm for 10 min, and discard the supernatant; Add 200 μL of 75% ethanol, centrifuge at 12,000 rpm for 10 min, and discard the supernatant (this step is carried out three times in total). Let the obtained precipitate dry at room temperature (about 10 min), add 40 μL of RNase-free water, detect the concentration using a ND5000 ultra-micro spectrophotometer, and store at -20 °C.

[0107] 3. Transcription

[0108] Take 1 μg of the purified PCR product obtained in step 2 and transcribe crRNA using the T7 transcription kit (NEB, product number E2050S). The crRNA transcription system is shown in Table 5.

[0109] Table 5. crRNA transcription system

[0110] Name Volume NTP Mix 10μL PCR product 1μg T7 RNA polymerase 2μL Nuclease-free water Up to 20μL Total volume 20μL

[0111] After mixing the above crRNA transcription system, transcribe overnight at 37 °C, and use DNase I to remove the excess DNA to obtain the transcription product: Add 20 μL of RNase-free water to the obtained transcription product, add 2 μL of DNase I, mix well, and incubate at 37 °C for 15 min to obtain crRNA.

[0112] 4. Purification of crRNA

[0113] Purify the crRNA obtained by transcription in step 3 according to the Agencourt RNA Clean XP instruction manual (Beckman Coulter). The specific steps are as follows: Vortex the magnetic beads to mix well, add 1.8 times the volume of magnetic beads to the transcription product, pipette 10 times or vortex for 30 s to mix the magnetic beads and the transcription system, and let it stand at room temperature for 5 min. Place the reaction system on the magnetic rack and let it stand for 5 - 10 min to separate the magnetic beads. Gently aspirate the liquid in the system, avoiding aspirating the magnetic beads. Add 200 μL of 70% ethanol (prepared with RNase-free water) to the magnetic beads, incubate at room temperature for 30 s, and aspirate the ethanol; repeat this process to wash the magnetic beads, a total of 3 times. Air-dry the system at room temperature to remove the ethanol in the system for about 10 min. Add 50 μL of RNase-free water, vortex for 30 s or pipette 10 times, aspirate the supernatant, place it in a 1.5 mL RNase-free centrifuge tube, and measure the concentration of the purified crRNA with an ND5000 spectrophotometer, and store it in aliquots at -80 °C. A total of 5 types of crRNA are obtained.

[0114] III. Screening of crRNA

[0115] 1. Using the plasmid standard pUC57-KP obtained in step 1 of Example 1 at 10 3 copies / μL as a template, and the primers KP-F3 and KP-R3 in Table 1) (SEQ ID No. 2 and SEQ ID No. 3) as primers, perform PCR amplification according to the method in step 3 of Example 1 to obtain the PCR amplification product.

[0116] 2. After PCR amplification, take 5 μL of the amplification product and detect Klebsiella pneumoniae using different crRNAs according to the method in Example 3, and at the same time set the amplification product with water as a template as a negative control.

[0117] The detection results showed that when using the KP plasmid at a concentration of 10 3 as a template, the fluorescence value detected by the combination of KP-crRNA-1 and the PCR amplification product was higher than that detected by the other 4 crRNAs ( Figure 2 ). Therefore, KP-crRNA-1 was used as the preferred crRNA for Klebsiella pneumoniae detection. KP-crRNA-1 (crRNA1) is an RNA molecule with the nucleotide sequence of SEQ ID No.4.

[0118] SEQ ID No.4: 5’-GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACACGUGCUGGAGGGCUAUCCAGAAGUGUG-3’;

[0119] Example 3 Detection of Klebsiella pneumoniae by CRISPR-Cas13a

[0120] I. Preparation of the CRISPR-Cas13a detection system

[0121] Prepare the CRISPR-Cas13a detection system according to Table 6.

[0122] Replace the template in Table 6 with ddH 2 O, and keep other reagent components unchanged, which is the negative control.

[0123] Table 6. CRISPR-Cas13a detection system

[0124]

[0125]

[0126] The relevant reagents in Table 6: The template is the KP amplification product obtained by PCR amplification using F3R3 (primer KP-F3 and primer KP-R3 in Table 1) with the plasmid standard pUC57-KP at a concentration of 10 3 copies / μL as a template; The LwCas13a protein is from Hangzhou Zhongce Biotechnology Co., Ltd., with the product number R101zc. The NTP Mix is a product of BBI company, with the product number B600056-0500. The reporter RNA is RNaseAlert TM QC System v2, specifically Invitrogen TMThe company's product, with the product number 4479769, contains reporter RNA (single-stranded RNA linked to the fluorescent group FAM), which will produce a fluorescent signal when degraded. The RNase inhibitor (Murine RNase inhibitor) and T7 RNA polymerase are products of NEB company, with the product numbers M0314S and M0251S respectively. The HEPES Buffer Solution is specifically a product of gibco company, with the product number 15630-106.

[0127] II. Fluorescence intensity detection

[0128] Add the above-prepared reaction system into a PCR tube and place it in a fluorescence quantitative PCR instrument to detect the change of fluorescence signal in the FAM channel. Set the temperature at 37°C, read the fluorescence intensity value every 2 minutes, and read it 30 times. Result determination: Within the same detection time, if the fluorescence intensity value is more than 1 time higher than that of the negative control (ddH 2 O), it is determined as a positive result (positive signal); if the fluorescence intensity value is not higher than 1 time that of the negative control (ddH 2 O), it is determined as a negative result (negative signal).

[0129] Furthermore, determine whether Klebsiella pneumoniae is contained in the test sample according to the presence or absence of a positive signal, and / or determine the concentration of Klebsiella pneumoniae in the test sample according to the strength of the positive signal:

[0130] (1) If there is a positive signal, it is determined that the test sample contains or potentially contains Klebsiella pneumoniae; if there is no positive signal, it is determined that the test sample does not contain or potentially does not contain Klebsiella pneumoniae;

[0131] (2) The stronger the positive signal, the higher the content of Klebsiella pneumoniae in the test sample; the weaker the positive signal, the lower the content of Klebsiella pneumoniae in the test sample.

[0132] Example 4 Sensitivity and specificity experiments

[0133] I. Sensitivity detection

[0134] Use the amplification product of the plasmid standard pUC57-KP after gradient dilution in Example 1 as a template, and detect the sensitivity of the method of the present invention according to the method in Example 3. The specific steps are as follows:

[0135] 1. Using the method in Step 3 of Example 1, PCR amplification was performed on the gradient-diluted Klebsiella pneumoniae plasmid standard pUC57-KP using F3R3 (primer KP-F3 and primer KP-R3 in Table 1) to obtain PCR amplification products. The copy numbers of the gradient-diluted plasmid standard pUC57-KP were 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0136] 2. Taking 5 μL of the above amplification products for detection according to the method in Example 3, and at the same time setting the amplification product with water as the template as a negative control. Replace the templates in Table 6 with the amplification products (Step 1) of plasmid standard pUC57-KP with 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL respectively, and the other operations were the same as in Example 3. The results showed that at 1 copy / μL, when detected for 30 min, a significant difference in fluorescence value could occur compared with the negative control, indicating that the sensitivity of the method of the present invention was good and could be as low as 1 copy / μL( Figure 3 ).

[0137] II. Specificity Detection

[0138] Klebsiella pneumoniae, Escherichia coli, Acinetobacter baumannii, and Pseudomonas aeruginosa strain samples (from clinical specimens) were obtained from the clinical laboratory of Beijing You'an Hospital Affiliated to Capital Medical University, and nucleic acids were extracted as detection templates, and detection was carried out according to the method in Example 3 to verify the specificity of the method of the present invention. The specific steps are as follows:

[0139] (1) Genomic DNAs of Klebsiella pneumoniae, Escherichia coli, Acinetobacter baumannii, and Pseudomonas aeruginosa were respectively extracted as detection templates, and PCR amplification was respectively performed using F3R3 (primer KP-F3 and primer KP-R3 in Table 1) according to the method in Step 3 of Example 1 to obtain Klebsiella pneumoniae PCR amplification products, Escherichia coli PCR amplification products, Acinetobacter baumannii PCR amplification products, and Pseudomonas aeruginosa PCR amplification products.

[0140] (2) Take 5 μL of the above amplification product and detect it according to the method in Example 3. At the same time, set the amplification product with water as the template as the negative control. Replace the templates in Table 6 with the PCR amplification products of Klebsiella pneumoniae, Escherichia coli, Acinetobacter baumannii, and Pseudomonas aeruginosa respectively, and the other operations are the same as those in Example 3.

[0141] The CRISPR-Cas13a detection results showed that the fluorescence signal in the Klebsiella pneumoniae reaction group gradually increased after the start of the reaction, while the fluorescence intensity in the negative control group (ddH 2 O) and the non-Klebsiella pneumoniae reaction group did not increase over time. After 60 minutes of detection, the fluorescence intensity in the Klebsiella pneumoniae reaction group was significantly higher than that in the negative control, all of which were positive results, and all of the non-Klebsiella pneumoniae reaction groups were negative results (the fluorescence intensity was the same as that in the negative control)( Figure 4 ). This indicates that the method for detecting Klebsiella pneumoniae based on the CRISPR-Cas13a system of the present invention has high specificity and there is no cross-reaction during the detection process.

[0142] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use, or improvement of the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. A composition for detecting Klebsiella pneumoniae, characterized in that, the composition comprises a primer pair for specifically amplifying a specific DNA fragment of Klebsiella pneumoniae and a crRNA, the sequence of the crRNA comprises an anchoring sequence for binding to the Cas13a protein and a guide sequence targeting the specific DNA fragment of Klebsiella pneumoniae, the guide sequence is positions 39-66 of SEQ ID No. 4, the primer pair consists of primer KP-F3 and primer KP-R3, and primer KP-F3 is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No. 2; the primer KP-R3 is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID No.

3.

2. The composition according to claim 1, characterized in that, the nucleotide sequence of the crRNA is SEQ ID No.

4.

3. A kit for detecting Klebsiella pneumoniae, characterized in that, the kit comprises the composition according to claim 1 and / or 2.

4. The kit according to claim 3, characterized in that, the kit further comprises Cas13a protein.

5. The kit according to claim 3 or 4, characterized in that, the kit further comprises reporter RNA.

6. The crRNA described in claim 1 or 2.

7. A complex of the crRNA described in claim 1 or 2 and Cas13a protein.

8. A method for detecting Klebsiella pneumoniae, characterized in that, the method comprises the following steps: A1) Extracting the DNA of the sample to be tested; A2) Using the DNA as a template, performing PCR amplification with primer KP-F3 and primer KP-R3 described in claim 3 to obtain an amplification product; A3) Detecting using a CRISPR-Cas13a detection system; the CRISPR-Cas13a detection system comprises the crRNA described in claim 1 or 2.

9. The method according to claim 8, characterized in that, the CRISPR-Cas13a detection system further comprises Cas13a protein and / or transcriptase.

10. The composition described in claim 1 or 2, and / or, the crRNA described in claim 6 or the complex described in claim 7 is used in any of the following applications: B1) Application in detecting Klebsiella pneumoniae; B2) Application in preparing a product for detecting Klebsiella pneumoniae; B3) Application in identifying or assisting in identifying Klebsiella pneumoniae; B4) Application in preparing a product for identifying or assisting in identifying Klebsiella pneumoniae; B5) Application in identifying or assisting in identifying whether the sample to be tested is or contains Klebsiella pneumoniae; B6) Application in preparing a product for identifying or assisting in identifying whether the sample to be tested is or contains Klebsiella pneumoniae; B7) Application in screening or assisting in screening drugs for preventing and treating Klebsiella pneumoniae; B8) Application in preparing a product for screening or assisting in screening drugs for preventing and treating Klebsiella pneumoniae; B9) Application in diagnosing or assisting in diagnosing diseases caused by Klebsiella pneumoniae infection; B10) Use in the preparation of a product for diagnosing or assisting in the diagnosis of a disease caused by Klebsiella pneumoniae infection; B11) Use in the therapeutic monitoring of a disease caused by Klebsiella pneumoniae infection; B12) Use in the preparation of a product for the therapeutic monitoring of a disease caused by Klebsiella pneumoniae infection.

Images