One-tube one-step amplicon library construction method for detecting gene fusion

Abstract

The invention relates to the technical field of high-throughput gene sequencing, and discloses a method for one-tube one-step construction of an amplicon library for detecting gene fusion, and the method for one-tube one-step construction of the amplicon library for detecting gene fusion comprises the following steps: carrying out joint connection on total cDNA of a sample in a connection system to obtain a connection product; the connecting system contains ligase and a short Y joint. According to the one-tube type one-step amplicon library construction method for detecting the gene fusion, in order to comprehensively detect the gene fusion and reduce the omission ratio, the gene fusion detection of known and unknown fusion partners is realized by using multiple single-ended anchoring PCR (Polymerase Chain Reaction) to construct a library and designing a specific primer aiming at a specific gene exon; by means of the method, all gene sequences of main gene exon fusion participating in fusion can be amplified without difference, and the problems that an existing detection method is prone to missing detection, and unknown fusion cannot be detected are effectively solved.

Description

Technical Field

[0001] The present invention relates to the technical field of high-throughput gene sequencing, and particularly to a method for detecting gene fusion by one-tube one-step construction of an amplicon library. Background Art

[0002] A fusion gene refers to the process in which all or part of the sequences of two genes are fused into a new gene, which may be the result of chromosomal translocation, interstitial deletion or chromosomal inversion. Currently, the main methods for detecting fusion include fluorescence in situ hybridization (FISH), real-time fluorescence quantitative PCR (RT-PCR), immunohistochemistry (IHC) and next-generation sequencing (NGS), etc., which are detected at the DNA, RNA and protein levels.

[0003] Currently, FISH, RT-PCR, IHC and NGS based on hybridization capture technology or conventional multiplex PCR library construction technology all have the limitations of large sample requirements, easy missed detection and inability to detect unknown fusions. With the wider application of NGS technology in clinical detection and the release of some expert consensus in recent years, it is recommended to use NGS to detect gene fusion.

[0004] NGS detection of fusion based on hybridization capture technology or conventional multiplex PCR library construction technology detects by designing probes to capture or primers to amplify breakpoints. Since the fusion breakpoint positions usually occur in long intron regions and may be different in different patients, it is not easy to amplify breakpoints with traditional PCR. NGS based on hybridization capture often misses detection due to reasons such as long and repetitive intron regions, high GC regions, and complex structural variations. In addition, both hybridization capture technology and conventional multiplex PCR have limitations such as many manual operation steps, long process, cumbersome operation, easy contamination and high cost.

[0005] Currently, in the prior art, for example, the Chinese patent with the publication number CN106835292B discloses a method for one-step rapid construction of an amplicon library, which designs a set of 22 kinds of amplicon primer combinations to construct the library in one step, making the library construction process simpler and more economical. However, this method can only detect several common known fusions, cannot detect rare and unknown fusions, and cannot construct a complete library structure to ensure complete ligation of adapters and achieve the purpose of improving library quality. The library quality needs to be improved. In view of this, we propose a method for detecting gene fusion by one-tube one-step construction of an amplicon library. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for detecting gene fusion by one-tube one-step construction of an amplicon library to solve the problems raised in the above background art.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] A method for one-tube one-step construction of an amplicon library for detecting gene fusion, adding total cDNA of a sample to a ligation system for adapter ligation to obtain a ligation product, and the ligation system contains a ligase and a short Y adapter;

[0009] Wherein the adapter structure is: [5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ / P-5’-GATCGGAAGAGC-3’];

[0010] Adding the obtained ligation product to an amplification system for PCR amplification to obtain an amplification product;

[0011] The amplification system contains an F-end adapter primer, an F-end template primer, an R-end adapter primer and related amplification reagents. Both the F-end adapter primer and the R-end adapter primer contain a sequencing adapter sequence, an index for differentiating samples and a universal sequence. The F-end template primer contains the reverse complement of the universal sequence and the reverse complement sequence of a specific amplification primer. The specific amplification primer is designed for the region near the fusion site of the main gene, and the F-end template primer is [3'CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA-] the reverse complement sequence of the specific amplification primer, with the 3'-end blocked and modified;

[0012] The amplification process includes 2 amplification reaction procedures. First, the F-end adapter primer performs unidirectional amplification using the F-end template primer as a template to construct a long specific primer, and then the constructed long specific primer is used to amplify the target region.

[0013] Preferably, it includes the following steps:

[0014] S1. Adapter ligation, adding total cDNA of a sample to a ligation system for adapter ligation to obtain a ligation product;

[0015] S2. Post-ligation purification, purifying the product of step S1 by magnetic beads to remove unligated adapters and impurities to obtain a purified ligation product;

[0016] S3. One-step amplification, mixing the purified ligation product of step S2 with an amplification system, and the amplification system contains an F-end adapter primer, an F-end template primer, an R-end adapter primer and a multiplex PCR enzyme Mix for single-tube single-time PCR amplification;

[0017] S4. Post-one-step amplification purification, purifying the product of step S3 by magnetic beads to remove unbound primers and impurities to obtain a library product, and performing high-throughput sequencing on the purified library product to detect gene fusion.

[0018] Preferably, the step S1 specifically includes the following steps:

[0019] S11. Thaw the Rapid Ligation buffer, invert and mix well, and place it on ice for later use;

[0020] S12. Prepare the reaction on ice in the PCR tube of the End Preparation step;

[0021] S13. Gently pipette and mix well (do not mix by shaking), and briefly centrifuge to collect the reaction solution at the bottom of the tube;

[0022] S14. Place the PCR tube in a PCR instrument and carry out the reaction.

[0023] Preferably, in the step S14, when the amount of Input DNA is low, try to double the ligation time. When extending the reaction time results in an increase in Adapter Dimer, it is necessary to adjust the usage concentration of the Adapter simultaneously.

[0024] Preferably, the step S2 specifically includes the following steps:

[0025] S21. Take 60 μL of magnetic beads in an eight-well tube, add all the products of the final reaction in the step S1, pipette or vortex to mix well, and let it stand at room temperature for 5 min;

[0026] S22. Centrifuge instantaneously, place it on a magnetic stand, let it stand for 3 min, and discard the supernatant after the liquid becomes clear, avoiding touching the magnetic beads;

[0027] S23. Add 180 μL of freshly prepared 80% ethanol, let it stand for 30 s, and discard the supernatant after the solution becomes clear;

[0028] S24. Repeat the previous step for a total of two washes;

[0029] S25. Cover the tube cap, centrifuge instantaneously to centrifuge the residual ethanol to the bottom of the tube, place the eight-well tube on a magnetic stand, use a 10 μL pipette to aspirate the residual ethanol, let it stand at room temperature for 3 min to ensure that the ethanol evaporates completely, but do not over-dry;

[0030] S26. Remove the eight-well tube from the magnetic stand, add 22 μL of Nuclease-Free Water, pipette or vortex to mix well, and let it stand at room temperature for 2 min;

[0031] S27. Place the eight-well tube on the magnetic stand for 2 min until the solution becomes clear;

[0032] S28. Aspirate 20 μL of the supernatant, transfer it to a new PCR tube or eight-well tube, make a mark, and prepare for the one-step amplification reaction in the step S3.

[0033] Preferably, the supernatant extracted in step S28 is stored at 4°C for 7 days.

[0034] Preferably, step S3 specifically includes the following steps:

[0035] S31. Thaw the customized Primer Mix and multiplex PCR enzyme Mix, then invert and mix well, and prepare them in a sterilized PCR tube.

[0036] S32. Use a pipette to pipette and mix well (avoid vigorous shaking and mixing), then centrifuge briefly.

[0037] S33. Set the PCR instrument program, place the reaction solution on the PCR instrument, and run the program.

[0038] Preferably, the total concentration of the adapter primers in step S31 is greater than the total concentration of the template primers.

[0039] Preferably, the hot lid temperature in step S33 is 105°C.

[0040] Preferably, step S4 specifically includes the following steps:

[0041] S41. Take 50 μL of magnetic beads in an eight-well tube, add all the products of the final reaction in step S3, pipette or vortex to mix well, and let it stand at room temperature for 5 min.

[0042] S42. Centrifuge briefly, place it on the magnetic stand, let it stand for 3 min, and discard the supernatant after the liquid becomes clear, taking care not to touch the magnetic beads.

[0043] S43. Add 180 μL of freshly prepared 80% ethanol, let it stand for 30 s, and discard the supernatant after the solution becomes clear.

[0044] S44. Repeat the previous step for a total of two washes.

[0045] S45. Use a 10 μL pipette to aspirate the residual ethanol, let it stand at room temperature for 3 min to ensure that the ethanol has evaporated completely, but do not over-dry.

[0046] S46. Add 22 μL of Nuclease-Free Water, remove the eight-well tube from the magnetic stand, pipette or vortex to mix well, and let it stand at room temperature for 2 min.

[0047] S47. Centrifuge briefly, place the eight-well tube on the magnetic stand for 2 min until the solution becomes clear.

[0048] S48. Aspirate 20 μL of the supernatant into a new 1.5 mL centrifuge tube.

[0049] S49. Measure and record the library concentration and fragment size.

[0050] S410. Perform on-machine sequencing.

[0051] Compared with the prior art, the present invention provides a method for constructing an amplicon library in one tube and one step for detecting gene fusion, which has the following beneficial effects:

[0052] 1. For the method of constructing an amplicon library in one tube and one step for detecting gene fusion, in order to comprehensively detect gene fusion and reduce the missed detection rate, by using multiplex single-end anchored PCR to construct a library and designing specific primers for specific gene exons, the detection of gene fusion with known and unknown fusion partners is realized, achieving the purpose of comprehensively detecting gene fusion and reducing the missed detection rate. This method can amplify all gene sequences of the exon fusion of the main gene involved in the fusion without discrimination, effectively solving the problems of easy missed detection and inability to detect unknown fusions in the existing detection methods.

[0053] 2. For the method of constructing an amplicon library in one tube and one step for detecting gene fusion, in order to simplify the library construction process, save time, manpower and costs, by optimizing the library construction process, a single-tube and single-time PCR reaction is used to achieve the amplification of the target region and the ligation of sequencing adapters, reducing multiple purification and quantification work, achieving the purpose of simplifying the library construction process and saving resources. At the same time, it avoids potential mistakes caused by frequent manual operations and the risk of sample cross-contamination caused by repeated opening of the lid, and also reduces the DNA loss and contamination risk caused by multiple sample transfers in the conventional multiplex PCR method.

[0054] 3. For the method of constructing an amplicon library in one tube and one step for detecting gene fusion, in order to improve the library quality and ensure the uniformity and representativeness of the library, by constructing a complete library structure and ensuring complete ligation of the adapters, the purpose of improving the library quality is achieved. This technology makes the prepared library of higher quality, providing a reliable guarantee for subsequent accurate gene fusion detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 Schematic diagram of the library fragment size constructed by the present invention;

[0056] Figure 2 Result diagram of detecting CD74 EXON6 fusion by the present invention;

[0057] Figure 3 Result diagram of detecting ROS1 EXON34 fusion by the present invention;

[0058] Figure 4 Flowchart of the final library creation of the present invention;

[0059] Figure 5 Flowchart of the overall method steps of the present invention;

[0060] Figure 6 Flowchart of step S1 of the present invention;

[0061] Figure 7 This is the flowchart of step S2 of the present invention;

[0062] Figure 8 This is the flowchart of step S3 of the present invention;

[0063] Figure 9 This is the flowchart of step S4 of the present invention. Detailed implementation manners

[0064] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0065] In the present application, the orientation or positional relationship indicated by the term "upper" is based on the orientation or positional relationship shown in the accompanying drawings. It is mainly for better describing the present application and its embodiments, and is not used to limit that the indicated device, element or component must have a specific orientation, or be constructed and operated in a specific orientation. And, the term "upper" may also be used to represent a certain attachment relationship or connection relationship in some cases. For those of ordinary skill in the art, the specific meanings of these terms in the present application can be understood according to specific circumstances.

[0066] Please refer to Figure 1 - Figure 9 The present invention provides a technical solution:

[0067] A method for one-tube one-step construction of an amplicon library for detecting gene fusion, adding total cDNA of a sample to a ligation system for adapter ligation to obtain a ligation product, and the ligation system contains a ligase and a short Y adapter;

[0068] wherein the adapter structure is: [5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ / P-5’-GATCGGAAGAGC-3’];

[0069] Adding the obtained ligation product into an amplification system for PCR amplification to obtain an amplification product;

[0070] The amplification system contains an F-end adapter primer, an F-end template primer, an R-end adapter primer and related amplification reagents. Both the F-end adapter primer and the R-end adapter primer contain a sequencing adapter sequence, an index for differentiating samples and a universal sequence. The F-end template primer contains the reverse complement of the universal sequence and the reverse complement sequence of the specific amplification primer. The specific amplification primer is designed for the region near the fusion site of the main gene. The F-end template primer is the reverse complement sequence of the [3'CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA-] specific amplification primer, with the 3' end blocked and modified;

[0071] The amplification process includes two amplification reaction procedures. First, the F-end adapter primer performs unidirectional amplification using the F-end template primer as a template to construct a long specific primer, and then the constructed long specific primer is used to amplify the target region:

[0072] Taking the ROS1 gene as an example, 3 specific primers are designed for ROS1 Exon 32\34\35: [CACTGTATTGAATTTTTACTCCCTTCTAGTAAT /

[0073] GGATTGTAACAACCAGAAATATTCCAACTAT / TCACCCCTTCCTTGGCACT];

[0074] The F-end template primer contains the reverse complement sequence of each specific primer, namely: [ATTACTAGAAGGGAGTAAAAATTCAATACAGTG /

[0075] ATAGTTGGAATATTTCTGGTTGTTACAATCC / AGTGCCAAGGAAGGGGTGA].

[0076] In addition, the following steps are also included:

[0077] S1. Adapter ligation. Add the total cDNA of the sample to the ligation system for adapter ligation to obtain a ligation product;

[0078] S2. Purification after ligation. Purify the product of step S1 through magnetic beads to remove unligated adapters and impurities to obtain a purified ligation product;

[0079] S3. One-step amplification. Mix the purified ligation product of step S2 with the amplification system. The amplification system contains an F-end adapter primer, an F-end template primer, an R-end adapter primer and a multiplex PCR enzyme Mix, and perform single-tube single-time PCR amplification;

[0080] S4. Purification after one-step amplification: Purify the product of step S3 using magnetic beads to remove unbound primers and impurities, obtaining a library product. Perform high-throughput sequencing on the purified library product to detect gene fusions.

[0081] In one embodiment of the present invention, step S1 specifically includes the following steps:

[0082] S11. Thaw the Rapid Ligation buffer and invert it gently to mix well, then place it on ice for later use.

[0083] S12. Prepare the following reaction (Table 1) on ice in the PCR tube for the End Preparation step:

[0084] Table 1

[0085] Component Volume (ul) Previous step product 50 Rapid Ligation buffer 25 Rapid DNA Ligase 5 ddH2O 10 Custom DNA Adapter (added last) 10 total Total system: 100

[0086] S13. Gently pipette to mix well (do not mix by shaking), and briefly centrifuge to collect the reaction solution at the bottom of the tube.

[0087] S14. Place the PCR tube in a PCR instrument and perform the following reaction (Table 2). When the amount of Input DNA is low, try doubling the ligation time. When increasing the reaction time results in an increase in Adapter Dimer, the Adapter usage concentration needs to be adjusted simultaneously:

[0088] Table 2

[0089] Temperature Time Hot lid: 105°C On 20℃ 15 min 4℃ Hold

[0090] In one embodiment of the present invention, step S2 specifically includes the following steps:

[0091] S21. Take 60 μL of magnetic beads in an eight-strip tube, add all the products of the final reaction in step S1, pipette or vortex to mix well, and let it stand at room temperature for 5 min.

[0092] S22. Centrifuge briefly, place it on a magnetic stand, let it stand for 3 min, and discard the supernatant when the liquid becomes clear, taking care not to touch the magnetic beads.

[0093] S23. Add 180 μL of freshly prepared 80% ethanol, let it stand for 30 s, and discard the supernatant when the solution becomes clear.

[0094] S24. Repeat the previous step for a total of two washes.

[0095] S25. Cover the tube lid, centrifuge briefly to centrifuge the residual ethanol to the bottom of the tube, place the eight-strip tube on a magnetic stand, use a 10 μL pipette to aspirate the residual ethanol, and let it stand at room temperature for 3 min to ensure that the ethanol has evaporated completely, but do not over-dry.

[0096] S26. Remove the eight - tube strip from the magnetic stand, add 22 μL of Nuclease - Free Water, pipette up and down or vortex to mix evenly, and let it stand at room temperature for 2 min;

[0097] S27. Place the eight - tube strip on the magnetic stand for 2 min until the solution becomes clear;

[0098] S28. Pipette 20 μL of the supernatant and transfer it to a new PCR tube or eight - tube strip, make a mark, and prepare for the one - step amplification reaction in step S3. The extracted supernatant can be stored at 4 °C for 7 days.

[0099] In one embodiment of the present invention, step S3 specifically includes the following steps:

[0100] S31. Thaw the customized Primer Mix and multiplex PCR enzyme Mix, invert and mix evenly, and prepare in a sterilized PCR tube (Table 3):

[0101] Table 3

[0102] Component Volume (ul) Purified Adapter Ligation product 20 Template primer Mix 2 Adapter primer 2 Multiplex PCR enzyme Mix 6 Total 30

[0103] Note: The total concentration of the adapter primer is greater than the total concentration of the template primer.

[0104] S32. Use a pipette to mix evenly (avoid vigorous shaking), and then centrifuge briefly;

[0105] S33. Set the PCR instrument program as follows, place the reaction solution on the PCR instrument, and run the program (Table 4):

[0106] Table 4

[0107]

[0108] In one embodiment of the present invention, step S4 specifically includes the following steps:

[0109] S41. Take 50 μL of magnetic beads in an eight - tube strip, add all the products of the final reaction in step S3, pipette up and down or vortex to mix evenly, and let it stand at room temperature for 5 min;

[0110] S42. Centrifuge briefly, place it on the magnetic stand, let it stand for 3 min, and discard the supernatant after the liquid becomes clear, avoiding touching the magnetic beads;

[0111] S43. Add 180 μL of freshly prepared 80% ethanol, let it stand for 30 s, and discard the supernatant after the solution becomes clear;

[0112] S44. Repeat the above step for a total of two washes;

[0113] S45. Use a 10 μL pipette to aspirate the residual ethanol, and let it stand at room temperature for 3 min to ensure that the ethanol has evaporated completely, but do not over-dry it.

[0114] S46. Add 22 μL of Nuclease-Free Water, remove the eight-strip tube from the magnetic stand, pipette or vortex to mix well, and let it stand at room temperature for 2 min.

[0115] S47. Centrifuge briefly, place the eight-strip tube on the magnetic stand for 2 min until the solution is clear.

[0116] S48. Aspirate 20 μL of the supernatant into a new 1.5 mL centrifuge tube.

[0117] S49. Measure and record the library concentration and fragment size.

[0118] S410. Sequence on the machine.

[0119] Furthermore, the fragment size of the constructed library is as Figure 1 shown.

[0120] Detection results (Table 5):

[0121] Table 5

[0122]

[0123] CD74 EXON6 / ROS1 EXON34 fusion positive was detected (see Figure 2 , Figure 3 ).

[0124] The present invention has been generally and exhaustively described above. However, based on the present invention, some modifications or improvements can be made, which are obvious to those of ordinary skill in the art. Therefore, modifications or improvements made without departing from the spirit and idea of the present invention are within the protection scope of the present invention.

Claims

1. A one-tube, one-step method for constructing an amplicon library for detecting gene fusions, characterized in that: The total cDNA of the sample is added to the ligation system for linker ligation to obtain a ligation product, wherein the ligation system contains a ligase and a short Y linker; The linker structure is: [5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' / P-5'-GATCGGAAGAGC-3']; The obtained ligation product is added into the amplification system for PCR amplification to obtain an amplification product; The amplification system contains an F-terminal adapter primer, an F-terminal template primer, an R-terminal adapter primer and related amplification reagents. Both the F-terminal adapter primer and the R-terminal adapter primer contain a sequencing adapter sequence, an index and a universal sequence for distinguishing samples. The F-terminal template primer contains a universal sequence reverse complement and a specific amplification primer reverse complement sequence. The specific amplification primer is designed for the region near the fusion site of the main gene. The F-terminal template primer is [3'CACTGACCTCAAGTCTGCACACGAGAAGGCTAGA-] a specific amplification primer reverse complement sequence, and the 3' end is blocked and modified; The amplification process includes two amplification reaction procedures. First, the F-terminal adapter primer uses the F-terminal template primer as a template for unidirectional amplification to construct a long specific primer, and then the constructed long specific primer is used to amplify the target region.

2. A one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 1, characterized in that The following steps are involved: S1, adapter ligation, adding the total cDNA of the sample to the ligation system for adapter ligation to obtain a ligation product; S2, purification after ligation, purifying the product of step S1 by magnetic beads to remove unligated connectors and impurities to obtain a purified ligation product; S3, one-step amplification, mixing the connection product purified in step S2 with an amplification system, the amplification system comprising an F-terminal adapter primer, an F-terminal template primer, an R-terminal adapter primer and a multiplex PCR enzyme Mix, and performing a single-tube single-time PCR amplification; S4: Purification after one-step amplification: The product of step S3 is purified by magnetic beads to remove unbound primers and impurities to obtain library products. The purified library products are subjected to high-throughput sequencing to detect gene fusion.

3. A one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 2, characterized in that: The S1 step specifically includes the following steps: S11. Thaw the Rapid Ligation buffer, mix thoroughly by inversion, and place on ice for later use. S12, prepare the reaction on ice in the PCR tube in the End Preparation step; S13. Use a pipette to gently pipette and mix well, and centrifuge briefly to collect the reaction solution at the bottom of the tube; S14. Place the PCR tube in a PCR instrument to perform the reaction.

4. The one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 3, characterized in that: In step S14, when the amount of input DNA is low, try to double the connection time. If the extension of reaction time leads to an increase in Adapter Dimer, the Adapter concentration needs to be adjusted at the same time.

5. The one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 4, characterized in that: The S2 step specifically includes the following steps: S21, take 60 μL of magnetic beads into eight tubes, add all the products of the final reaction in step S1, pipette or vortex to mix, and let stand at room temperature for 5 minutes; S22, centrifuge briefly, place on a magnetic stand, let stand for 3 minutes, discard the supernatant after the liquid is clear, and avoid touching the magnetic beads; S23, add 180 μL of freshly prepared 80% ethanol, let stand for 30 seconds, and discard the supernatant after the solution becomes clear; S24, repeat the previous step, washing twice in total; S25, cover the tube cap, centrifuge briefly, centrifuge the residual ethanol to the bottom of the tube, place the eight-tube strip on a magnetic rack, use a 10μL pipette to remove the residual ethanol, and let it stand at room temperature for 3 minutes; S26. Remove the eight-tube strip from the magnetic rack, add 22 μL Nuclease-Free Water, pipette or vortex to mix, and let stand at room temperature for 2 min. S27, place the eight-tube strip on the magnetic rack for 2 minutes to wait for the solution to become clear; S28. Take 20 μL of supernatant and transfer it to a new PCR tube or eight-tube strip, mark it, and prepare for the one-step amplification reaction in step S3.

6. The one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 5, characterized in that: The supernatant extracted in step S28 is stored at 4° C. for 7 days.

7. A one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 6, characterized in that: The S3 step specifically includes the following steps: S31, thaw the customized Primer Mix and multiple PCR enzyme Mix, mix them by inversion, and prepare them in a sterilized PCR tube; S32, use a pipette to mix, and then centrifuge briefly; S33, set the PCR instrument program, place the reaction solution on the PCR instrument, and run the program.

8. The one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 7, characterized in that: The total concentration of the adapter primers in step S31 is greater than the total concentration of the template primers.

9. The one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 8, characterized in that: The temperature of the hot cover in step S33 is 105°C.

10. The one-tube one-step method for constructing an amplicon library for detecting gene fusion according to claim 9, characterized in that: The S4 step specifically includes the following steps: S41, take 50 μL of magnetic beads into eight tubes, add all the products of the final reaction in step S3, pipette or vortex to mix, and let stand at room temperature for 5 minutes; S42, centrifuge briefly, place on a magnetic stand, let stand for 3 minutes, discard the supernatant after the liquid is clear, and avoid touching the magnetic beads; S43, add 180 μL of freshly prepared 80% ethanol, let stand for 30 seconds, and discard the supernatant after the solution becomes clear; S44, repeat the previous step, washing twice in total; S45, remove the residual ethanol with a 10 μL pipette and let stand at room temperature for 3 min; S46, add 22 μL of Nuclease-Free Water, remove the eight-tube strip from the magnetic stand, pipette or vortex to mix, and let stand at room temperature for 2 min; S47, instant centrifuge, place the eight-tube strip on a magnetic rack for 2 minutes, and wait for the solution to become clear; S48, pipette 20 μL of supernatant into a new 1.5mL centrifuge tube; S49, measuring and recording the library concentration and fragment size; S410, sequencing on the machine.

Images