A dCAPS molecular marker for detecting moisture content and dehydration rate of corn kernels and application thereof

By identifying the ZmNAD gene for maize kernel moisture and dehydration rate through GWAS, developing the dCAPS molecular marker, and using Sac 1 enzyme digestion technology to simplify detection, the problem of high detection cost in existing technologies has been solved. This enables rapid and low-cost identification of maize kernel moisture and dehydration rate, thus improving breeding efficiency.

CN120119030BActive Publication Date: 2025-10-24SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510408889.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-10-24
Estimated Expiration
2045-04-02

AI Technical Summary

Technical Problem

In existing technologies, single nucleotide detection technology is costly and time-consuming, making it unsuitable for detecting large quantities of materials. This has resulted in the limited application of functional SNPs in molecular marker-assisted selection breeding for measuring moisture content and dehydration rate in maize kernels.

Method used

The gene ZmNAD, which controls the moisture content and dehydration rate of maize kernels, was identified by GWAS. The dCAPS molecular marker was developed, and the detection was simplified by Sac 1 enzyme digestion technology. Specific primer pairs were designed to achieve rapid and low-cost identification of kernel moisture content and dehydration rate.

Benefits of technology

This method enables rapid and low-cost identification of maize varieties with low moisture content and high dehydration rate, improving detection efficiency, reducing breeding costs, and has broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120119030B_ABST
    Figure CN120119030B_ABST
Patent Text Reader

Abstract

The application discloses a dCAPS molecular marker for detecting moisture content and dehydration rate of corn kernels and application thereof, and belongs to the technical field of corn molecular breeding. Based on correlation analysis of a gene ZmNAD, the application identifies a significant SNP related to the moisture content and dehydration rate of kernels, and further develops a dCAPS molecular marker ZmNAD-SNP1-Sac1 with a sequence as shown in SEQ ID NO. 1 and a primer pair with sequences as shown in SEQ ID NO. 4-5. The dCAPS molecular marker and the primer pair thereof can be applied to identification of corn varieties with low moisture content and high dehydration rate of kernels and molecular marker assisted selection breeding, so that the detection cost can be effectively saved, the period can be shortened, and the detection efficiency can be improved. The application provides a new technical means for screening corn materials with low moisture content and high dehydration rate of kernels, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular breeding of corn, in particular to a dCAPS molecular marker for detecting the moisture content and dehydration rate of corn kernels and its application. BACKGROUND

[0002] Corn (Zea mays L.) is the most widely planted grain and forage crop in China. In order to further improve production efficiency and reduce production costs, mechanical harvesting of grain has become a key technology for corn production. However, due to the high moisture content of corn ears at the time of harvest, it not only leads to grain mildew and deterioration, but also limits the mechanical harvesting of corn. During the natural drying process from maturity to harvest, the initial moisture content of mature kernels and the dehydration rate in the field environment jointly determine the final moisture content at harvest. Therefore, breeding corn hybrids with low moisture content and high dehydration rate of mature kernels can promote mechanical harvesting, improve threshing efficiency, and reduce additional drying costs and shrinkage losses, which is a key measure to realize mechanical harvesting of corn.

[0003] Genome-wide association studies (GWAS) is an effective tool for analyzing the genetic structure of complex quantitative traits. In recent years, researchers have identified some single nucleotide polymorphisms (SNPs) related to moisture content and dehydration rate through GWAS. Li et al. (Li et al. 2021) conducted GWAS on the grain moisture content of 513 corn inbred lines, revealing 71 SNPs affecting corn kernel moisture. Zhang et al. (Zhang et al. 2020) conducted GWAS on 310 corn inbred lines, identifying 16 SNPs significantly associated with kernel moisture content at harvest. Li et al. (Li et al. 2020) identified 27 SNPs related to kernel moisture content and dehydration rate in corn through GWAS. Among these SNPs affecting corn kernel moisture content and dehydration rate, there are a large number of functional SNPs that can be applied to molecular marker-assisted selection breeding of corn kernel moisture content and dehydration rate.

[0004] However, the current single nucleotide detection technology is too costly and time-consuming, making it unsuitable for large-scale material detection, which has led to the underutilization of functional SNPs reported in these studies. Therefore, there is an urgent need to provide a method for adapting the above functional SNPs to large-scale material detection. SUMMARY

[0005] The application aims to provide a dCAPS molecular marker for detecting moisture content and dehydration rate of corn kernels and application thereof, so as to solve the problems in the prior art.

[0006] To achieve the above object, the application provides the following scheme.

[0007] The application provides a dCAPS molecular marker for detecting moisture content and dehydration rate of corn kernels, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, and the K at the 300th position of the sequence represents polymorphism, which is T or G.

[0008] Preferably, the dCAPS molecular marker primer pair is used to amplify a 199bp band in corn genomic DNA, wherein the amplified band of the corn kernel low-moisture-content and high-dehydration-rate variety is digested by Sac 1 to generate 170bp and 29bp bands; the amplified band of the corn kernel high-moisture-content and low-dehydration-rate variety is digested by Sac 1 to generate a 199bp band.

[0009] Preferably, the nucleotide sequence of the forward primer of the dCAPS molecular marker primer pair is shown as SEQ ID NO. 4, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 5.

[0010] The application also provides a primer pair for detecting the dCAPS molecular marker, wherein the nucleotide sequence of the forward primer of the primer pair is shown as SEQ ID NO. 4, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 5.

[0011] The application also provides application of the primer pair in preparation of a product for detecting the dCAPS molecular marker.

[0012] The application also provides a kit for detecting the dCAPS molecular marker, comprising the primer pair.

[0013] Preferably, the kit further comprises a restriction enzyme Sac 1.

[0014] The application also provides application of the dCAPS molecular marker, the primer pair or the kit in identifying a corn kernel low-moisture-content and high-dehydration-rate variety.

[0015] The application further provides application of the dCAPS molecular marker, the primer pair or the kit in molecular marker assisted selection breeding of corn kernel moisture content and dehydration rate.

[0016] The application further provides a method for identifying a corn kernel low moisture content and high dehydration rate variety, comprising the following steps:

[0017] extracting DNA of a corn sample to be tested;

[0018] using the DNA as a template, performing amplification by using the primer pair, and collecting an amplification product;

[0019] performing enzyme digestion on the amplification product, and performing electrophoresis detection on the enzyme digestion product;

[0020] judging according to the electrophoresis result, and if the electrophoresis result only has a 170bp band, the corn kernel is a low moisture content and high dehydration rate variety.

[0021] Preferably, the enzyme used in the enzyme digestion is a restriction enzyme Sac 1.

[0022] The application discloses the following technical effects:

[0023] The application determines a key gene ZmNAD for controlling corn kernel moisture content and dehydration rate in a mature period by performing GWAS on 425 selfing lines. Based on the association analysis of the gene ZmNAD, a significant SNP related to the kernel moisture content and the dehydration rate is identified, and a dCAPS molecular marker ZmNAD-SNP1-Sac1 with a sequence as shown in SEQ ID NO. 1 and a primer pair with sequences as shown in SEQ ID NO. 4-5 are developed. The dCAPS molecular marker and the primer pair provided by the application can be applied to identification of a corn variety with low kernel moisture content and high dehydration rate and molecular marker assisted selection breeding, and can effectively save detection cost, shorten a period and improve detection efficiency. The application provides a new technical means for screening a corn material with low kernel moisture content and high dehydration rate, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only constitute some embodiments of the application, and for those skilled in the art, other drawings can also be obtained based on these drawings without creative labor.

[0025] Figure 1Figure for haplotype analysis based on ZmNAD association analysis; wherein, A: Haplotype 1, Haplotype 2 in the grain moisture content in Sichuan Wenjiang, Sichuan Chongzhou, Yunnan Jinghong three kinds of environment; B: Haplotype 1, Haplotype 2 in the moisture content change index in Sichuan Wenjiang, Sichuan Chongzhou, Yunnan Jinghong three kinds of environment; * indicates P < 0.05, ** indicates P < 0.01;

[0026] Figure 2 Figure for PCR amplification and enzyme digestion electrophoresis of molecular marker ZmNAD-SNP1-Sac1; wherein, A: electrophoresis result of PCR amplification product without Sac1 enzyme digestion; B: electrophoresis result of PCR amplification product after Sac1 enzyme digestion;

[0027] Figure 3 Figure for verification result of molecular marker ZmNAD-SNP1-Sac1 in known genotype materials; wherein, A: electrophoresis verification result of molecular marker accuracy; lanes 1-7 are Mo4, Mo12, Mo15, Mo32, Mo33, Mo37, Mo49; lanes 8-14 are Mo6, Mo13, Mo14, Mo17, Mo18, Mo22, Mo26; B: grain moisture content of Haplotype 1, Haplotype 2; C: Haplotype 1, Haplotype 2 in the moisture content change index; * indicates P < 0.05, ** indicates P < 0.01; DETAILED DESCRIPTION

[0028] The following detailed description of various example embodiments of the application will not be considered to limit the application to these embodiments only, but rather to provide a more thorough description of the various aspects, features and embodiments of the application.

[0029] It should be understood that the terms used in the specification of the present application are merely used to describe particular embodiments and are not intended to limit the present application. In addition, for numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is specifically disclosed. Each intermediate value within any stated value or stated range, as well as any other stated value or intermediate value within the stated range, is also included in the present application. The upper limit and the lower limit of these smaller ranges can be included or excluded independently from the range.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0031] Many modifications and variations of the described implementations of the application can be made without departing from its spirit or scope, as will be apparent to those skilled in the art. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.

[0032] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0033] Example 1 Identifying the gene ZmNAD controlling the moisture content and dehydration rate of corn kernels by GWAS

[0034] 1.1 Planting of association analysis population and acquisition of phenotype data

[0035] The association analysis population containing 425 inbred lines was planted in Chongzhou, Sichuan, Jinghong, Yunnan, and Wenjiang, Sichuan. In each environment, 3 replicates were set according to the random block standard. Each inbred line was planted in 3 rows with a row length of 3 meters and a row spacing of 0.8 meters, and 14 plants were planted in each row with a density of about 58000 plants per hectare. Field planting and management were carried out in the conventional field management mode. According to the pollination time of each inbred line, the kernel moisture content (MC) was measured from 30 days after pollination, and the measurement was carried out every 5 days, a total of 5 periods. In each period, 5 single plants of the same genotype material were measured, and the average value of 3 measurements of each plant was taken as the phenotype value of the inbred line. Then, according to the kernel moisture content data of the 5 periods, the corresponding kernel moisture content change index (AUDDC) was calculated to represent the kernel dehydration rate, and the calculation formula was:

[0036]

[0037] Wherein, n represents the number of measurements, γ represents the kernel moisture content, i represents the i-th measurement, and t represents the measurement time. The statistical software SPSS 25.0 was used to evaluate the population trait phenotype, and the results showed that the frequency of population phenotype values was typically normally distributed. The formula H B 2 = σ G 2 / σ P 2 The general heritability was calculated, σ G 2 = (MSG-MSE) / n, σ P 2 = (MSG-MSE) / n+ MSE, wherein σ G 2 , σ P 2, MSG, MSE, and n represent genotypic variance, phenotypic variance, genotypic mean square, error mean square, and number of replicates, respectively. The results showed that the broad-sense heritability of corn kernel moisture content at various stages ranged from 59.45% to 70.60%, and the broad-sense heritability of the kernel moisture content variation index ranged from 60.28% to 70.69%. These phenotypic analyses indicate that corn kernel moisture content and dehydration rate are primarily controlled by genotype, and that the phenotypic values ​​conform to quantitative genetic characteristics, making them suitable for association analysis.

[0038] 1.2425 accessions of population genotypes

[0039] Using resequencing technology, 425 inbred lines were resequenced at a depth of 7×, yielding a total of 2,805,182 SNPs. Genotypes were then filtered using parameters such as missing genotype rate > 0.2, heterozygosity rate > 0.2, and minimum allele frequency < 0.05, ultimately yielding 1,647,400 high-quality SNPs.

[0040] 1.3GWAS to identify candidate genes controlling maize kernel moisture content and dehydration rate

[0041] A GWAS was conducted by combining the phenotypic values ​​of grain moisture content and moisture content variation index of 425 inbred lines with 1.6474 million SNPs. The association map was constructed using a mixed linear model (MLM). -5 Using a threshold of 0.000, SNPs associated with multiple kernel moisture content traits and three kernel moisture content variation indices were selected, resulting in the identification of 55 significantly associated SNPs. Within a 100-kb linkage disequilibrium segment, these SNPs identified 29 genes. Among them, the ZmNAD gene showed high expression abundance in the endosperm at 12 and 27 days after pollination, suggesting that it may affect kernel moisture content and dehydration rate to some extent. Therefore, the ZmNAD gene was preliminarily identified as a candidate gene controlling kernel moisture content and dehydration rate in maize.

[0042] Example 2 Association analysis and haplotype identification of candidate gene ZmNAD

[0043] In the association analysis population of 425 inbred lines, 39 SNPs were found by PCR amplification of the ZmNAD gene body and upstream promoter region. Candidate gene association analysis was performed by combining the 39 SNPs with the phenotypic values ​​of grain moisture content and moisture content change index. The results showed that two SNPs, SNP-3-68175469 and SNP-3-68175700, were significantly associated with grain moisture content and dehydration rate. Based on these two significant SNPs, two haplotypes were identified, namely Hap1 (AT) and Hap2 (TG). Figure 1The grain moisture content and moisture content change index phenotype values of the Hap2 material were significantly lower than those of Hap1 under the three environments, indicating that the Hap2 material has low moisture content and high dehydration rate in the mature corn kernels. Therefore, Hap2 was determined to be an excellent haplotype of ZmNAD.

[0044] Example 3 Development of dCAPS molecular markers based on specific SNP markers

[0045] Two significant SNPs screened according to Example 2 were used to develop dCAPS molecular markers. Based on the cleavage efficiency of the endonuclease and the PCR amplification effect of the molecular marker, only the dCAPS molecular marker ZmNAD-SNP1-Sac1 designed according to SNP-3-68175700 was verified to be successful, and the nucleotide sequence thereof is shown as SEQ ID NO. 1.

[0046] SEQ ID NO. 1:

[0047] CTTATATTTTATTTCTAAAAGATAAAATAGGATATGATTTAAAGTGTTTAGGATCATAAAATACTTATTGTTACAGTTAAGTCGTATCATGTTATTCAAAAATATATTATGTTATTTACGAAATAAAATTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTGTGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTCGGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTC K TGCGGGAACCTAGATCTCGCCCCTTAGAGAGATCTTATGGTGCTCCGAGTTGACAGGCCACCTGGAACGTTCCCAGGCGACGTAGAGTCACCTAGAGATTAGAAATCCAATCGAAGAAGAGTATCTTGAATGAAGTGGATCTTGCTTTCTGAGAGGATAAAATCCTAGGGTCGACTTAGGATGACAGGTAACCCAAGACGGATCTAGACGACATAAAGTCTGATAAGGTGGAGGTGTGTATGCGGGAAGCTACAACTAGAACTACGCTACATCTACTCTTAGGGCAGGAATGATAAATGA; the SNP site is identified by underlining, and K is G or T.

[0048] The reverse primer of the dCAPS molecular marker is designed according to the sequence (SEQ ID NO. 2) near the SNP site.

[0049] SEQ ID NO. 2:

[0050] 5'-GTCCGCAATGCCGCAGGATCATCTTCTTCKTGCGGGAACCTAGATCTCGCCCCTT AGAG-3'; the underlined SNP site, and K is G or T.

[0051] Specifically, the sequence near the T / G site is modified into a Sac1 enzyme cutting site (GAGCTC, cut at the fifth base T and the sixth base C), the original sequence 5'-TGCGG-3' is modified into 5'-AGCTC-3', and a 24bp sequence 5'-GAACCTAGATCTCGCCCCTTAGAG-3' (SEQ ID NO. 3) is selected at the 3' end to increase the size difference of the enzyme cutting fragments.

[0052] The sequence of the reverse primer obtained according to the method is shown as 5'-CTCTAAGGGGCGAGATCTAGGTTCGAGCT-3' (ZmNAD-SNP1-Sac1-R, SEQ ID NO. 5). The forward primer is not specially considered, and only the sequence between the forward primer and the reverse primer is required to have no other Sac1 enzyme cutting site except the significant SNP position. The sequence of the forward primer designed in the application is 5'-TTATTGGCATCGATTTGGTG-3' (ZmNAD-SNP1-F, SEQ ID NO. 4).

[0053] The developed dCAPS molecular marker ZmNAD-SNP1-Sac1 is used for genotype identification. Specifically:

[0054] (1) When the ZmNAD-Hap2 genotype is G at the SNP-3-68175700 marker, the primer ZmNAD-SNP1-F / ZmNAD-SNP1-Sac1-R is used for PCR amplification, and the sequence of the product is SEQ ID NO. 6, as shown in Figure 2 A: the fragment size is 199bp. At this time, the SNP site G is a Sac1 enzyme cutting site, and after Sac1 enzyme cutting, the sequence of the PCR product is changed into SEQ ID NO. 7 and SEQ ID NO. 8, i.e. 29bp and 170bp two fragments, and the 170bp size fragment can be detected by agarose gel electrophoresis Figure 2 B).

[0055] SEQ ID NO. 6:

[0056] TTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTGTGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTCGGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTC G AGCTCGAACCTAGATCTCGCCCCTTAGAG; the SNP site is underlined;

[0057] SEQ ID NO. 7:

[0058] AGCTCGAACCTAGATCTCGCCCCTTAGAG;

[0059] SEQ ID NO. 8:

[0060] TTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTGTGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTCGGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTCG.

[0061] (2) If the ZmNAD-Hapl genotype at the SNP-3-68175700 marker is T, then the PCR product sequence after amplification with primers ZmNAD-SNP1-F / ZmNAD-SNP1-Sacl-R is SEQ ID NO. 9, as shown in Figure 2 A), and the fragment size is 199 bp. At this time, the T at the SNP site is not a Sac I cleavage site, and there is no other Sac I cleavage site in the entire sequence. Therefore, after Sac I cleavage, the PCR product cannot be cleaved open, and the fragment size is still 199 bp Figure 2 B).

[0062] SEQ ID NO. 9:

[0063] TTATTGGCATCGATTTGGTGCCAAATACTAGGGATGTATCGTCTCGTGGTGCCCTTTGTGACGGCGCGGATTGTTCGCGACCTTGCTACAGAAGCAGCTCTTTCTCTATGTCGCGCTCGGACGGTCCACGCTCTAGACCAGTCCGCAATGCCGCAGGATCATCTTCTTC T AGCTCGAACCTAGATCTCGCCCCTTAGAG; the underlined SNP site.

[0064] Method for identifying maize grain low moisture content and high dehydration rate varieties or genotypes at mature stage

[0065] The method for identifying maize grain low moisture content and high dehydration rate varieties at mature stage comprises the following steps:

[0066] (1) Extracting DNA of the maize sample to be identified;

[0067] (2) Using the sample DNA as a template, and using ZmNAD-SNP1-F / ZmNAD-SNP1-Sac1-R primers, the PCR amplification system is shown in Table 1:

[0068] Table 1 PCR amplification system

[0069]

[0070] The PCR reaction program is: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 25 s, 34 cycles, 72°C extension for 5 min, 12°C preservation for 10 min.

[0071] (3) Enzymatic digestion and agarose gel electrophoresis detection of the PCR amplification product. The enzyme digestion system is shown in Table 2:

[0072] Table 2 Enzymatic digestion system

[0073]

[0074] After mixing the above components, the enzyme digestion is performed at 37°C for 15 min. Then, the enzyme digestion product is electrophoresed with 2% agarose at 180V for 45 min.

[0075] (4) According to the electrophoresis result, it is determined whether the corn sample to be identified is a mature grain low water content and high dehydration rate variety. Specifically, the corn variety with a 199 bp band is a ZmNAD-Hap1 genotype, the corn variety with a 170 bp band is a ZmNAD-Hap2 genotype, and the corn variety with both 199 bp and 170 bp bands is a hybrid genotype; wherein, the ZmNAD-Hap2 genotype and the hybrid genotype are both mature grain low water content and high dehydration rate corn varieties.

[0076] Example 5 Verification of the accuracy of the molecular marker by using known genotype materials

[0077] The known ZmNAD-Hap2 homozygous materials are Mo4, Mo12, Mo15, Mo32, Mo33, Mo37 and Mo49, and the known ZmNAD-Hap1 homozygous materials are Mo6, Mo13, Mo14, Mo17, Mo18 and Mo22. The above known genotype corn varieties are selected to verify the accuracy of the ZmNAD-SNP1-Sac1 molecular marker, and the verification is performed by using the method of Example 3 and Example 4, and the results are shown in Table A. Figure 3 The electrophoresis band size of all ZmNAD-Hap2 homozygous materials is 170 bp, and the electrophoresis band size of all ZmNAD-Hap1 homozygous materials is 199 bp. At the same time, the grain water content of the ZmNAD-Hap2 homozygous materials is lower than that of the ZmNAD-Hap1 homozygous materials (Table B), and the grain dehydration rate of the ZmNAD-Hap2 homozygous materials is higher than that of the ZmNAD-Hap1 homozygous materials (Table C). Figure 3 Figure 3 Therefore, by using the molecular marker of the present application, it can be accurately identified whether the corn is a low grain water content and high dehydration rate variety and its genotype.

[0078] The above examples only describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope of the present application as defined by the claims.​

Claims

1. Use of a kit for detecting a dCAPS molecular marker in the identification of maize grain varieties with low moisture content and high dehydration rate, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, and the K at the 300th position of the sequence represents a polymorphism, which is T or G; The kit comprises a primer pair; The nucleotide sequence of the forward primer of the primer pair is shown as SEQ ID NO. 4, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 5; The primer pair is used to amplify a 199bp band in corn genomic DNA, wherein the amplified band of the corn kernel low moisture content and high dehydration rate variety is digested by Sac 1 to produce 170bp and 29bp bands; The amplified band of the corn kernel high moisture content and low dehydration rate variety is digested by Sac 1 to produce a 199bp band.

2. Use of a kit for detecting a dCAPS molecular marker in molecular marker assisted selection breeding for kernel moisture content and dehydration rate in maize, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, and the K at the 300th position of the sequence represents a polymorphism, which is T or G; The kit comprises a primer pair; The nucleotide sequence of the forward primer of the primer pair is shown as SEQ ID NO. 4, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 5; The primer pair is used to amplify a 199bp band in corn genomic DNA, wherein the amplified band of the corn kernel low moisture content and high dehydration rate variety is digested by Sac 1 to produce 170bp and 29bp bands; The amplified band of the corn kernel high moisture content and low dehydration rate variety is digested by Sac 1 to produce a 199bp band.

3. A method of identifying maize grain varieties with low moisture content and high dehydration rate, characterized in that, The method comprises the following steps: Extracting DNA from the corn sample to be tested; Using the DNA as a template, amplifying the molecular marker of claim 1 using a primer pair, and collecting the amplification product; Performing enzyme digestion on the amplification product and performing electrophoresis detection on the enzyme digestion product; According to the electrophoresis result, if only a 170bp band exists, it is a corn kernel low moisture content and high dehydration rate variety; The nucleotide sequence of the forward primer of the primer pair is shown as SEQ ID NO. 4, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 5; The enzyme used for the enzyme digestion is a restriction enzyme Sac 1.