Application of ZmMIR319A gene in regulating leaf angle of maize

Abstract

The application relates to the field of genetic engineering breeding and molecular breeding, and particularly discloses ZmMIR319A Application of a gene in regulating a corn leaf angle. ZmMIR319A The gene nucleotide sequence is shown in SEQ ID NO. 1. The application uses a CRISPR / Cas9 gene editing technology to carry out site-specific knockout of a gene in corn ZmMIR319A, Three different types of gene knockout mutants are created, and ZmMIR319A Overexpression materials are created. It is found that, compared with a control, the leaf angle of a leaf on an ear of the knockout mutant is smaller, and the leaf angle of a leaf on an ear of the overexpression plant is increased, which indicates that ZmMIR319A ZmMIR319A The gene can positively regulate a corn leaf angle. The application lays a theoretical foundation for researching a molecular mechanism of a corn leaf angle, and simultaneously provides new molecular markers and gene resources for molecular design breeding and cultivating new excellent corn germplasm with a small leaf angle and a dense planting characteristic.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering breeding and molecular breeding, and particularly relates to a maize ZmMIR319A and its application in maize leaf angle regulation. BACKGROUND

[0002] Maize is the world's first grain crop. In recent years, with the adjustment of the national planting structure, and the rapid development of livestock and deep processing industries, the demand for maize has increased dramatically, leading to an increasingly prominent contradiction between supply and demand of maize in China. Maize breeding practice shows that the increase in planting density contributes much more to the total yield than the increase in single plant yield (Mansfield and Mumm, 2014). Improving the density tolerance and planting density of varieties has become an important goal and trend of modern maize breeding and production, and reducing the leaf angle and shaping compact plant type is the key to improving the density tolerance of maize. The essence of density tolerance is the rational allocation of light and nutrients in high-density environment to ensure good stress resistance, so as to achieve good group environmental adaptability, high photosynthetic efficiency, and reasonable and efficient source-sink transport of photosynthetic products, and finally obtain high group yield. Plant compact plant type plays an important role in light interception, photosynthetic efficiency improvement and assimilate allocation. Leaf angle is a key component of density-tolerant plant type. Suitable leaf angle, especially the compact plant type with straight and upright leaves above the ear, can reduce the mutual shading between maize plants, improve the overall canopy structure in the field, and enhance the ventilation and light transmission between plants, which is more conducive to the capture of sunlight and photosynthesis by functional leaves (ear leaves, first leaves above the ear and first leaves below the ear) of maize, thereby benefiting the improvement of maize group yield. Breeding practice shows that transforming compact maize varieties into flat and spread plant types will be extremely detrimental to dense planting, and the yield reduction rate under dense planting conditions can reach 13.79%. On the contrary, transforming flat and spread maize varieties into compact types can significantly improve the density tolerance, and the yield increase rate under dense planting conditions can reach 16.9% (Li Denghai et al., 1992). Research on the history of maize breeding also shows that, compared with early varieties, the leaves of modern maize hybrids are more upright and upwelling, and the light energy capture capacity is increased by 14% compared with early varieties (Maddonni et al., 2012). Therefore, reducing the leaf angle and increasing the leaf uprightness are the key to improving the density tolerance and yield of maize, and it has important theoretical and practical significance to excavate key genes for regulating maize leaf angle and uprightness and analyze their genetic networks for cultivating new density-tolerant plant varieties.

[0003] MicroRNAs (miRNAs) are a class of endogenous non-coding small RNA molecules (21-24 nt in length) that target mRNA for degradation or translational repression through base pairing, and play a key role in plant responses to environmental stress (Lagos-Quintana et al., 2001; Lau et al., 2001; Lee et al., 2001). miRNA genes are transcribed by Pol II to generate pri-miRNA, which is cleaved into mature miRNA by Dicer-like enzymes, and then binds to AGO proteins to form RNA-induced silencing complex (RISC) to perform functions (Park et al. 2002; Reinhart et al. 2002). So far, the miRBase database (http: / / www.mirbase.org / ) has collected 38589 mature miRNAs and 28645 hairpin precursor sequences, which are widely involved in hormone signaling, cell differentiation, organ morphogenesis and other processes.

[0004] miR319 is a conserved microRNA in plants, which forms a miR319-TCP module with target genes TCP, and widely regulates plant growth and development and stress response. In Arabidopsis, miR319 targets TCP4 , affecting petal growth, leaf development and leaf serration formation (Hay et al., 2004; Palatnik et al., 2003; Palatnik et al., 2007); the miR319-TCP module is involved in regulating poplar epidermal hair initiation and cotton fiber development (Cao et al., 2020); overexpression of Os-miR319 in rice reduces the expression of OsTCP5 and OsTCP8 , resulting in wider leaves and more leaf veins (Luo et al., 2006). In Arabidopsis, silencing miR319 or overexpression of TCP can delay leaf senescence, and the expression level of miR319 is related to flowering time (Schommer et al., 2008). Under stress, overexpression of miR319b negatively regulates TCP5 in switchgrass, enhancing ethylene synthesis to improve salt tolerance (Zhou et al., 2013); in rice, miR319 is involved in stress regulation under cold and heat stress (Yang et al., 2013). However, there is no research and report on the regulation of miRNA319 on leaf angle in maize.

[0005] The application utilizes CRISPR / Cas9 (Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9) gene editing technology to create three different mutation types of ZmMIR319A gene knockout mutants ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3, also create ZmMIR319A overexpression materials ZmMIR319A-OE#1, ZmMIR319A-OE#2 and ZmMIR319A-OE#3. Field experiments find that, compared with control wild type plants, ZmMIR319A knockout mutants ( ZmMIR319A-KO ) have significantly reduced leaf angle and more compact plant type, while overexpression plants ( ZmMIR319A-OE ) exhibit increased leaf angle and loose plant type, indicating that ZmMIR319A participates in regulating the leaf angle and leaf erectness of corn. The application will enrich the regulation network of corn leaf angle and leaf erectness, further mine key genes regulating corn leaf angle and analyze the genetic network, which has theoretical and practical significance for cultivating new varieties of corn with small leaf angle, compact plant type and dense planting tolerance. SUMMARY

[0006] The technical problem to be solved by the application is to clarify ZmMIR319A application in the regulation of corn leaf angle, to provide gene resources and new germplasm for cultivating new corn varieties with small leaf angle, compact plant type and dense planting tolerance. The specific technical scheme is as follows:

[0007] 1. Sequence analysis of the ZmMIR319A of corn inbred line X249, the nucleotide sequence of the ZmMIR319A gene is shown in SEQ ID NO. 1, and the mature sequence of miR319 is shown in SEQ ID NO. 2. A suitable site is selected for gene editing target design.

[0008] 2. Constructing a ZmMIR319A gene editing vector using CRISPR / Cas9 gene editing technology, and introducing the gene editing vector into callus of corn inbred line X249 using Agrobacterium-mediated method. After obtaining T0 generation transgenic plants, crossing with X249 wild type to obtain F1 generation seeds, and after selfing and genotyping to obtain homozygous non-transgenic gene editing plants, observing and counting the changes of the leaf angle of the first leaf, the second leaf and the third leaf above the ear.

[0009] 3. Constructing an overexpression vector, and introducing the overexpression vector into callus of corn inbred line X249 using Agrobacterium-mediated method. After obtaining T2 generation homozygous positive plants, observing and counting the changes of the leaf angle of the first leaf, the second leaf and the third leaf above the ear.

[0010] The present application utilizes CRISPR / Cas9 technology to edit the gene of corn ZmMIR319A site, and three different types of mutants of the gene are obtained, and the three mutants all show the phenotype of smaller leaf angle. The corn ZmMIR319A overexpression material, and the plant shows the phenotype of larger leaf angle. It is speculated that ZmMIR319A positively regulates the leaf angle of corn. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1 、 ZmMIR319A Knockout mutant vector design.

[0012] Figure 2 、 ZmMIR319A Knockout event gene sequence variation analysis. The base variation site is represented by blue font, ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 the deletion base is represented by a blue short line.

[0013] Figure 3 , corn ZmMIR319A Comparison of the leaf angle phenotype of the seedling and the first leaf of the knockout mutant and the overexpression plant at the seedling stage.a. ZmMIR319A Knockout mutant whole plant; b. ZmMIR319A The angle of the first leaf of the knockout mutant; c. ZmMIR319A Statistical analysis of the angle of the first leaf of the knockout mutant.d. ZmMIR319A Overexpression plant; e. ZmMIR319A Overexpression first leaf angle; f. ZmMIR319A Statistical analysis of the angle of the first leaf of the overexpression plant. The asterisk * in the column chart indicates that there is a significant difference (p<0.05) in the t test.

[0014] Figure 4 , corn ZmMIR319A Comparison of the phenotype of the knockout mutant at the mature stage and the angle of the first, second and third leaves on the ear.a. ZmMIR319A Knockout mutant whole plant; b. ZmMIR319A The angle of the first, second and third leaves on the ear of the knockout mutant; c. ZmMIR319A Statistical analysis of the angle of the first, second and third leaves on the ear of the knockout mutant. The asterisk * in the column chart indicates that there is a significant difference (p<0.05) in the t test.

[0015] Figure 5 , corn ZmMIR319A Comparison of the phenotype of the overexpression plant at the mature stage and the angle of the first, second and third leaves on the ear.a. ZmMIR319A Overexpression plant whole plant; b. ZmMIR319A The angle of the first, second and third leaves on the ear of the overexpression plant; c. ZmMIR319AStatistical analysis of the angle between the first, second and third leaves on the ear of the overexpression plants. The asterisk (*) in the column chart indicates that there is a significant difference (p<0.05) in t-test. DETAILED DESCRIPTION

[0016] Example One ZmMIR319A Mutant material

[0017] To clarify ZmMIR319A the role of the mutant in the leaf angle of corn, the present application uses gene cloning and vector construction technology to create ZmMIR319A mutants through gene editing and investigate the function of the gene in corn.

[0018] The present application selects corn inbred line X249 as the recipient material for gene editing, and selects ZmMIR319A the sequence shown by MT1 of 10 bases before the mature sequence (5'-CTGTTTGTGG-3') and the first 13 bases of the mature sequence (5'-TTGGACTGAAGGG-3') as the target region for CRISPR / Cas9 gene editing.

[0019] MT1 (SEQ ID NO. 3): CTGTTTGTGGTTGGACTGAAGGG

[0020] 1, ZmMIR319A Construction of knockout vector

[0021] The gene editing vector of the present application is pBUE411-ZmMIR319A-Cas9 , the basic vector of the vector is pBUE411-Cas9 , the intermediate vector is pCBCmT1T2 , and gRNA is provided. The present application obtains MT-sgRNA by designing target points on primers and then through PCR, and further connects to the basic vector through enzyme digestion, and the specific construction process is as follows.

[0022] (1) Design of target gRNA. The gene conservative sequence of ZmMIR319A is input into the http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR website for target design. The sgRNA skeleton sequence of the present application is obtained by directly amplifying the intermediate vector.

[0023] (2) MT-sgRNA is obtained by designing target points on primers and PCR amplification. Primer ZmMIR319A-MT1-F (SEQ ID NO. 4) and primer ZmMIR319A-MT1-R (SEQ ID NO. 5) amplify the intermediate vector pCBCmT1T2, for obtaining the sgRNA fragment containing the first and second targets. The PCR system and conditions are as follows: template DNA (intermediate vector pCBCmT1T2 ≥30 ng / μL) 1.2 μL; primer F / R: 1.2 μL each; sterilized ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The temperature program of PCR is as follows: ① 98 ℃ 2 min; ② 98 ℃ 10 s; ③ 58 ℃ 30 s; ④ 72 ℃ 30 s; ⑤ cycle 33 times from ②-④; ⑥ 72 ℃ 5 min; ⑦ 25 ℃ 10 min. The PCR product is recovered after agarose gel electrophoresis.

[0024] The primer base sequence required for vector construction is shown in SEQ ID NO. 4 and SEQ ID NO. 5.

[0025] SEQ ID NO. 4:

[0026] 5'-ATATATGGTCTCTGGCGACTGTTTGTGGTTGGACTGAAGGGGTTTTAGAGCTAGAAATAGCAA-3';

[0027] SEQ ID NO. 5:

[0028] 5'-ATTATTGGTCTCTAAACCTGTTTGTGGTTGGACTGAATGCTTCTTGGTGCCGC-3';

[0029] (3) Constructed into the backbone vector by enzyme digestion and ligation. The pBUE411-Cas9 vector and the recovered sgRNA fragment with the target were digested with BsaI , and T4 ligase was added to ligate the vector and the sgRNA fragment. The enzyme digestion and ligation system is as follows:

[0030] sgRNA fragment: 2 μL

[0031] pBUE411-Cas9 vector (≥60 ng / μL): 2 μL

[0032] 10 x NEB Buffer: 1.5 μL

[0033] BsaI endonuclease (product number: #R3733S): 1 μL

[0034] T4 ligase (product number: #M0202M): 1 μL

[0035] ddH2O: 6 μL.

[0036] pCas9-ZmMIR319A knockout mutant vector design map is shown as Figure 1

[0037] 2. Agrobacterium-mediated genetic transformation of maize

[0038] The transformation receptor is maize inbred line X249, carrying 1 ZmMIR319A copy.

[0039] The above constructed pCas9-ZmMIR319A vector is transformed into Agrobacterium EHA105 by heat shock method, PCR is used for identification, and the bacterial liquid is stored at -80°C with glycerol. Freshly peeled 1.5 mm or so of inbred line X249 embryo as receptor material, put the peeled corn embryo into a 2 mL plastic centrifuge tube containing 1.8 mL of suspension, the placing time is not more than 1 h, about 100 embryos are put in each centrifuge tube; the suspension is sucked off, and the embryos are washed twice with new suspension, a small amount of suspension is reserved at the bottom of the tube which can cover the embryos, then heat shock at 43°C for 2 min, followed by ice bath for 1 min, use pipette to suck the residual washing solution, and add 1.0 mL of Agrobacterium infection liquid, shake gently for 30 s, then stand in the dark for 8 min. Next, pour the embryos and infection liquid in the centrifuge tube onto the co-culture medium, shake well, then use pipette to suck out the excess infection liquid, all the scutes of the embryos are upwards, co-culture at 23°C in the dark for 3 days. After co-culture, use sterile forceps to transfer the embryos to recovery medium and culture at 28°C for 14 days, pay attention to remove the sprouts growing on the embryos in time during the process. After recovery culture, transfer the embryos to screening medium containing 1.5 mg / L Bialaphos for 3 rounds of screening, 2 weeks for each round, then transfer to 2 mg / L Bialaphos screening medium for 2 rounds of screening, 2 weeks for each round. Transfer the resistant callus to propagation medium and culture at 28°C in the dark for 2 weeks. Then transfer the propagated resistant callus to induction medium and culture at 28°C in the dark for 2 weeks. Then transfer to differentiation medium and culture at 25°C and 5000 lux light intensity for 2 weeks. After culture, separate the differentiated seedlings into single seedlings and place them in rooting medium, continue to culture at 25°C and 5000 lux light intensity until rooting; transfer the seedlings to small pots for growth, and transplant them to the greenhouse after growth and survival, harvest the offspring seeds after 3-4 months.

[0040] 3. Detection of T0 generation plant knockout mutation results

[0041] To determine the T0 generation plant knockout mutation results, the following steps are taken:

[0042] ​The application extracts corn leaf DNA by CTAB method, and the specific method is as follows: cutting 2 cm long seedling leaves, putting into a 2 mL centrifuge tube containing steel balls; putting the centrifuge tube containing the leaves into liquid nitrogen for 5 minutes, and crushing the leaf sample by using a grinder; adding 700 μL CTAB extraction buffer (containing 1% of β mercaptoethanol) into the centrifuge tube, mixing uniformly by violent shaking, preheating in a 65 ℃ constant temperature water bath for 20-30 minutes (during which, inverting once); after the centrifuge tube is cooled to room temperature, adding 700 μL chloroform:isopropyl alcohol (24:1) extraction solution, shaking for 30 seconds, and then standing for a while at room temperature; centrifuging at 12000 rpm for 5 minutes at 4 ℃, taking 500 μL supernatant into a new 1.5 mL centrifuge tube; adding equal volume of isopropyl alcohol into the centrifuge tube containing the supernatant, mixing uniformly by light shaking, and standing for 10 minutes or so at room temperature; then, putting the centrifuge tube containing the sample into a 4 ℃ centrifuge, centrifuging at 12000 rpm for 10 minutes, then gently sucking the supernatant, discarding the supernatant, and retaining the precipitate; adding 800 μL 75% ethanol, washing the precipitate twice, centrifuging at 10000 rpm for 5 minutes, and discarding the supernatant; placing the sample at room temperature for natural drying for 2-4 hours, obtaining DNA precipitate, adding appropriate amount of sterile water to dissolve, slightly shaking, and fully dissolving the DNA. The DNA sample is stored at -20 ℃. The DNA concentration is detected by using Nanodrop, and diluted to 10 ng / L for use as a PCR template.

[0043] Then, PCR primers are designed according to ZmMIR319A gene sequences.

[0044] The target to be detected is MT1, the product size is 636 bp, and the primer sequences are shown in SEQ ID NO. 6 and SEQ ID NO. 7:

[0045] SEQ ID NO. 6: ZmMIR319A-1 -T-F: 5'-CGTTTGCGTTCACCTCTG-3';

[0046] SEQ ID NO. 7: ZmMIR319A-1 -T-R: 5'-GGTCCCCGAGCTCTATCG-3'.

[0047] The amplification is carried out according to the following PCR parameters:

[0048] Reaction system: 15 μL MIX regular PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterilized ddH2O, 7.5 μL 2x taq mix (product number: 10103ES); reaction procedure: regular PCR: 58°C annealing, extension 30s, 32 cycles.

[0049] Then the PCR product was recovered and ligated to a T vector for sequencing. By sequencing the DNA sequences of the target regions of multiple T0 generation independent positive transformation events, it was determined whether gene editing occurred in the target region.

[0050] Three mutation types were obtained by using X249 as a transgenic plant receptor, and the sequences before and after editing are shown in Figure 2 , corresponding to three ZmMIR319A homozygous mutants: ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 . Comparison of the mature sequence of the wild type ZmMIR319A shows that ZmMIR319A-KO#1 there is a 9 bp base deletion in the mature sequence region of the ZmMIR319A gene; ZmMIR319A-KO#2 there is a 3 bp base deletion in the mature sequence region of the ZmMIR319A gene; ZmMIR319A-KO#3 there is a 1 bp base deletion in the mature sequence region of the ZmMIR319A gene. Figure 2 ).

[0051] 4. Genotyping of F1 generation plants

[0052] Since the T0 generation corn plants grown in the greenhouse often have uncoordinated development of female and male ears, in order to propagate the T0 generation plants and make the obtained gene editing type hereditary, the present application uses wild type pollen of corn inbred line X249 to pollinate the T0 generation plants obtained above ZmMIR319A-KO#1, ZmMIR319A-KO#2 and ZmMIR319A-KO#3 , and then obtains F1 generation seeds, and the grown plants are F1 generation plants.

[0053] The F1 generation plants include two segregation types, one is Cas9 - positive plants (transgenic plants), and the other is Cas9 - negative plants (non-transgenic plants). In order to avoid continuous editing of the X249 wild type allele introduced by hybrid pollination by sgRNA and Cas9, thereby causing complexity of mutation types, it is necessary to select plants that do not contain the Cas9 gene but contain the T0 generation mutation type from the F1 generation plants, and such plants can obtain non-transgenic F2 generation after selfing. The genotyping steps of the F1 generation plants are as follows:

[0054] After extracting the leaf DNA by the CTAB method described above, first, the specific primers of the gene were used for PCR amplification, and the base sequence was shown as Cas9-F (SEQ ID NO. 8) and Cas9-R (SEQ ID NO. 9): Cas9

[0055] SEQ ID NO. 8: 5'-CCCGGACAATAGCGATGT-3';

[0056] SEQ ID NO. 9: 5'-GAGTGGGCCGACGTAGTA-3'.

[0057] The PCR reaction system was the same as above; the reaction procedure was as follows: conventional PCR: 58°C annealing, extension for 30 s, 32 cycles. After the PCR product was subjected to agarose gel electrophoresis, the positive plants and the negative plants were distinguished according to the results. Cas9 Cas9

[0058] Further, the primers for detecting the target described above Cas9 T-F and ZmMIR319A-1 T-R were used for PCR amplification on the negative plants; after the PCR product was purified, it was connected to a T vector and subjected to sequencing; and the genetic condition of the T0 generation mutation type was analyzed and determined according to the sequencing results. ZmMIR319A-1

[0059] Genotyping of F2 generation plants 5 The F1 plants described above which do not contain the

[0060] gene but contain the T0 generation mutation type are self-crossed (F2) to obtain the homozygous, non-transgenic gene editing seeds, which are the mutant with a homozygous genetic background. Cas9 The F2 generation plants obtained by self-crossing the F1 generation plants include three separation types, AA, Aa and aa. We selected the homozygous non-transgenic gene editing plants from the F2 generation plants by genotyping, and then determined the leaf angle by the next step. Meanwhile, the homozygous non-transgenic gene editing seeds can be obtained by self-crossing the plants.

[0061] The genotyping steps of the F2 generation plants are as follows.

[0062] After extracting the leaf DNA of the F2 generation plants by the CTAB method described above, the primers described above

[0063] and ZmMIR319A-T-F were used for one round of PCR amplification, and the amplification product was then used for specific primers ZmMIR319A-T-R and ZmMIR319A-T2-F ZmMIR319A- T2-R ​​​​Two rounds of PCR amplification were performed, and the PCR products were subjected to non-denaturing PAGE electrophoresis (gel concentration: 12%; voltage: 150 V; time: 2.5 h) for genotyping. The homozygous gene-edited plants were selfed to obtain homozygous non-transgenic gene-edited seeds. The base sequence is shown in SEQ ID NO. 10 and SEQ ID NO. 11: ZmMIR319A-T2-F ZmMIR319A-T2-R

[0064] SEQ ID NO. 10: 5'-AATCAAGCTCTACGCTGTT-3';

[0065] SEQ ID NO. 11: 5'-AAGCGTTTGAGCAAACAA-3'.

[0066] Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL one round of PCR product, 5.5 μL sterilized ddH2O, 7.5 μL 2X M5 HiPer PAGE Taq PCR mix (Polymerase Bio-technology Co., Ltd., item number: 10103ES); reaction program: conventional PCR: 58°C annealing, extension 30 s, 32 cycles.

[0067] After the PCR products were subjected to non-denaturing PAGE electrophoresis and silver nitrate staining, genotyping was performed according to the band size. The homozygous gene-edited plants were subjected to the next step of leaf angle determination test.

[0068] Example 2: Corn ZmMIR319A Overexpression vector construction and phenotype screening of transgenic plants

[0069] 1. ZmMIR319A Overexpression vector construction

[0070] (1) Acquisition and amplification of the target gene. The pri-miR319A precursor sequence of corn miR319A was obtained from the public database miRBase, and specific primers ZmMIR319A-OE-F (SEQ ID NO. 12) and ZmMIR319A-OE-R (SEQ ID NO. 13) were designed according to the pri-miR319A precursor sequence. High-fidelity DNA polymerase was used for PCR amplification to obtain ZmMIR319A ​​The PCR system and conditions are as follows: template DNA (X249 genomic DNA) 1.2 μL; primer F / R: 1.2 μL each; sterilized ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The temperature program of PCR is as follows: ① 98℃ 2min; ② 98℃ 10s; ③ 58℃ 30s; ④ 72℃ 30s; ⑤ cycle 33 times from ②-④; ⑥ 72℃ 5min; ⑦ 25℃ 10min. The PCR product is recovered after agarose gel electrophoresis.

[0071] The primer base sequence required for vector construction is shown in SEQ ID NO. 12 and SEQ ID NO. 13.

[0072] ZmMIR319A-OE-F (SEQ ID NO. 12) and TGTTACTTCTGCAGCCCGGGGGTTCAGTTTTCTCTGGAA

[0073] ZmMIR319A-OE-R (SEQ ID NO. 13): CAAGCGTTTGAGCAAACAAAAG

[0074] (2) Constructed into the backbone vector by enzyme digestion and ligation, selected the plant expression vector-pBI121-Ubi containing the maize ubiquitin promoter (Ubiquitin promoter) to drive the efficient expression of Z ZmMIR319A . The restriction enzymes XmaI and SmaI were used to double-digest the vector, and the linearized vector fragment was recovered. The insertion of the miR319A precursor was prepared. The vector and the target fragment were ligated by adding recombinant ligase. The 5 μL enzyme digestion and ligation system was as follows, pri-miR319A fragment: 2 μL, pBI121-Ubi vector (≥60 ng / μL): 2 μL, DNA recombinant ligase (product number: 7E682G2): 1 μL.

[0075] The ligation product was transformed into competent E. coli (DH5α), positive clones were selected on medium containing the antibiotic kanamycin, and the plasmid was extracted to confirm the correct insertion of Z ZmMIR319A precursor by sequencing.

[0076] 2. T0 generation ZmMIR319A Results of overexpression plant detection

[0077] To determine whether the T0 generation plants are positive seedlings, we screened positive seedlings by Basta resistance gene, and the specific method is as follows:

[0078] A 0.1% concentration of Basta solution is prepared and evenly applied to the leaves of T0 generation plants to screen for positive events. Significant phenotypic differences typically begin to appear within 3-7 days after application. Plants that successfully express the bar / pat gene show green, healthy leaves after application, or only slight, temporary chlorosis / scorching (especially under higher concentrations or strong light), but recover quickly.

[0079] T0 generation positive plants (hybrid) were self-pollinated to obtain T1 generation seeds (due to segregation, T1 generation seeds included homozygous, heterozygous, and wild-type seeds). Twenty of these T1 generation seeds were then sown and self-pollinated to harvest T2 generation seeds. These 20 seed samples were then sown to produce 50 plants. The Basta resistance gene screening method described above was used to select positive seedlings. T2 generation seeds from all 50 positive plants were identified as homozygous transgenic seeds; otherwise, they were identified as heterozygous transgenic seeds or wild-type seeds. The selected T2 generation homozygous transgenic seeds were then sown, and leaf angles were measured.

[0080] Example 3 Corn ZmMIR319A Phenotypic observation of knockout mutants and overexpression plants

[0081] 1. Planting of corn materials

[0082] Choose wild-type X249 with plump, uniformly sized kernels. ZmMIR319A mutant ( ZmMIR319A-KO# 1、ZmMIR319A-KO#2、ZmMIR319A-KO#3 Seeds and overexpression ZmMIR319A-OE#1、ZmMIR319A-OE#2、 ZmMIR319A-OE#3 Seeds were sown in 20cm x 20cm pots and cultured normally in an artificial climate chamber (16 hours light / 8 hours darkness, temperature 25°C, humidity 50%, light intensity 1000µE) to compare the differences in leaf angle at the seedling stage of different materials. Simultaneously, in late May, these seeds were directly sown at the Pinggu Experimental Base of Beijing University of Science and Technology to compare the differences in leaf angle at maturity of different materials.

[0083] 2. Observation of the leaf angle phenotype of the plant

[0084] At the 4-leaf stage and pollen shedding stage, wild-type, mutant, and overexpression plants with consistent growth were selected for leaf angle photography, and the leaf angles were measured using a LAMDA leaf tilt meter. Specifically, the leaf angle of the first leaf was measured in 4-leaf seedlings, and the leaf angles of the first, second, and third leaves on the spike were measured in plants at the pollen shedding stage. At least 10 individual plants were measured for each material.

[0085] A comparative study of leaf angles during the seedling stage revealed that, compared to the wild type, ZmMIR319A mutant ZmMIR319A-KO#1、 ZmMIR319A-KO#2、ZmMIR319A-KO#3 The leaf angle of the first leaf is significantly reduced. Figure 3ac), and ZmMIR319A Overexpression plants ZmMIR319A-OE#1、ZmMIR319A-OE#2、ZmMIR319A-OE#3 The leaf angle of the first leaf is significantly increased. Figure 3 df). Statistical analysis used Student's t-test (i.e., t-test) to compare significant differences with the control wild-type. An asterisk (*) above the bar chart indicates a significant difference (P<0.05) with the control wild-type.

[0086] A comparative study of leaf angles at maturity revealed that, compared to the wild type, ZmMIR319A mutant ZmMIR319A-KO#1、 ZmMIR319A-KO#2、ZmMIR319A-KO#3 The leaf angles of the first (L1), second (L2), and third (L3) leaves on the spike were significantly smaller than those of the corresponding leaves in the wild type. Figure 4 ac). And ZmMIR319A Overexpression plants ZmMIR319A-OE#1、 ZmMIR319A-OE#2、ZmMIR319A-OE#3 The leaf angles of the first (L1), second (L2), and third (L3) leaves on the spike were significantly larger than those of the corresponding leaves in the wild type. Figure 5 Statistical analysis used Student's t-test (i.e., t-test) to compare significant differences with the control wild-type. An asterisk (*) above the bar chart indicates a significant difference (P < 0.05) between the wild-type and the control.

[0087] The invention obtained ZmMIR39A The knockout mutant exhibits a smaller leaf angle (including the angles of the first, second, and third leaves on the ear), demonstrating a significant advantage under field conditions with increased maize planting density. This provides an important pathway for increasing planting density and improving maize yield per unit area and total yield in my country. Simultaneously, this mutant is also an excellent material for studying the molecular regulatory mechanism of maize leaf angle, providing important theoretical basis, gene resources, and germplasm materials for molecular genetic improvement breeding of ideal maize plant architecture.

[0088] References:

[0089] Li Denghai. The role of maize plant architecture in high-yield breeding. Shandong Agricultural Sciences, 1992, 3: 4-8.

[0090] Tang Bin, Li Hongzhi, Cao Zhongyang, Chen Songlin, Wang Qiong, Zou Kangping, Chen Zhihui. Effects of different planting densities on yield and major agronomic traits of 13 maize varieties. Hunan Agricultural Sciences, 2013, 01:17-21.

[0091] Cao JF, Zhao B, Huang CC, Chen ZW, Zhao T, Liu HR, Hu GJ, Shangguan XX, Shan CM, Wang LJ, Zhang TZ, Wendel JF, Guan XY, Chen XY. The miR319-Targeted GhTCP4 Promotes the Transition from Cell Elongation to Wall Thickening in Cotton Fiber. Molecular Plant. 2020, 6;13(7):1063-1077.

[0092] Hay A, Barkoulas M, Tsiantis M. PINning down the connections: transcription factors and hormones in leaf morphogenesis. Current Opinion in Plant Biology, 2004, 7(5): 575-581.

[0093] Lagos-Quintana M, Rauhut R, Lendeckel W. Identification of novel genes coding for small expressed RNAs. Science, 2001, 294(5543):853-858.

[0094] Lau NC, Lim LP, Weinstein EG. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science, 2001, 294(5543):858-862.

[0095] Lee RC, Ambros V. An extensive class of small RNAs in Caenorhabditis elegans. Science, 2001, 294(5543):862-864.

[0096] Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH. Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development. FEBS Letter, 2006, 580(21): 5111-5116. Maddonni GA, Otegui ME, Cirilo AG. Plant population density, row spacing and hybrid effects on maize canopy architecture and light attenuation. Field Crops Research, 2012, 71: 183-193.

[0097] Mansfield BD, Mumm RH. Survey of plant density tolerance in U.S. maize germplasm. Crop Science, 2014, 54:157-173.

[0098] Palatnik JF, Allen E, Wu XL, Schommer C, Schwab R, Carrington JC, Weigel D. Control of leaf morphogenesis by microRNAs. Nature, 2003, 425(6955): 257-263.

[0099] Palatnik JF, Wollmann H, Schommer C, Schwab R, Boisbouvier J, Rodriguez R, Warthmann N, Allen E, Dezulian T, Huson D, Carrington JC, Weigel D. Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319. Development Cell, 2007, 13(1): 115-125.

[0100] Park W, Li J, Song R, Messing J, Chen X CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Current Biology, 2002, 12: 1484-1495.

[0101] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP. MicroRNAs in plants. Genes & Development, 2002, 16: 1616-1626

[0102] Schommer C, Palatnik JF, Aggarwal P, Chételat A, Cubas P, Farmer EE, Nath U, Weigel D. Control of jasmonate biosynthesis and senescence by miR319 targets. PLoS Biology, 2008, 6(9): e230.

[0103] Wang B, Lin Z, Li X, Zhao Y, Zhao B, Wu G, Ma X, Wang H, Xie Y, Li Q, Song G, Kong D, Zheng Z, Wei H, Shen R, Wu H, Chen X, Meng Z, Wang T, Li Y, Li X, Chen Y, Lai J, Hufford MB, Ross-Ibarra J, He H, Wang H. Genome-wide selection and genetic improvement during modern maize breeding. Nature Genetics, 2020, 52(6):565-571.

[0104] Yang C, Li D, Mao D, Liu X, Ji C, Li X, Zhao X. Overexpression of microRNA319 impacts leaf morphogenesis and leads to enhanced cold tolerance in rice (Oryza sativa L.). Plant Cell Environment, 2013, 36:2207-2218.

[0105] Zhang B, Pan X, Cobb GP, Anderson TA. Plant microRNA: A small regulatory molecule with big impact. Development Biology, 2006, 289:3-16.

[0106] Zhou M, Li D, Li Z, Hu Q, Yang C, Zhu L, Luo H. Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bent grass. Plant Physiology, 2013, 161, 1375-1391.

Claims

1. ZmMIR319A The application of genes in regulating the angle of maize leaves is characterized by, Knockout in corn ZmMIR319A This leads to a smaller angle between maize leaves and overexpression. ZmMIR319A This causes an increase in the leaf angle; ZmMIR319A The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the mature miRNA319 sequence encoded by the ZmMIR319A gene is shown in SEQ ID NO.

2.

2. A method for creating a maize leaf angle mutant, characterized in that, The gene editing of claim 1 was achieved using CRISPR / Cas9 gene editing technology. ZmMIR319A Gene knockout yields maize material with reduced leaf angle.

3. The method for creating a maize leaf angle mutant according to claim 2, characterized in that, The CRISPR / Cas9 gene editing technology uses a CRISPR / Cas9 vector designed to target the maize ZmMIR319A gene, with MT1 as the target DNA sequence shown in SEQ ID NO.

3.

4. A method for creating a maize large-leaf angle mutant, characterized in that, The improvement of claim 1 by genetic engineering technology ZmMIR319A Gene expression yielded maize material with increased leaf angle.

5. Obtained based on the method of claim 3 ZmMIR319A Mutant genes ZmMIR319A-KO#1 ZmMIR319A-KO#2 and ZmMIR319A-KO#3 Its characteristics are, As described in claim 1 ZmMIR319A Compared to the mature miR319 sequence encoded by the gene, i.e., SEQ ID NO.2, ZmMIR319A-KO#1 The mature sequence being encoded has a 9bp deletion at positions 1-9; ZmMIR319A-KO#2 The mature sequence being encoded has a 3 bp deletion at positions 6-8; ZmMIR319A-KO#3 The mature sequence being encoded lacks the "C" base at position 6.

Images