Application of KASP molecular marker in identification of light yellow flower color character of muskmelon

By developing the KASP molecular marker chr04:26634798 G/A, the problems of environmental interference and long cycle in the identification of melon flower color phenotype have been solved, enabling rapid and accurate identification and efficient breeding of the light yellow flower color trait in melons.

CN120945100APending Publication Date: 2025-11-14XINJIANG ACAD OF AGRI SCI (XINJIANG BRANCH OF CHINESE ACAD OF AGRI SCI)
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202511165381.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-20
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Traditional breeding methods for identifying melon flower color phenotypic characteristics are highly susceptible to environmental interference, have long cycles, and low selection efficiency, making it difficult to meet the needs of modern agricultural production.

Method used

We developed the KASP molecular marker chr04:26634798 G/A, designed primers based on the SNP site at chr04 locus 26634798 on chromosome 26634798, and combined PCR amplification and fluorescence detection to achieve rapid and accurate identification of the light yellow flower color trait in melons.

Benefits of technology

This method enables efficient and low-cost identification of the light yellow flower color trait in melons, shortening the breeding cycle, improving breeding efficiency, and reducing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945100A_ABST
    Figure CN120945100A_ABST
Patent Text Reader

Abstract

The invention discloses application of a KASP molecular marker in identification of light yellow flower color traits of muskmelons, and belongs to the technical field of molecular markers. According to the KASP molecular marker for identifying the light yellow flower color character of the muskmelon, a genetic segregation population is constructed by taking a dark yellow flower color muskmelon and a light yellow flower color muskmelon as parents, and a stably inherited marker site chr04: 26634798G / A is obtained through molecular marker technology identification. The marker is closely related to the light yellow flower color character of the muskmelon, and has the characteristics of strong specificity and good stability. The molecular marker provided by the invention can realize rapid genotype detection of a muskmelon material through a high-throughput genotyping system, and the identification result is accurate and reliable and is not influenced by environmental factors. The molecular marker can be applied to molecular marker-assisted selective breeding of melon flower color characters, the breeding efficiency is remarkably improved, the breeding period is shortened, the breeding cost is reduced, and an effective molecular breeding tool is provided for directional improvement of melon flower colors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of molecular marker technology, specifically relating to the application of a KASP molecular marker in identifying the light yellow flower color trait in melons. Background Technology

[0002] Muskmelon (Cucumis melo L.) is an important global economic crop, and flower color is a key agronomic trait in its cultivation. As one of the secondary origin centers of muskmelon, my country possesses abundant germplasm resources, exhibiting extremely rich variations in flower color, ranging continuously from deep yellow to light yellow. This difference in flower color is not only an important component of the muskmelon's appearance but also closely related to many of the crop's production characteristics. Flower color is an important agronomic trait in melons, and elucidating its genetic regulation mechanism is of great significance for improving reproductive efficiency, fruit quality, and variety selection. Currently, the breeding of melon flower color mainly relies on traditional breeding practices, which suffer from problems such as significant environmental interference in phenotypic identification, long cycles (usually requiring 6-8 generations), and low selection efficiency, making it difficult to meet the needs of modern agricultural production. Summary of the Invention

[0003] The purpose of this application is to provide an application of KASP molecular markers in identifying the light yellow flower color trait in melons, which can be applied to breeding practices quickly, accurately and at low cost, thereby efficiently breeding distinctive varieties of melons with highly recognizable light yellow flower color traits and shortening the breeding cycle.

[0004] To achieve the above objectives, this application provides an application of the KASP molecular marker in identifying the light yellow flower color trait in melons, wherein the identification of the light yellow flower color trait in melons includes the following steps: Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was then performed using primers based on the KASP molecular marker chr04:26634798 G / A to obtain the gene type of the target melon. Based on the detected gene type, the traits of the target melon were determined. The KASP molecular marker chr04:26634798 G / A was designed based on the SNP site at 26634798 on chromosome chr04.

[0005] As some optional embodiments of this application, the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.1.

[0006] As some optional embodiments of this application, the polymorphism of the KASP molecular marker is A or B, the AA genotype is a deep yellow flower type, the BB genotype is a light yellow flower type, and the AB genotype is a deep yellow flower type.

[0007] As some optional embodiments of this application, the PCR amplification includes: Pre-denaturation at 95℃ for 10 min; Denaturation at 95℃ for 20 seconds; Annealing at 60℃ for 45 seconds; The annealing extension temperature is reduced by 0.6℃ per cycle, for a total of 10 cycles; Denaturation at 95℃ for 20 seconds, annealing and extension at 55℃ for 20 seconds, 30 to 35 cycles.

[0008] As some optional embodiments of this application, the gene type is obtained based on the following reaction system: 0.44 μL each of primer F1 and primer F2, 1.32 μL of primer R, and buffer solution is added to bring the volume to 220 μL.

[0009] As some optional embodiments of this application, the primer pair of the KASP molecular marker chr04:26634798 G / A includes two forward primers and one reverse primer; The two forward primers include chr04:26634798 G / A-F1 as shown in SEQ ID NO.2 and chr04:26634798 G / A-F2 as shown in SEQ ID NO.3; the reverse primer is chr04:26634798 G / AR as shown in SEQ ID NO.4.

[0010] As some optional embodiments of this application, the primer pair of the KASP molecular marker chr04:26634798 G / A can be used to prepare a kit for identifying the KASP molecular marker for the light yellow flower color trait in melons.

[0011] As some optional embodiments of this application, the primer pair of the KASP molecular marker chr04:26634798 G / A can be used for the breeding of light yellow-flowered melon germplasm.

[0012] In summary, this application has the following advantages: 1. The KASP molecular marker provided in this application for identifying the light yellow flower color trait in melons is closely related to this trait. A genetically segregating population was constructed using deep yellow and light yellow flower melons as parents, and the marker exhibits stable inheritance. It can be used for marker-assisted selection breeding of melon flower color. Furthermore, this marker is the first KASP marker in China and abroad linked to the light yellow flower color trait in melons.

[0013] 2. The KASP molecular marker provided in this application for identifying the light yellow flower color trait in melons can be used for genotyping of melon materials and further targeted improvement of melon flower color through high-throughput genotyping systems. The advantages of this method are that it is unaffected by environmental factors and the identification results are accurate and reliable, significantly reducing costs. When applied to melon germplasm breeding, it can effectively shorten breeding time and improve breeding efficiency. Attached Figure Description

[0014] Figure 1 Phenotypic diagrams of the deep yellow-flowered (HMC-1108) and light yellow-flowered (HMC-1037) melon parents and F1 cells involved in the embodiments of this application.

[0015] Figure 2 This is a genotyping diagram of the KASP marker involved in the embodiments of this application in the two parents, HMC-1108 and HMC-1037, F1 and BC1 of melon. Detailed Implementation

[0016] The principles and features of this application are described below with reference to embodiments. The examples are for illustrative purposes only and are not intended to limit the scope of this application. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0017] The development of molecular marker technology has provided a new technical approach to address the shortcomings of traditional breeding methods. Kompetitive Allele-Specific PCR (KASP) is an automated, high-throughput molecular marker detection technology developed based on SNPs and indels. Based on differences in marker terminal sites, it uses a two-color fluorescence method to detect two genotypes of a single SNP site, enabling precise bicelestemization of target SNPs in genomic DNA samples. Currently, the fingerprinting of most melon germplasm resources and varieties is constructed using SSR markers. Existing research has confirmed that KASP technology has significant advantages over traditional SSR markers: 1) higher polymorphism based on SNP sites; 2) more than 10-fold increase in detection throughput; 3) genotyping accuracy of 99.9%; and 4) 60% reduction in single-marker detection cost. These technical advantages make it particularly suitable for genotyping of large-scale breeding populations. Although studies have successfully located flower color-related genes in crops such as watermelon (ClGF gene) and Chinese cabbage (41.5kb region on chromosome 9), a complete molecular marker-assisted selection system has not yet been established in melons, especially lacking functional markers closely linked to light yellow flower color.

[0018] In melon cultivation, flower color, as an important agronomic trait, is closely related to crop reproductive efficiency and quality formation through its genetic regulation mechanism. Existing research indicates that plant flower color primarily affects crop production through two pathways: first, it acts as a visual signal to attract specific pollinating insects, increasing pollination efficiency; second, it protects floral organs from photothermal damage by selectively reflecting specific wavelengths of light. Of particular note is that yellow flowers in insect-pollinated crops like melons easily attract pests such as aphids and whiteflies, leading to damage to reproductive organs such as the stigma, severely impacting pollination success rate and fruit quality. This finding reveals a clear causal relationship between flower color traits and crop yield and quality.

[0019] Muskmelon (Cucumis melo L.) is an important global economic crop, exhibiting rich variation in flower color, ranging from deep yellow to light yellow in a continuous distribution. Traditional breeding practices have shown that light yellow flower varieties can effectively reduce pest damage rates while maintaining sufficient attractiveness to pollinating insects. However, due to the lack of effective selection markers, traditional breeding methods suffer from the following technical drawbacks: 1) phenotypic identification is greatly affected by environmental factors; 2) the breeding cycle is long (usually requiring 6-8 generations); and 3) selection efficiency is low. These drawbacks directly lead to high costs in breeding new varieties, making it difficult to meet the needs of modern agricultural production. Therefore, developing KASP molecular markers for genes related to light yellow flower color in muskmelon is of great significance for promoting and popularizing the application of molecular marker technology, as well as improving the breeding efficiency and level of new muskmelon varieties with light yellow flower color traits.

[0020] Based on the aforementioned technological status, this application establishes a highly efficient molecular detection system for light yellow flower color in melons by developing specific KASP molecular markers. This system includes KASP molecular markers for identifying the light yellow flower color trait in melons, primer pairs associated with these KASP molecular markers, and a kit containing these specific primer pairs. These kits are designed for efficient identification of the light yellow flower color trait in melons. This application goes beyond simply providing these molecular markers and kits; it further elaborates on the specific application methods of these tools in the germplasm selection process for light yellow flower color in melons. Simultaneously, based on the aforementioned KASP molecular markers, primer pairs, and kits, this application details a method for identifying the light yellow flower color trait in melons. This method includes steps such as extracting DNA from melon samples, performing PCR amplification, and using KASP technology for genotypic analysis, thereby achieving accurate identification of the light yellow flower color trait in melons. The application of this technology will effectively solve key technical bottlenecks in traditional breeding, such as inaccurate phenotypic identification and low selection efficiency, providing a new technical means for the breeding of insect-resistant melon varieties. Furthermore, marker-assisted selection can significantly shorten the breeding cycle of new varieties, thereby improving breeding efficiency and having important application value.

[0021] Specifically, this application used Bulked Segregant Analysis (BSA) to initially locate the region of key genes for light yellow flower color, and further narrowed the location interval using KASP molecular markers. The molecular markers in this application can be applied rapidly, accurately, and at low cost to breeding practices, thereby selecting distinctive melon varieties with highly recognizable light yellow flower color traits.

[0022] Firstly, this application provides a KASP molecular marker for identifying the light yellow flower color trait in melons, identified as KASP molecular marker chr04:26634798 G / A. This KASP molecular marker chr04:26634798 G / A is designed based on a single nucleotide polymorphism (SNP) located at position 26634798 on chromosome chr04. Further analysis shows that the base at this SNP site is mutated from guanine (G) to adenine (A), and its nucleotide sequence is detailed in the sequence identifier SEQ ID NO.1.

[0023] The sequence identifier SEQ ID NO.1 and its corresponding variant sites are detailed below: 5'-TGATAATATATGAAACTTAAGGCTCAAAGTACAAGATTGTTGTACTAAGA[G / A]CAAAGGAACTAGGGGAATACAAACTAAAATGAAAACTTGGAGAACAACAA-3'.

[0024] The KASP molecular marker described in this application for identifying the light yellow flower color trait in melons was developed using the following method: (1) Using deep yellow-flowered melon material HMC-1108 and light yellow-flowered melon material HMC-1037 as parents, the F1 generation was obtained by hybridization, and the F2 generation was obtained by self-pollination of the F1 generation. The flower color trait of the F2 generation was then identified.

[0025] (2) At the same time, 30 dark-colored single plants and 30 light-colored single plants were selected from the F2 generation population, and genomic DNA was extracted from the tender leaves of 100 samples respectively. The dark-colored and light-colored DNA were mixed in equal amounts to construct an extreme mixed pool of dark-colored and light-colored plants.

[0026] (3) Whole genome resequencing was performed on the two parents and two extreme pools using the Illumina HiSeq™ PE150 sequencing platform. The sequencing results showed that the number of SNP variations peaked on chromosome 4. SNPs were detected using GATK v4.2 software. By calculating the SNP-index value, regions or genes associated with the light yellow flower color trait were located. Based on the SNP information in the candidate interval, KASP primers closely linked to the light yellow flower color were designed, including two forward competing primers 1 / 2 and one reverse universal primer 3.

[0027] (4) Using the genotype and phenotype of the F2 generation population, the KASP molecular marker chr04:26634798 G / A with polymorphism among the parents and accurate genotyping of pale yellow flowers in the F2 generation population was screened out. It is located in a region of about 77kb on chromosome 4.

[0028] Secondly, the primer pair of the KASP molecular marker used to identify the light yellow flower color trait of melon in this application includes two forward primers and one reverse primer. The two forward primers include chr04:26634798G / A-F1 as shown in SEQ ID NO.2 and chr04:26634798 G / A-F2 as shown in SEQ ID NO.3; the reverse primer is chr04:26634798 G / AR as shown in SEQ ID NO.4.

[0029] Specifically: The sequence identifier SEQ ID NO.2 is detailed below: 5'-GAAGGTGACCAAGTTCATGCTAGTTTGTATTCCCCTAGTTCCTTTGT-3'.

[0030] The sequence identifier SEQ ID NO.3 is detailed below: 5'-GAAGGTCGGAGTCAACGGATTGTTTGTATTCCCCTAGTTCCTTTGC-3'.

[0031] The sequence identifier SEQ ID NO.4 is detailed below: 5'-TATGAAACTTAAGGCTCAAAGTACAAGATT-3'.

[0032] Thirdly, the kit for identifying the KASP molecular marker of light yellow flower color in melons according to this application includes primer pairs of the KASP molecular marker chr04:26634798 G / A as described above, namely chr04:26634798 G / A-F1 as shown in SEQ ID NO.2, chr04:26634798 G / A-F2 as shown in SEQ ID NO.3, and chr04:26634798 G / AR as shown in SEQ ID NO.4.

[0033] Among them, chr04:26634798 G / A-F1 as shown in SEQ ID NO.2 and chr04:26634798 G / A-F2 as shown in SEQ ID NO.3 are forward competitive primers, and chr04:26634798 G / AR as shown in SEQ ID NO.4 are reverse universal primers.

[0034] Fourthly, the method for identifying the light yellow flower color trait of melons according to this application comprises the following steps: Genomic DNA was extracted from the melon samples to be tested. Using this DNA as a template, PCR amplification was performed using universal and specific primers for the molecular marker chr04:26634798 G / A. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 60℃ annealing / extension for 45 s, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing / extension for 20 s, for 30-35 cycles. The results were analyzed using the GeneMatrix™ high-throughput genotyping system and Matrix Master software.

[0035] Specifically, if the detected gene type is AA, the target melon will exhibit a deep yellow flower color; if the detected gene type is BB, the target melon will exhibit a light yellow flower color; and if the detected gene type is AB, the target melon will exhibit a deep yellow flower color.

[0036] In this specific implementation, the gene type was determined based on the following reaction system: 0.44 μL each of primer F1 and primer F2 (100 μM), 1.32 μL of primer R, and a buffer solution (2×PACE Master Mix) were added to bring the volume to 220 μL. After preparation, the mixture was stored at 4°C for later use. If storage for a longer period of time was required, it was stored at -20°C.

[0037] In this specific implementation, a 96-well plate was used for the fluorescence detection experiment. The reaction mixture consisted of 1 μL of DNA template, 5.00 μL of Primer Mix, and 4 μL of distilled water. After preparation, the plate was sealed. The negative control in each DNA sample group was ddH2O. The PCR plate with the samples added was then placed in a quantitative fluorescence PCR instrument for the quantitative fluorescence PCR reaction.

[0038] The technical solutions described above in this application will be explained in detail below with reference to specific embodiments.

[0039] Example 1 This embodiment provides a more detailed explanation of the preliminary localization of the light yellow flower color trait gene in melons, including: using deep yellow and light yellow flower melons as parents, obtaining the F1 generation through hybridization, obtaining the F2 genetic segregating population through self-pollination of the F1 generation, identifying the flower color trait of the F2 genetic segregating population, selecting representative deep yellow and light yellow flower single plants, constructing a DNA pool of extreme traits, and then performing preliminary localization of the key gene for light yellow flower color in melons based on the group segregation analysis method and high-throughput resequencing method.

[0040] Specifically: Step 1: Identification of the light yellow flower color trait in melons The male parent, a deep yellow-flowered melon (HMC-1108), the female parent, a light yellow-flowered melon (HMC-1037), F1 plants, and individual plants of the F2 population were planted, and the flower color trait was identified during the flowering period.

[0041] The flower color phenotypes of melons were identified in six generations of populations: HMC-1108, HMC-1037, F1 (HMC-1108×HMC-1037), F2 (F1 self-pollination), BC1 (F1×HMC-1108), and BC1 (F1×HMC-1037). The segregation ratios of deep yellow and light yellow flowers in the six generations were calculated, and the inheritance patterns of melon flower color were analyzed.

[0042] Analysis revealed that HMC-1108 produces yellow flowers, while HMC-1037 produces pale yellow flowers. Figure 1 This shows the flower color expression of HMC-1108, HMC-1037, and F1 under normal field planting conditions. Table 1 shows the inheritance pattern of melon flower color genes.

[0043] Table 1

[0044] Table 1 shows that all flowers in the F1 population are deep yellow, the ratio of deep yellow to pale yellow flowers in the F2 population is 3:1, all flowers in the BC1 (F1×HMC-1108) population are deep yellow, and the ratio of deep yellow to pale yellow flowers in the BC1 (F1×HMC-1037) population is 1:1. Analysis of the genetic patterns of melon flower color reveals that the pale yellow flower phenotype in HMC-1037 is controlled by a single recessive gene.

[0045] Step 2: Extract DNA using the CTAB method (1) Sampling: Sampling is carried out when the melon seedlings have two leaves and one heart. Take 2-3 cm of the young leaves (dry weight is about 50 mg) and store the sample in an ultra-low temperature freezer at -80℃ for later use.

[0046] (2) Prepare test reagents: CTAB (see Table 2 for CTAB buffer preparation method), NaCl, EDTA, 2-Mercaptoethanol, Tris-HCl, anhydrous ethanol, distilled water, 70% ethanol, isopropanol, ddH2O, chloroform, isoamyl alcohol, agarose, 1wt% TAE buffer, loading buffer, and MakerDL2000.

[0047] Table 2 CTAB buffer preparation

[0048] (3) CTAB extraction: 1) Before tissue grinding, preheat CTAB buffer in a water bath at 65°C.

[0049] 2) After removing the samples, place them in a 96-well PCR plate. Add 100 μL of CTAB buffer to each tube using a 300 μL multipipe syringe and tighten the cap. Grind the samples using a tissue homogenizer at approximately 30 times / second for about 5 minutes (to prevent liquid spillage during grinding, it is recommended to check the cap every 2 minutes). After grinding, centrifuge in a plate centrifuge, and then add 240 μL of CTAB buffer.

[0050] 3) After tightening the cap, place the sample in a water bath and incubate at 65°C for 30 to 45 minutes, inverting the tube 2 to 3 times during the process to mix the sample.

[0051] 4) After the sample has cooled to room temperature, add 340 μL of chloroform / isoamyl alcohol (chloroform to isoamyl alcohol volume ratio of 24:1) using a 300 μL pipette, and gently invert to mix to prevent DNA fragment breakage.

[0052] 5) Centrifuge at 3000 rpm for 10 minutes.

[0053] 6) Using a multi-channel pipette, slowly aspirate 200 μL of the supernatant from top to bottom into a 96-well plate, being careful to avoid aspirating impurities. Add an equal volume of 200 μL of isopropanol pre-chilled at -20°C at room temperature. Gently mix by inverting the plate several times, then freeze at -20°C for at least 20 minutes until DNA precipitates out.

[0054] 7) Centrifuge the mixture at 3000 rpm for 30 minutes.

[0055] 8) Carefully open the cap, quickly pour out the liquid in the tube, and absorb any excess liquid from the tube opening on dry absorbent paper.

[0056] 9) Add 200 μL of 70% alcohol to the test tube, cover it, and gently invert it to wash.

[0057] 10) Centrifuge the centrifuge tubes containing the alcohol wash buffer at 3000 rpm for 10 min. Quickly discard the supernatant and dry the tubes to remove excess liquid (this can be done at room temperature or under vacuum). Add 200 μL of ddH2O to each of the labeled centrifuge tubes to dissolve the DNA. Place the samples in a -4°C freezer overnight and store them at -20°C for later use.

[0058] Step 3, BSA sequencing Thirty dark-flowered melon plants and 30 light-flowered melon plants were randomly selected from the F2 genetic population. Genomic DNA was extracted from these plants and mixed in equal amounts to construct a pool of extreme trait DNA. Whole-genome resequencing was performed on both parents and their two extreme pools using an Illumina HiSeq™ PE150 sequencing platform. The reference genome was the melon genome Melon (DHL92) v4 Genome. A total of 54.04 Gb of sequencing data was obtained from the dark yellow-flowered melon, the light yellow-flowered melon, and their two progeny pools. Sequencing data analysis showed that a total of 54.04 Gb of high-quality data was obtained from the four samples (parents and two progeny pools). The average coverage depth of the non-N regions of the reference genome was 53.76-58.79×, and the genome coverage (≥1×) was above 98.67%. The GC content of all samples was normal, ranging from 35.35% to 37.05%. Quality control analysis showed that the sequencing data was of good quality and the alignment efficiency met expectations, and could be used for subsequent variant detection and association analysis.

[0059] SNP detection was performed on the samples using GATK v4.2 software. 3,475,336 homozygous, high-quality polymorphic markers were obtained from the parents. The light yellow flower color of the parent was used as the reference parent. The frequency (SNP-index) of the 3,475,336 marker sites between the two offspring pools was analyzed and calculated.

[0060] Step 4: Preliminary localization of the gene for light yellow flower color in melons Based on the ScaffoldsN50 in the genome, a window size of 100kb and a step size of 1kb were selected. The average SNP-index in each window was calculated to reflect the distribution of SNP-index on chromosomes in the offspring pool.

[0061] Calculate △(SNP-index), which is the difference between the SNP-indexes of the two offspring pools: △(SNP-index) = SNP-index (extreme dark yellow) - SNP-index (extreme light yellow).

[0062] 1000 permutation tests were performed, and a 95% confidence level was selected as the screening threshold. Window segments exceeding the threshold were considered candidate intervals. SNP variations between the two parents were compared using IGV (Integrative Genomics Viewer), and KASP markers were designed using PrimerPicker. Genotyping was then performed in a six-generation population to verify the stability and polymorphism of the markers.

[0063] Based on the typing results, the gene for light yellow flower color in melon was preliminarily located in the 1.2Mb region on chromosome 4 of melon.

[0064] Example 2 This embodiment provides a more detailed explanation of the identification of the gene for the light yellow flower color trait in melons and the development of the KASP molecular marker chr04:26634798 G / A: Step 1: Fine-grained localization of the light yellow flower color trait in melons Based on the initial localization results of Example 1, KASP markers were designed at a density of 1 KASP marker per 20kb on average within the 1.2Mb target region of melon chromosome 4. High-throughput genotyping was performed on the F2 and BC1 populations, and the candidate region was narrowed down to 77kb through recombinant single-plant analysis.

[0065] Step 2: Development of the KASP molecular marker chr04:26634798 G / A (1) SNP information extraction Based on the gene localization results in Example 1, the SNP distribution information within the candidate interval of chromosome 4 of the melon was analyzed.

[0066] (2) Extracting DNA The extraction method is as described in Example 1.

[0067] (3) Primer polymorphism detection 1) The reaction system is 220 μL. Prepare the primer mixture as follows: 0.44 μL each of forward competitive primer 1 and forward competitive primer 2, 31.32 μL of reverse universal primer, add 2×PACE Master Mix to bring the volume to 220 μL. After preparation, store at 4℃ for later use. If storage for a longer period of time, store at -20℃.

[0068] The experiment used 96-well plates. The reaction mixture was as follows: 1 μL DNA template, 5 μL Primer Mix, and 4 μL distilled water. After preparation, the plates were sealed. A negative control of ddH2O was included in each DNA sample. The PCR plates were then placed in a quantitative real-time PCR instrument for the quantitative real-time PCR reaction.

[0069] Among them, the positive competitive primer 1 (chr04:26634798 G / A-F1), the positive competitive primer 2 (chr04:26634798 G / A-F2), and the reverse universal primer 3 (chr04:26634798 G / AR).

[0070] Specifically, positive competitive primer 1: 5'-GAAGGTGACCAAGTTCATGCTAGTTTGTATTCCCCTAGTTCCTTTGT-3'.

[0071] Positive competitive primer 2: 5'-GAAGGTCGGAGTCAACGGATTGTTTGTATTCCCCTAGTTCCTTTGC-3'.

[0072] Reverse universal primer 3: 5'-TATGAAACTTAAGGCTCAAAGTACAAGATT-3'.

[0073] 2) The PCR reaction procedure is shown in Table 3.

[0074] Table 3

[0075] Thermal cycling and fluorescence readings were performed on the GeneMatrix™ high-throughput genotyping system (HC Scientific, Chengdu) using the Matrix Cycler and Matrix Scanner. The genotyping data were then converted into cluster maps using Matrix Master software.

[0076] like Figure 2As shown, the genotypes for deep yellow and light yellow flowers in melons were detected as AA and BB, respectively, using the KASP molecular marker chr04:26634798 G / A. This indicates that the KASP molecular marker chr04:26634798 G / A for light yellow melons can be used for genotype identification between deep yellow and light yellow flower colors. Figure 2 In the study, the genotype results of the KASP marker chr04:26634798 G / A in deep yellow and light yellow flower colors, as well as in F2 and BC1, showed that when the tested genotype was AA, the flower color of each plant was deep yellow; when the tested genotype was BB, the flower color of each plant was light yellow; and when the tested genotype was AB, the flower color of each plant was deep yellow. ddH2O served as a blank control. Figure 2 It can be concluded that the KASP marker chr04:26634798G / A segregated in the F2 and BC1 populations.

[0077] Step 3: Verification of KASP molecular markers for pale yellow melon flowers (1) Identification of flower color characteristics of melon Flower color traits were identified in the parents, F1, F2 and BC1 genetic populations.

[0078] (2) Extraction of melon genomic DNA DNA was extracted from the young leaves of the parent plants of the prospective parent species, selecting individual plants with dark and light flower colors from F1, F2, and BC1.

[0079] (3) PCR amplification (same as Table 3 above) Combining flower color trait identification and genotype testing, the following results can be obtained: 1) The F2 and BC1 plants with genotype AA were tested, and the phenotypic characteristic was deep yellow flower color; 2) Individual plants of genotype BB in F2 and BC1 showed a light yellow flower color. 3) The F2 and BC1 plants with genotype AB were tested, and the trait was deep yellow flower color.

[0080] In summary, the KASP molecular marker chr04:26634798 G / A is closely linked to the light yellow flower color trait in melons, and the light yellow flower color in melons is a recessive trait.

[0081] While specific embodiments of this application have been described in detail, this should not be construed as limiting the scope of protection of this application. Various modifications and variations that can be made by those skilled in the art without inventive effort within the scope described in the claims still fall within the scope of protection of this application.

Claims

1. The application of a KASP molecular marker in identifying the light yellow flower color trait in melons, characterized in that, The identification of the light yellow flower color trait in melons includes the following steps: Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was then performed using primers based on the KASP molecular marker chr04:26634798 G / A to obtain the gene type of the target melon. Based on the detected gene type, the traits of the target melon were determined. The KASP molecular marker chr04:26634798 G / A was designed based on the SNP site at 26634798 on chromosome chr04.

2. The application according to claim 1, characterized in that, The SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The polymorphism of the KASP molecular marker is A or B, with AA genotype indicating a deep yellow flower color, BB genotype indicating a light yellow flower color, and AB genotype indicating a deep yellow flower color.

4. The application according to claim 1, characterized in that, The PCR amplification includes: Pre-denaturation at 95℃ for 10 min; Denaturation at 95℃ for 20 seconds; Annealing at 60℃ for 45 seconds; The annealing extension temperature is reduced by 0.6℃ per cycle, for a total of 10 cycles; Denaturation at 95℃ for 20 seconds, annealing and extension at 55℃ for 20 seconds, 30 to 35 cycles.

5. The application according to claim 1, characterized in that, The gene type was obtained based on the following reaction system: 0.44 μL each of primer F1 and primer F2, 1.32 μL of primer R, and buffer solution was added to bring the volume to 220 μL.

6. The application according to claim 1, characterized in that, The primer pair for the KASP molecular marker chr04:26634798 G / A includes two forward primers and one reverse primer; The two forward primers include chr04:26634798 G / A-F1 as shown in SEQ ID NO.2 and chr04:26634798 G / A-F2 as shown in SEQ ID NO.3; the reverse primer is chr04:26634798G / AR as shown in SEQ ID NO.

4.

7. The application according to claim 6, characterized in that, The primer pair for the KASP molecular marker chr04:26634798 G / A can be used to prepare a kit for identifying the KASP molecular marker for the light yellow flower color trait in melons.

8. The application according to claim 6, characterized in that, The primer pair for the KASP molecular marker chr04:26634798 G / A can be used for the breeding of light yellow-flowered melon varieties.

Citation Information

Cited By

  • Application of muskmelon round fruit type KASP molecular marker in identification of sweet melon fruit type

    CN121874397A

  • Application of a KASP molecular marker for round melon fruit type in the identification of melon fruit type

    CN121874397B