Molecular marker of rice pre-harvest sprouting gene SD6 and application of molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker of a rice pre-harvest sprouting related gene SD6 and application of the SNP molecular marker. The polymorphism of the molecular marker is C or T. The molecular marker and the rice pre-harvest sprouting phenotype are co-separated, the rice pre-harvest sprouting gene SD6 can be quickly and accurately classified by utilizing the molecular marker and combining a KASP technology, the pre-harvest sprouting ability of a plant is judged in the rice seedling stage, the breeding cost is reduced, and the breeding efficiency is improved; according to the method, tedious procedures such as enzyme digestion, electrophoresis and sequencing are not needed in the detection process, and efficient and environment-friendly application of the SD6 gene to commercial molecular breeding of rice is facilitated.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology technology and rice breeding, and particularly relates to a molecular marker of rice pre-harvest sprouting gene SD6 and its application. Background Art

[0002] Seed dormancy and germination are important characteristics for plants to adapt to the external environment and ensure their survival and reproduction. During the domestication of crops, more considerations are given to cultivation traits such as high yield, good quality, disease and pest resistance, and stress tolerance, and at the same time, it is ensured that seeds have consistent germination characteristics, while the retention of appropriate seed dormancy is often ignored, resulting in pre-harvest sprouting in many gramineous crops. Pre-harvest sprouting, also known as pre-harvest sprouting, is a phenomenon in which cereal crops germinate on the ear when encountering continuous high temperature and rainy weather in the late mature stage. In recent years, with the global warming, the rainy weather in the late mature stage of crops has led to frequent occurrence of pre-harvest sprouting disasters. Pre-harvest sprouting not only causes crop yield reduction and quality decline, but also seriously affects the seed production quality of crops.

[0003] Dormancy is a complex trait controlled by multiple genes and affected by the environment, and its phenotype is difficult to accurately identify. More than 100 related QTL loci have been identified in rice, but only a few genes such as Sdr4, qSD7-1 / Rc, and qSD1-2 / SD1 have been cloned. These genes also regulate seed coat color or plant height, etc. It is difficult to use these genes to improve rice dormancy to solve the problem of pre-harvest sprouting, and there is a lack of key gene resources for improving the existing pre-harvest sprouting of rice in production. In 2022, Nature Genetics published a research paper titled "Antagonistic control of seed dormancy in rice by two bHLH transcription factors". This research cloned a key gene SD6 that controls rice seed dormancy from the strong dormancy rice variety Kasalath by constructing a high-density chromosome single segment substitution line population that can stably detect the dormancy locus, and verified its regulatory function. At present, due to the lack of simple and effective molecular markers, the SD6 gene cannot be widely used in rice breeding, and the existing detection methods are complex, with high detection costs and great difficulties. Therefore, in the present application, the inventors provided a SNP molecular marker for detecting the rice pre-harvest sprouting gene SD6 based on KASP, providing an effective strategy for improving rice pre-harvest sprouting. Summary of the Invention

[0004] The purpose of the present invention is to provide a molecular marker of rice pre-harvest sprouting gene SD6 for genotyping of rice SD6 gene and molecular marker-assisted breeding.

[0005] Previous studies on the rice pre-harvest sprouting gene SD6 indicated that the functional locus of the SD6 gene is located in the coding region of the gene. Based on the gene sequences published in previous literature and nucleotide sequence alignment with reference genomes such as Nipponbare, 9311, Minghui 63, and Zhenshan 97, single nucleotide polymorphism (SNP) sites unique to the SD6 gene were identified.

[0006] Using Primer5 software, primers were designed for the functional SNP sites of the rice pre-harvest sprouting gene SD6, and KASP tests were performed on donor materials containing SD6 and other rice varieties without SD6.

[0007] KASP (Kompetitive Allele-Specific PCR), namely competitive allele-specific PCR, is a fluorescence-based genotyping technology for accurate allele detection of SNPs at specific loci in DNA samples.

[0008] The present invention provides primers for genotyping the rice pre-harvest sprouting gene SD6 developed based on KASP technology, including specific primer SP1, specific primer SP2, and common primer CP, and the primer sequences are shown in SEQ ID NO: 1-3 respectively.

[0009] The present invention also provides a detection reagent or kit containing the above primers.

[0010] The present invention also provides the application of the molecular marker, primer, detection reagent or kit in detecting or identifying the rice pre-harvest sprouting gene SD6.

[0011] The present invention also provides the application of the molecular marker, primer, detection reagent or kit in rice molecular marker-assisted breeding.

[0012] The present invention also provides the application of the molecular marker, primer, detection reagent or kit in breeding rice resources with resistance to pre-harvest sprouting.

[0013] The said application includes the following steps:

[0014] 1) Extract the DNA of the rice sample to be tested;

[0015] 2) Take 1.3 μL of DNA, 0.1 μL each of 10 μM specific primers SP1 and SP2, 0.3 μL of 10 μM common primer CP, 5 μL of 2×KASP Master Mix, and 3.2 μL of ddH 2 O, mix well and perform PCR amplification;

[0016] 3) Detect the genotype of PCR amplification products with the ABI fluorescence quantitative PCR instrument 7500 FAST;

[0017] Further, the PCR reaction conditions in step 2 are: pre-denaturation at 95 °C for 10 minutes; the first amplification reaction: denaturation at 95 °C for 15 seconds, annealing and extension at 65 °C to 57 °C for 60 seconds, 10 cycles, and the temperature of annealing and extension decreases by 0.8 °C for each cycle;

[0018] The second amplification reaction, denaturation at 95 °C for 15 seconds, annealing and extension at 57 °C for 60 seconds, 35 cycles.

[0019] The third fluorescence detection, reading fluorescence at 30 °C for 1 minute.

[0020] Further, step 3 is specifically: use the built-in software 7500 Software V2.3 of ABI 7500 FAST to type the PCR amplification products. If only the fluorescence signal (FAM) corresponding to the specific primer SP1 is detected in the PCR products of the sample, the detected site is base C, and the tested rice sample is determined to be homozygous for the pre-harvest sprouting tolerance sd6 genotype; if only the fluorescence signal (VIC) corresponding to the specific primer SP2 is detected, the detected site is base T, and the tested rice sample is determined to be homozygous for the non-pre-harvest sprouting SD6 genotype; if both fluorescence signals are detected simultaneously, the detected site is C:T (FAM:VIC), and the tested rice is judged to be heterozygous for the non-pre-harvest sprouting SD6 / sd6 genotype.

[0021] Use the molecular marker of the pre-harvest sprouting tolerance SD6 of rice provided by the present invention to detect the SD6 gene locus of rice varieties, and finally confirm the allelic types of the SD6 gene in the tested rice varieties.

[0022] The molecular marker provided by the present invention has the characteristics of stable amplification and high detection efficiency. The method has the advantages of simple operation, low cost, short cycle, good stability, etc. It can be selected in the low generation, shortening the breeding years, greatly accelerating the breeding process, saving production costs, improving breeding efficiency, realizing the identification of the target gene in rice germplasm resources and breeding offspring, and has important significance for the improvement of rice pre-harvest sprouting tolerance. Description of the Drawings

[0023] The drawings here are incorporated into the specification and constitute a part of this specification, showing the embodiments in line with the present invention, and are used together with the specification to explain the principles of the present invention.

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 This is the nucleotide sequence alignment diagram of the rice pre-harvest sprouting gene SD6 of the present invention.

[0026] Figure 2 This is the genotyping diagram of rice varieties detected by the molecular marker of the rice pre-harvest sprouting gene SD6 in Example 2 of the present invention. Detailed implementation manners

[0027] In order to more clearly understand the above objects, features and advantages of the present invention, the solutions of the present invention will be further described below. It should be noted that, without conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other.

[0028] Many specific details are set forth in the following description in order to fully understand the present invention, but the present invention can also be implemented in other ways different from those described herein; obviously, the embodiments in the specification are only a part of the embodiments of the present invention, rather than all of the embodiments.

[0029] The preferred embodiments of the present invention will be described in detail below in conjunction with the embodiments. It should be understood that the following embodiments are given only for the purpose of illustration, and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods.

[0031] Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels.

[0032] Example 1 Obtaining of the molecular marker of the rice pre-harvest sprouting tolerance gene SD6

[0033] This embodiment is used to illustrate the application of the molecular marker provided by the present invention in detecting the rice pre-harvest sprouting tolerance gene SD6. The specific steps are as follows:

[0034] According to the previous literature, the 200bp nucleotide sequences (SEQ ID NO.4) on both sides of the functional SNP locus of the rice pre-harvest sprouting tolerance gene SD6 were aligned with the sequences publicly disclosed in the literature, the NCBI databases of varieties such as Nipponbare, 9311, Minghui 63, and Zhenshan 97 (see Figure 1 ), and Primer5 was used for primer design. Each group of markers has three primers, and the primers were entrusted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0035] Table 1 Molecular markers and their primer information

[0036] Genome database IRGSP-1.0 (Nipponbare) SNP position Chr6:3275343 Nucleotide sequence of specific primer 1 (SP1) gaaggtgaccaagttcatgctGTGGTAACAACGTCACAGTGGC Nucleotide sequence of specific primer 2 (SP2) gaaggtcggagtcaacggattGGTGGTAACAACGTCACAGTGGT Nucleotide sequence of common primer (CP) GAGCTCCTGAGCTTTGGTTCAC

[0037] The molecular marker designed based on the KASP reaction principle and the single-base difference of rice pre-harvest sprouting-resistant materials can detect the rice pre-harvest sprouting-resistant SD6 gene with high throughput. If only FAM fluorescence is detected in the sample, the corresponding specific primer is SP1; if only HEX fluorescence is detected, the corresponding specific primer is SP2; if both fluorescences are detected simultaneously, the base at this locus is in a heterozygous state.

[0038] Example 2 Application of the molecular marker of rice pre-harvest sprouting-resistant SD6 gene

[0039] Extract genomic DNA from rice leaves by CTAB method: Sampling is placed into a 1.2 mL 96-well plate, two 4 mm steel beads are added, and after quick freezing in liquid nitrogen, it is broken by wall at 45 Hz for 35 seconds; after opening the lid, 300 μL of CTAB solution and chloroform are respectively added, and after mixing evenly, it is left standing at room temperature for 10 minutes; centrifuge at 4000 rmp for 15 min, take 90 μL of the supernatant and transfer it to a 0.2 mL 96-well PCR plate; add an equal volume of isopropanol solution and gently shake to mix evenly, precipitate at -20 °C for more than 1 hour, centrifuge at 4000 rmp for 15 min, and discard the supernatant; add 100 μL of 75% ethanol, invert up and down to mix evenly, centrifuge at 4000 rmp for 10 min, and discard the supernatant; dry overnight, add 100 μL of H2O to dissolve DNA for standby;

[0040] Add DNA samples, primer sets, Mix and ddH 2 O to the 96-well PCR reaction plate, and the reaction system is shown in Table 2.

[0041] Table 2 Reaction system for KASP detection

[0042]

[0043] PCR amplification is completed in the fluorescence quantitative PCR instrument 7500 FAST, and the Touchdown PCR reaction conditions are: pre-denaturation at 95 °C for 10 minutes; the first amplification reaction, denaturation at 95 °C for 15 seconds, annealing and extension at 65 °C - 57 °C for 60 seconds, 10 cycles, and the temperature of annealing and extension decreases by 0.8 °C for each cycle; the second amplification reaction, denaturation at 94 °C for 15 seconds, annealing and extension at 57 °C for 60 seconds, 35 cycles. After the reaction is completed, read the fluorescence data of the KASP reaction product at 30 °C for 1 minute, and the result of fluorescence scanning will be automatically converted into a graph (the KASP Master Mix used in the present invention is purchased from LGC Company, UK).

[0044] Perform KASP detection on rice varieties using the molecular marker of rice pre-harvest sprouting-resistant SD6 gene, and the results are shown in Table 3. The detection result of the donor variety Kasalath of the SD6 gene is base C (see Figure 2 ).

[0045] The experimental results show that the molecular markers designed in this patent can well distinguish whether the SD6 gene is contained in different rice varieties, and can accurately genotype, so as to determine the pre-harvest sprouting ability of plants at the seedling stage of rice, reduce the breeding cost, and improve the breeding efficiency.

[0046] Table 3 Genotyping data of rice varieties by the molecular marker of the pre-harvest sprouting gene SD6 in rice

[0047]

[0048]

[0049] The above are only specific embodiments of the present invention, which enable those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be obvious to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments described herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of SNP molecular marker of a rice pre-harvest sprouting related gene SD6 in genotyping of SD6 gene It is characterized in that: The polymorphism of the SNP marker is C / T, and the SNP locus of the SNP molecular marker is located at 3275343 on chromosome 6 of the genomic database of rice variety Nipponbare (IRGSP-1.0).

2. A primer set for SNP molecular markers related to genes associated with pre-harvest sprouting of rice SD6 ​ It is characterized in that The primer set includes two specific primers (SP1 and SP2) and a universal primer CP, wherein the nucleotide sequences of the specific primers are shown in SEQ ID NO. 1-2, and the nucleotide sequence of the universal primer is shown in SEQ ID NO.

3.

3. Use of the primer set according to claim 2 in the preparation of a detection reagent or kit for detecting SD6 gene.

4. For detecting SD6 the detection reagent or kit for genes, It is characterized in that It includes the primer set described in claim 2.

5. A method for detecting the SNP molecular marker as described in claim 1 It is characterized in that It includes the following steps: 1) Extract the genomic DNA of the leaves of the rice plant to be tested; 2) Using the genomic DNA of the rice plant to be tested as a template, use the primer set described in claim 2 to perform PCR amplification to detect the polymorphism of the SNP molecular marker locus described in claim 1; 3) According to the genotype of the detected SNP molecular marker locus, determine whether the plant to be tested is a rice variety resistant to pre-harvest sprouting.

6. The detection method as described in claim 5 It is characterized in that The KASP technology is used to detect the SNP locus.

7. According to the method described in claim 5 It is characterized in that The reaction system for PCR detection is calculated based on a total volume of 10 μL and includes: 1.3 μL of template DNA, 0.1 μL each of 100 μM specific primers SP1 and SP2, 0.3 μL of 100 μM universal CP primer, 5 μL of 2×KASP Master Mix, and 3.2 μL of ddH2O.

8. According to the method described in claim 5 or 6 or 7 It is characterized in that The reaction program for PCR detection is pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 15 seconds, annealing and extension at 65°C to 57°C for 60 seconds, 10 cycles, and the temperature of annealing and extension decreases by 0.8°C for each cycle; denaturation at 95°C for 15 seconds, annealing and extension at 57°C for 60 seconds, 35 cycles; reading fluorescence at 30°C for 1 minute.

9. According to the method described in claim 5 It is characterized in that: If the SNP molecular marker genotype of the rice plant to be tested described in claim 1 is detected as C / C, it indicates that the rice plant to be tested is homozygous for preharvest sprouting resistance. sd6 If the genotype is detected as T / T, it indicates that the plant to be tested is homozygous for preharvest sprouting susceptibility. SD6 If the genotype is detected as C / T, it indicates that the rice plant to be tested has a heterozygous genotype. SD6 / sd6 rice plant.

10. The application of the primer set described in claim 2 or the detection reagent or kit described in claim 4 or the method described in any one of claims 5-8 in any of the following aspects: 1) Identify or assist in identifying genes related to pre-harvest sprouting in rice SD6 ; 2) Molecular marker-assisted breeding of rice

Images