DCAPS molecular marker for detecting moisture content and dehydration rate of corn kernels and application of dCAPS molecular marker
GWAS was used to identify the gene ZmNAD related to corn grain moisture content and dehydration rate, and develop dCAPS molecular markers, which solved the problems of high detection costs and long cycles in the prior art, and achieved efficient and economical identification of corn grain moisture content and dehydration rate.
Patent Information
- Application Number
- CN202510408889.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-02
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2045-04-02
AI Technical Summary
The prior art is difficult to efficiently detect the moisture content and dehydration rate of corn grains in large quantities, resulting in the failure of functional SNP to be effectively applied.
The gene ZmNAD, which controls the moisture content and dehydration rate of corn grains, was identified through GWAS, and the dCAPS molecular marker ZmNAD-SNP1-Sac1 was developed, which simplified the detection technology of SNP and reduced the detection cost.
It has achieved efficient identification of varieties with low moisture content and high dehydration rate in corn grains, which has reduced the detection cost, shortened the detection cycle and improved the detection efficiency.
Smart Images

Figure CN120119030A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of maize molecular breeding, and particularly to a dCAPS molecular marker for detecting the moisture content and dehydration rate of maize kernels and its application. Background Art
[0002] Maize (Zea mays L.) is the most widely planted grain and forage crop in China. To further improve production efficiency and reduce production costs, mechanized grain harvesting has become a key technology for maize production. However, due to the high moisture content of maize ears at harvest, it not only causes grain mildew and deterioration but also limits maize mechanized harvesting. During the natural drying process from maize maturity to harvest, the initial moisture content of mature kernels and the dehydration rate in the field environment jointly determine the final moisture content at harvest. Therefore, breeding maize hybrids with low moisture content and high dehydration rate in mature kernels can promote mechanical harvesting, improve threshing efficiency, and reduce additional drying costs and shrinkage losses, which is a key measure to achieve maize mechanical harvesting.
[0003] Genome-wide association studies (GWAS) is an effective tool for analyzing the genetic structure of complex quantitative traits. In recent years, researchers have identified some single nucleotide polymorphisms (SNPs) related to traits such as moisture content and dehydration rate through GWAS. Li et al. (Li et al. 2021) conducted GWAS on the grain moisture content of 513 maize inbred lines and revealed 71 SNPs affecting maize grain moisture. Zhang et al. (Zhang et al. 2020) conducted GWAS on 310 maize inbred lines and identified a total of 16 SNPs significantly related to the grain moisture content at harvest. Li et al. (Li et al. 2020) identified 27 SNPs related to grain moisture content and dehydration rate in maize through GWAS. Among these SNPs affecting maize grain moisture content and dehydration rate, there are a large number of functional SNPs, all of which can be applied to molecular marker-assisted selection breeding for maize grain moisture content and dehydration rate.
[0004] However, the current single nucleotide detection technology is costly and has a long cycle, which is not suitable for detecting a large number of materials, resulting in poor application of these reported functional SNPs. Therefore, there is an urgent need to provide a method for adapting the above-mentioned functional SNPs to the detection of a large number of materials. Summary of the Invention
[0005] The object of the present invention is to provide a dCAPS molecular marker for detecting the moisture content and dehydration rate of maize kernels and its application, so as to solve the problems existing in the above-mentioned prior art. The present invention identified a gene ZmNAD that controls the moisture content and dehydration rate of maize kernels at maturity through GWAS, and transformed the significant SNP of the gene ZmNAD into a dCAPS molecular marker, simplifying the detection technology of this SNP and reducing the detection cost of identifying maize kernel varieties or genotypes with low moisture content and high dehydration rate.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a dCAPS molecular marker for detecting the moisture content and dehydration rate of maize kernels. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The K at the 300th position of this sequence represents polymorphism, which is T or G.
[0008] Preferably, a 199bp band is amplified using the dCAPS molecular marker primer pair in maize genomic DNA. Among them, after the amplified band of maize kernel varieties with low moisture content and high dehydration rate is digested with Sac 1 enzyme, bands of 170bp and 29bp are produced; after the amplified band of maize kernel varieties with high moisture content and low dehydration rate is digested with Sac 1 enzyme, a 199bp band is obtained;
[0009] Among them, the nucleotide sequence of the forward primer of the dCAPS molecular marker primer pair is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5.
[0010] The present invention also provides a primer pair for detecting the above dCAPS molecular marker. The nucleotide sequence of the forward primer of the primer pair is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5.
[0011] The present invention also provides an application of the above primer pair in the preparation of a product for detecting the above dCAPS molecular marker.
[0012] The present invention also provides a kit for detecting the above dCAPS molecular marker, including the above primer pair.
[0013] Preferably, it also includes the restriction endonuclease Sac 1.
[0014] The present invention also provides an application of the above dCAPS molecular marker, the above primer pair or the above kit in identifying maize kernel varieties with low moisture content and high dehydration rate.
[0015] The present invention also provides an application of the above-mentioned dCAPS molecular marker, the above-mentioned primer pair or the above-mentioned kit in molecular marker-assisted selection breeding for maize kernel moisture content and dehydration rate.
[0016] The present invention also provides a method for identifying maize varieties with low kernel moisture content and high dehydration rate, comprising the following steps:
[0017] Extract the DNA of the maize sample to be tested;
[0018] Using the above-mentioned primer pair to amplify with the said DNA as a template, and collect the amplification products;
[0019] Digest the amplification products and perform electrophoresis detection on the digested products;
[0020] Judge according to the electrophoresis results. If only a 170bp band exists in the electrophoresis results, it is a maize variety with low kernel moisture content and high dehydration rate.
[0021] Preferably, the enzyme used for digestion is the restriction endonuclease Sac 1.
[0022] The present invention discloses the following technical effects:
[0023] The present invention conducts GWAS in 425 inbred lines, determines the key gene ZmNAD that controls maize kernel moisture content and dehydration rate at maturity. Based on the association analysis of the gene ZmNAD, significant SNPs related to kernel moisture content and dehydration rate are identified, and then a dCAPS molecular marker ZmNAD-SNP1-Sac1 with a sequence as shown in SEQ ID NO.1 and a primer pair with sequences as shown in SEQ ID NOs.4-5 are developed. The dCAPS molecular marker and its primer pair provided by the present invention can be applied to the identification and molecular marker-assisted selection breeding of maize varieties with low kernel moisture content and high dehydration rate, can effectively save the detection cost, shorten the cycle, and improve the detection efficiency. The present invention provides a new technical means for screening maize materials with low kernel moisture content and high dehydration rate, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0025] Figure 1It is a haplotype analysis result diagram based on ZmNAD association analysis. Among them, A: The grain moisture content of Hap1 and Hap2 in three environments of Wenjiang, Sichuan, Chongzhou, Sichuan, and Jinghong, Yunnan; B: The moisture content change index of Hap1 and Hap2 in three environments of Wenjiang, Sichuan, Chongzhou, Sichuan, and Jinghong, Yunnan; * indicates P<0.05, ** indicates P<0.01;
[0026] Figure 2 It is a PCR amplification and enzyme digestion electrophoresis result diagram of the molecular marker ZmNAD-SNP1-Sac1. Among them, A: The electrophoresis result of the PCR amplification product without Sac1 enzyme digestion; B: The electrophoresis result of the PCR amplification product after Sac1 enzyme digestion;
[0027] Figure 3 It is a verification result diagram of the molecular marker ZmNAD-SNP1-Sac1 in materials with known genotypes. Among them, A: The electrophoresis verification result of the molecular marker accuracy; Lanes 1-7 are Mo4, Mo12, Mo15, Mo32, Mo33, Mo37, Mo49; Lanes 8-14 are Mo6, Mo13, Mo14, Mo17, Mo18, Mo22, Mo26; B: The grain moisture content of Hap1 and Hap2; C: The moisture content change index of Hap1 and Hap2; * indicates P<0.05, ** indicates P<0.01; Detailed implementation manners
[0028] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0029] It should be understood that the terms described in the present invention are only for describing special implementation manners and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0030] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.
[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0033] Example 1 Identification of ZmNAD gene controlling corn kernel moisture content and dehydration rate using GWAS
[0034] 1.1 Population planting and phenotypic data acquisition for association analysis
[0035] The association analysis population containing 425 inbred lines was planted in three environments: Chongzhou, Sichuan, Jinghong, Yunnan, and Wenjiang, Sichuan. Each environment was set up with 3 replications according to the random block standard. Each inbred line was planted in 3 rows, with a row length of 3 meters, a row spacing of 0.8 meters, 14 plants per row, and a density of about 58,000 plants / hectare. Conventional field management methods were used for field planting and management. According to the pollination time of each inbred line, the grain moisture content (MC) was measured starting from 30 days after pollination, and measured every 5 days, for a total of 5 periods. Five individual plants of the same genotype material were measured in each period, and each plant was measured 3 times to take the average value as the phenotypic value of the inbred line. Then, based on the grain moisture content data of the 5 periods, the corresponding grain moisture content change index (AUDDC) was calculated to represent the grain dehydration rate. The calculation formula is:
[0036]
[0037] Where n represents the number of measurements, γ represents the moisture content of the grain, i represents the number of measurements, and t represents the measurement time. The statistical software SPSS25.0 was used to evaluate the population phenotype, and the results showed that the frequency of the population phenotype values showed a typical normal distribution. B 2 =σ G 2 / σ P 2 Calculate the broad-sense heritability, σ G 2 =(MSG-MSE) / n,σ P 2 =(MSG-MSE) / n+MSE, where σ G 2 , σ P 2, MSG, MSE, and n represent the genotypic variance, phenotypic variance, mean square of genotype, mean square of error, and number of replicates, respectively. The results showed that the broad-sense heritability of maize grain moisture content at each stage was between 59.45% and 70.60%, and the broad-sense heritability of the grain moisture content change index was between 60.28% and 70.69%. The above phenotypic analysis results indicated that the maize grain moisture content and dehydration rate were mainly controlled by genotype, the phenotypic values conformed to the characteristics of quantitative inheritance, and were suitable for association analysis.
[0038] 1.2 Obtaining the genotypes of the 425 material population
[0039] Using resequencing technology, 425 inbred line materials were resequenced with a sequencing depth of 7×, and a total of 2,805,182 SNPs were obtained. Then, under the parameter settings of genotype deletion rate > 0.2, heterozygosity rate > 0.2, and minor allele frequency < 0.05, the genotypes were filtered, and finally 1.6474 million high-quality SNPs were obtained.
[0040] 1.3 Mining candidate genes controlling maize grain moisture content and dehydration rate by GWAS
[0041] Combining the phenotypic values of grain moisture content and moisture content change index of 425 inbred lines and 1.6474 million SNPs, GWAS was performed. The mixed linear model (MLM) was used for association mapping, with P = 1.61×10 -5 as the threshold, SNPs jointly associated with multiple grain moisture content traits and three grain moisture content change index traits were selected, and a total of 55 significantly associated SNPs were identified. Within a 100 Kb linkage disequilibrium region, 29 genes were mined from these SNPs. Among them, the ZmNAD gene had a relatively high expression abundance in the endosperm at 12 days and 27 days after pollination, indicating that this gene might affect the grain moisture content and dehydration rate to a certain extent. Therefore, the ZmNAD gene was initially determined as a candidate gene controlling maize grain moisture content and dehydration rate.
[0042] Example 2 Association analysis and haplotype identification of candidate gene ZmNAD
[0043] In the association analysis population of 425 inbred lines, 39 SNPs were found by PCR amplification of the ZmNAD gene body and upstream promoter region. Combining the 39 SNPs and the phenotypic values of grain moisture content and moisture content change index for candidate gene association analysis, the results showed that two SNPs, SNP-3-68175469 and SNP-3-68175700, were significantly correlated with grain moisture content and dehydration rate. Based on these two significant SNPs, two haplotypes were identified, namely Hap1 (AT) and Hap2 (TG), as Figure 1As shown in the figure. Under three environments, the phenotypic values of the grain moisture content and the moisture content change index of the Hap2 material were significantly lower than those of Hap1, indicating that the Hap2 material had a low moisture content and a high dehydration rate in mature maize grains. Therefore, Hap2 was identified as an excellent haplotype of ZmNAD.
[0044] Example 3 Development of dCAPS Molecular Markers Based on Specific SNP Markers
[0045] Based on the two significant SNPs screened in Example 2, dCAPS molecular markers were developed. Considering the cleavage efficiency of the restriction enzyme and the PCR amplification effect of the molecular marker, only the dCAPS molecular marker ZmNAD - SNP1 - Sac1 designed according to the SNP - 3 - 68175700 marker was successfully verified, and its nucleotide sequence is shown in SEQ ID NO.1.
[0046] SEQ ID NO.1:
[0047] CTTATATTTTATTTCTAAAAGATAAAATAGGATATGATTTAAAGTGTTTAGGATCATAAAATACTTATTGTTACACAGTTAAGTCGTATCATGTTATTCAAAAATATATTATGTTATTTACGAAATAAAATTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTGTGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTCGGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTC K TGCGGGAACCTAGATCTCGCCCCTTAGAGAGATCTTATGGTGCTCCGAGTTGACAGGCCACCTGGAACGTTCCCAGGCGACGTAGAGTCACCTAGAGATTAGAAATCCAATCGAAGAAGAGTATCTTGAATGAAGTGGATCTTGCTTTCTGAGAGGATAAAATCCTAGGGTCGACTTAGGATGACAGGTAACCCAAGACGGATCTAGACGACATAAAGTCTGATAAGGTGGAGGTGTGTATGCGGGAAGCTACAACTAGAACTACGCTACATCTACTCTTAGGGCAGGAATGATAAATGA; The underlined part indicates the SNP site, and K is G or T.
[0048] Among them, the reverse primer of the dCAPS molecular marker was designed based on the sequence near the SNP locus (SEQ ID NO.2).
[0049] SEQ ID NO.2:
[0050] 5’-GTCCGCAATGCCGCAGGATCATCTTCTTCKTGCGGGAACCTAGATCTCGCCCCTT AGAG-3; the SNP locus is underlined, and K is G or T.
[0051] Specifically, the sequence near the T / G locus was modified into a Sac1 restriction site (GAGCTC, which is cut at the fifth base T and the sixth base C), and the original sequence 5’-TGCGG-3’ was modified into 5’-AGCTC-3’. At the same time, a 24bp sequence 5’-GAACCTAGATCTCGCCCCTTAGAG-3’ (SEQ ID NO.3) was selected at the 3’ end to increase the size difference of the fragments after digestion.
[0052] The reverse primer sequence obtained according to this method is shown as 5’-CTCTAAGGGGCGAGATCTAGGTTCGAGCT-3’ (ZmNAD-SNP1-Sac1-R, SEQ ID NO.5). There is no special consideration for the design of the forward primer, only requiring that there are no other Sac1 restriction sites between its sequence and the reverse primer except at the significant SNP position. The forward primer sequence designed in the present invention is 5’-TTATTGGCATCGATTTGGTG-3’ (ZmNAD-SNP1-F, SEQ ID NO.4).
[0053] The developed dCAPS molecular marker ZmNAD-SNP1-Sac1 was used for genotype identification. Specifically:
[0054] (1) If the ZmNAD-Hap2 genotype is G at the SNP-3-68175700 marker, after PCR amplification with the primers ZmNAD-SNP1-F / ZmNAD-SNP1-Sac1-R, the product sequence is SEQ ID NO.6, as Figure 2 shown in A below: the fragment size is 199bp. At this time, the G at this SNP locus is the Sac1 restriction site. After digestion with Sac1, the PCR product sequence becomes SEQ ID NO.7 and SEQ ID NO.8, that is, two fragments of 29bp and 170bp, and a 170bp-sized fragment can be detected by agarose gel electrophoresis ( Figure 2 shown in B below).
[0055] SEQ ID NO.6:
[0056] TTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTGTGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTCGGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTC G AGCTCGAACCTAGATCTCGCCCCTTAGAG; Underlined is the SNP site;
[0057] SEQ ID NO.7:
[0058] AGCTCGAACCTAGATCTCGCCCCTTAGAG;
[0059] SEQ ID NO.8:
[0060] TTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTG TGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTC GGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTCG。
[0061] (2) If the ZmNAD-Hap1 genotype is T at the SNP-3-68175700 marker, after PCR amplification with primers ZmNAD-SNP1-F / ZmNAD-SNP1-Sac1-R, the product sequence is SEQ ID NO.9, as Figure 2 shown in A below: The fragment size is 199bp. At this time, the T at this SNP site is not a Sac1 restriction site, and there are no other Sac1 restriction sites in the entire sequence. Therefore, after digestion with Sac1, the PCR product cannot be digested and the fragment size remains 199bp ( Figure 2 shown in B below).
[0062] SEQ ID NO.9:
[0063] TTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTGTGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTCGGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTC T AGCTCGAACCTAGATCTCGCCCCTTAGAG; The SNP site is marked by an underscore.
[0064] Method for Identifying Varieties or Genotypes with Low Moisture Content and High Dehydration Rate of Maize Grains at Maturity Stage
[0065] The method for identifying varieties of maize grains with low moisture content and high dehydration rate at maturity stage includes the following steps:
[0066] (1) Extract the DNA of the maize sample to be identified;
[0067] (2) Using the sample DNA as a template, and using the ZmNAD-SNP1-F / ZmNAD-SNP1-Sac1-R primers, the PCR amplification system is shown in Table 1:
[0068] Table 1 PCR Amplification System
[0069]
[0070] The PCR reaction procedure is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 25 s, perform 34 cycles, extension at 72°C for 5 min, and store at 12°C for 10 min.
[0071] (3) Perform enzymatic digestion and agarose gel electrophoresis detection on the PCR amplification product. The enzymatic digestion system is shown in Table 2:
[0072] Table 2 Enzymatic Digestion System
[0073]
[0074] After mixing the above components, perform enzymatic digestion at 37°C for 15 min. Then, electrophorese the enzymatic digestion product on 2% agarose at 180 V voltage for 45 min.
[0075] (4) Determine whether the maize sample to be identified is a variety with low grain moisture content and high dehydration rate at the mature stage according to the electrophoresis results. Specifically: Maize varieties with the ZmNAD-Hap1 genotype have a band of 199 bp in size, maize varieties with the ZmNAD-Hap2 genotype have a band of 170 bp in size, and maize varieties with both 199 bp and 170 bp bands are heterozygous genotype maize varieties; among them, both the ZmNAD-Hap2 genotype and the heterozygous genotype are maize varieties with low grain moisture content and high dehydration rate at the mature stage.
[0076] Example 5 Verification of the accuracy of the molecular marker using known genotype materials
[0077] The known ZmNAD-Hap2 homozygous materials are Mo4, Mo12, Mo15, Mo32, Mo33, Mo37, Mo49, and the ZmNAD-Hap1 homozygous materials are Mo6, Mo13, Mo14, Mo17, Mo18, Mo22, Mo26. Select the maize varieties with the above-known genotypes to verify the accuracy of the ZmNAD-SNP1-Sac1 molecular marker, and use the methods of Example 3 and Example 4 for verification. The results are as Figure 3 shown in A. The electrophoretic band sizes of all ZmNAD-Hap2 homozygous materials are 170 bp, while the electrophoretic band sizes of ZmNAD-Hap1 homozygous materials are 199 bp. At the same time, the grain moisture content of ZmNAD-Hap2 homozygous materials is lower than that of ZmNAD-Hap1 ( Figure 3 shown in B), and the grain dehydration rate of ZmNAD-Hap2 homozygous materials is higher than that of ZmNAD-Hap1 ( Figure 3 shown in C). Therefore, using the molecular marker of the present invention, it is possible to accurately identify whether maize is a variety with low grain moisture content and high dehydration rate and its genotype.
[0078] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A dCAPS molecular marker for detecting moisture content and dehydration rate of corn kernels, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the 300th K in the sequence represents a polymorphism, which is T or G.
2. The dCAPS molecular marker according to claim 1, characterized in that The dCAPS molecular marker primer pair was used to amplify a 199 bp band in corn genomic DNA. After Sac 1 digestion, the amplified bands of corn kernels with low moisture content and high dehydration rate produced bands of 170 bp and 29 bp respectively; after Sac 1 digestion, the amplified bands of corn kernels with high moisture content and low dehydration rate produced a 199 bp band. The nucleotide sequence of the forward primer of the dCAPS molecular marker primer pair is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
5.
3. A primer pair for detecting the dCAPS molecular marker according to claim 1 or 2, characterized in that: The nucleotide sequence of the forward primer of the primer pair is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
5.
4. Use of the primer pair according to claim 3 in preparing a product for detecting the dCAPS molecular marker according to claim 1 or 2.
5. A kit for detecting the dCAPS molecular marker according to claim 1 or 2, characterized in that: Comprising the primer pair as claimed in claim 3.
6. The kit according to claim 5, characterized in that Also included is the restriction endonuclease Sac 1.
7. Use of the dCAPS molecular marker according to claim 1 or 2, the primer pair according to claim 3 or the kit according to claim 5 or 6 in identifying corn kernel varieties with low moisture content and high dehydration rate.
8. Use of the dCAPS molecular marker according to claim 1 or 2, the primer pair according to claim 3, or the kit according to claim 5 or 6 in molecular marker-assisted selection breeding for moisture content and dehydration rate of corn kernels.
9. A method for identifying corn kernel varieties with low moisture content and high dehydration rate, characterized in that: The following steps are involved: Extracting DNA from corn samples to be tested; Using the DNA as a template, amplifying using the primer pair described in claim 3, and collecting the amplified product; Performing enzyme digestion on the amplified product, and performing electrophoresis detection on the enzyme digestion product; Judging from the electrophoresis results, if there is only a 170bp band in the electrophoresis results, it is a variety of corn kernels with low moisture content and high dehydration rate.
10. The method according to claim 9, characterized in that The enzyme used for the enzyme digestion is the restriction endonuclease Sac 1.
Citation Information
Patent Citations
QTL fragment for regulating and controlling corn kernel dehydration rate, molecular marker and application of QTL fragment
CN116287371A
SNP (Single Nucleotide Polymorphism) molecular marker of corn kernel water content associated site and application thereof
CN118127221A
Major QTL, SNP molecular marker and KASP detection primer group for controlling dehydration rate of corn kernels and application of major QTL, SNP molecular marker and KASP detection primer group
CN119372362A
Cited By
Marker closely linked with corn kernel dehydration rate and application thereof
CN120866556A