Respiratory tract allergic inflammation relieving agent based on environmental microorganism extract and application of respiratory tract allergic inflammation relieving agent

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a respiratory tract allergic inflammation relieving agent based on environmental microorganism extracts and application of the respiratory tract allergic inflammation relieving agent. According to the invention, the application of the paracoccus iili in preparation of the product for preventing and treating the chronic respiratory disease is found for the first time, and the paracoccus iili as a purely natural and pollution-free environmental beneficial bacterium does not destroy the balance of microorganisms in an indoor environment, can generate beneficial metabolites, and is beneficial to reducing the risk of the respiratory disease. Cell and animal experiments find that the paracoccus Iili can reduce asthma-related inflammatory factors, directly acts on respiratory mucosa through inhalation exposure, can play a role in preventing and protecting respiratory diseases, and has a good development value. The asthma prevention and treatment product based on paracoccus Israei can be combined with balance maintenance of microbial communities, and a comprehensive and sustainable respiratory disease risk prevention effect is provided for the indoor environment.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a respiratory allergic inflammation reliever based on environmental microbial extracts and its application. Background Art

[0002] Asthma, as a highly prevalent chronic respiratory disease globally, can affect people of all ages, and its onset is closely related to environmental exposure. Certain exposure factors in the environment, such as environmental smoke and indoor dampness, are considered risk factors for increasing the occurrence and exacerbation of asthma.

[0003] Traditional treatments mainly involve inhaled corticosteroids (such as budesonide) combined with β 2 receptor agonists (such as salbutamol). Although they can relieve symptoms in the short term, long-term use may cause side effects such as drug resistance, hormone dependence, and metabolic disorders. In recent years, more green, safe, and lower-side-effect asthma treatment-related products have also been developed in this technical field. For example, CN 117205206 A discloses the application of tryptophan metabolites in the preparation of products for treating and / or relieving asthma. After intraperitoneal injection and nasal instillation of an 8 g / L tryptophan metabolite solution into a mouse asthma model, the asthma symptoms of the mice can be improved. However, this administration method still has an invasive risk. Therefore, it is necessary to develop a spray-type product with higher safety.

[0004] At the present stage, research on probiotics related to asthma treatment is also being developed in this field. It has been reported that the breast milk-derived Bifidobacterium lactis Probio-M8 can effectively regulate the "gut-lung axis" and prevent and relieve asthma symptoms. However, the environmental source-related probiotic resources closely related to the asthma living environment still need to be developed. Summary of the Invention

[0005] To solve the above technical problems, the present invention conducts investigations on the living environment samples of asthma patients and healthy people, and screens and discovers new indoor environmental beneficial bacteria that have a protective effect on asthma.

[0006] To achieve the above object of the present invention, the technical solution adopted by the present invention is:

[0007] In a first aspect of the present invention, there is provided the application of Paracoccus yeei in the preparation of products for preventing and treating chronic respiratory diseases.

[0008] In some embodiments of the present invention, the chronic respiratory diseases include asthma, chronic obstructive pulmonary disease, chronic bronchitis, allergic rhinitis, allergic cough, etc.

[0009] In some embodiments of the present invention, the standard taxonomic nomenclature of the Paracoccus yeei is Paracoccus yeei, which is a strain of the genus Paracoccus.

[0010] In some embodiments of the present invention, the strain number of Paracoccus yeei is CICC 24331, the platform resource number in the national strain resource library is 1511C0005000012018, the original number is G2-13, and the resource classification code is 15131135102. This strain was directly purchased from Beijing Bio-win Biotechnology Co., Ltd., and the product number is bio-116116. In some embodiments of the present invention, the Paracoccus yeei includes extracts and cultures of Paracoccus yeei.

[0011] In some embodiments of the present invention, the extract refers to a product obtained by directly crushing, separating, and extracting Paracoccus yeei.

[0012] In some embodiments of the present invention, the culture refers to related products obtained by inoculating Paracoccus yeei into a culture medium for cultivation.

[0013] In some embodiments of the present invention, the product is a culture supernatant separation liquid of Paracoccus yeei. This culture supernatant separation liquid is obtained by inoculating Paracoccus yeei into a TSA culture medium, culturing, and centrifuging.

[0014] In some embodiments of the present invention, the temperature of the cultivation is 25-32°C.

[0015] In some embodiments of the present invention, the time of the cultivation is 12-96 h.

[0016] In some embodiments of the present invention, the product is a drug.

[0017] In some embodiments of the present invention, the drug further includes pharmaceutically acceptable excipients.

[0018] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, antiadhesives, chelating agents, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoaming agents, thickeners, clathrates, humectants, absorbents, diluents, flocculants and deflocculants, filter aids, release retardants, carriers.

[0019] The above-mentioned pharmaceutically acceptable excipients are generally recognized for this purpose and serve as inactive ingredients of the pharmaceutical agent. Compilations of pharmaceutically acceptable excipients can be found in tools such as "Handbook of Pharmaceutical Excipients" (2nd Edition, edited by A. Wade and P. J. Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical Press, London, 1994); "Pharmacopoeia of the People's Republic of China - List of Names of Pharmaceutical Excipients", etc.

[0020] In some embodiments of the present invention, the dosage form of the drug includes an enteral dosage form or a parenteral dosage form.

[0021] In some embodiments of the present invention, the enteral dosage form includes at least one of powders, tablets, granules, capsules, sustained-release agents, solutions, dry suspensions, effervescent tablets, emulsions, suspensions, syrups, drops, chewable tablets.

[0022] In some embodiments of the present invention, the parenteral dosage form includes at least one of injection dosage forms, respiratory dosage forms, skin dosage forms, mucosal dosage forms, and cavity dosage forms.

[0023] Further preferably, the dosage form is a respiratory dosage form, specifically including aerosols, sprays, atomized products, etc.

[0024] In a second aspect of the present invention, there is provided a product comprising a culture and / or extract of Paracoccus yeei.

[0025] In some embodiments of the present invention, the product is a drug; the drug further includes pharmaceutically acceptable excipients.

[0026] In a third aspect of the present invention, there is provided a method for preparing the product according to the second aspect of the present invention, comprising the following steps:

[0027] Inoculate Paracoccus yeei in a culture medium and culture to obtain.

[0028] In some embodiments of the present invention, the culture medium includes TSA medium, NA medium, and R2A medium.

[0029] In some embodiments of the present invention, the temperature of the culture is 25 - 32 °C.

[0030] In some embodiments of the present invention, the time of the culture is 12 - 96 h.

[0031] The beneficial effects of the present invention are as follows:

[0032] The present invention first discovers the use of Paracoccus yeei in the preparation of products for preventing and treating chronic respiratory diseases. As a natural and pollution-free environmental beneficial bacterium, Paracoccus yeei will not disrupt the balance of microorganisms in the indoor environment, and can also produce beneficial metabolites, which is beneficial to reducing the risk of respiratory diseases. Through cell and animal experiments, the present invention finds that Paracoccus yeei can reduce asthma-related inflammatory factors, directly act on the respiratory mucosa through inhalation exposure, and can play its role in preventing and protecting respiratory diseases, with good development value. The asthma prevention and treatment products based on Paracoccus yeei can be combined with the maintenance of the balance of the microbial community, so as to comprehensively and effectively reduce the asthma risk of high-risk populations of respiratory diseases, especially children and adults with a family history of allergies, and provide a comprehensive and sustainable preventive effect on respiratory diseases for the indoor environment. Brief Description of the Drawings

[0033] The following further describes the present invention in conjunction with the drawings and embodiments, wherein:

[0034] Figure 1 Results of metagenomic detection of household dust samples of healthy people, patients with allergic rhinitis (AR), patients with asthma and allergic rhinitis comorbidity (Comorbidity), and asthma patients (Asthma).

[0035] Figure 2 Shows the changes in inflammatory factors after treating 16HBE cells with L-tryptophan and bacterial culture supernatant (BCS) respectively. Among them, A-D are the expression changes of IL-6, IL-8, IL-1β, and IFN-γ genes after treating 16HBE cells with bacterial culture supernatant at 0, 1:100, 1:50, and 1:10 for 24 hours detected by qRT-PCR; E-G are the change results of IL-6, IL-8, and IL-1β genes after treating 16HBE cells with 0, 10, 50, and 100 μM of L-tryptophan for 24 hours detected by qRT-PCR.

[0036] Figure 3 Shows the changes in inflammatory factors after treating 16HBE cells with L-tryptophan and bacterial culture supernatant (BCS) respectively. Among them: A-D are the expression changes of TGF-β, IL-4, IL-13, and IL-33 genes after treating 16HBE cells with bacterial culture supernatant at 0, 1:100, 1:50, and 1:10 for 24 hours detected by qRT-PCR; E-G are the change results of TGF-β, IL-4, IL-13, and IL-33 genes after treating 16HBE cells with 0, 10, 50, and 100 μM of L-tryptophan for 24 hours detected by qRT-PCR.

[0037] Figure 4 Results of the apparent fur changes in each group of mice: Among them, A is the control group; B is the asthma model group; C is the first product intervention group; D is the second product intervention group.

[0038] Figure 5 Results of the pathological structure of the lung tissue in each group of mice: Among them, A is the control group; B is the asthma model group; C is the first product intervention group; D is the second product intervention group.

[0039] Figure 6 Results of mucus secretion in the lung tissue of each group of mice (PAS staining): Among them, A is the control group; B is the asthma model group; C is the first product intervention group; D is the second product intervention group. Specific implementation manners

[0040] The following will clearly and completely describe the concept and technical effects of the present invention in combination with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of the present invention.

[0041] Example 1 Screening of Paracoccus yeei

[0042] 1. Sample source

[0043] 97 cases were selected in Shanghai, China, including 32 cases of simple asthma patients, 37 cases of simple allergic rhinitis (AR) patients, 28 cases of asthma and AR comorbidity patients, and 52 cases of age- and gender-matched control groups were established. Dust samples of the above patients' families were collected for metagenomic detection. The relevant experiments were permitted by the Ethics Committee of the School of Public Health, Fudan University (IRB#2019-09-0778), and informed consent of the subjects was obtained.

[0044] 2. Experimental results

[0045] After metagenomic detection of the dust samples of these families, it was found that two species in the genus Paracoccus were enriched in healthy families, among which Paracoccus yeei was the first dominant flora in healthy families ( Figure 1 ). In this example, the Paracoccus yeei strain with the product number bio-116116 of Beijing Bio-win Biotech Co., Ltd. was purchased, and a stable culture system was established after trying various culture conditions.

[0046] Example 2 Cultivation of Paracoccus yeei

[0047] 1. Preparation of culture medium

[0048] Paracoccus yeei (Beijing BioWin Biotechnology Co., Ltd., product number bio-116116) uses tryptone soy agar (TSA) as the culture medium, and its components include 15.0 g of tryptone, 5.0 g of soy peptone, 5.0 g of NaCl, 15.0 g of agar, and 1000.0 mL of distilled water. Adjust the pH to 7.3. After mixing the above components, sterilize them at 121 °C for 15 min.

[0049] 2. Bacterial culture

[0050] Inoculate Paracoccus yeei into the culture medium and culture it in a gas bath constant temperature oscillator at 28 °C for 48 hours.

[0051] 3. Treatment of culture

[0052] The cultured Paracoccus yeei suspension is centrifuged at 4 °C and 3000 rcf for 30 min, the supernatant is collected, filtered through a 0.22 μm filter, and the metabolite supernatant is sterilized. Separate the supernatant containing metabolites and store it at 4 °C. Dilute it according to specific circumstances when in use.

[0053] Example 3 Paracoccus yeei reduces the level of asthma-related inflammation at the cellular level

[0054] 1. Experimental method

[0055] Select human normal bronchial epithelial cells 16HBE and culture them in DMEM medium (containing 10% FBS and 1% double antibody) at 37 °C and 5% CO 2 conditions.

[0056] L-tryptophan treatment: Divide into 4 groups, namely the control group, low-dose intervention group, medium-dose intervention group, and high-dose intervention group. The added L-tryptophan concentrations are 0, 10, 50, and 100 μM respectively.

[0057] Treatment with bacterial culture supernatant: Divide into 4 groups, namely the control group, bacterial culture supernatant intervention group I, bacterial culture supernatant intervention group II, and bacterial culture supernatant intervention group III. Dilute the bacterial culture supernatant with cell culture medium, and the dilution ratios (volume ratio, bacterial culture supernatant: cell culture medium) are 0, 1:100, 1:50, and 1:10 respectively.

[0058] Inoculate 16HBE cells into a 6-well plate. When the cell density reaches 80%, perform the above intervention treatment. Extract RNA after 24 hours. Subsequently, use real-time fluorescence quantitative PCR to detect the changes in inflammatory factors in each group.

[0059] Table 1 Primer sequence information

[0060] Gene Primer Sequence (5' to 3') GAPDH F: GCACCGTCAAGGCTGAGAAC (SEQ ID NO: 1) R: TGGTGAAGACGCCAGTGGA (SEQ ID NO: 2) IL-4 F: GACTCGCCTACAAAGCCCAGA (SEQ ID NO: 3) R: AGCTGCTTGTGCCTGTGGAA (SEQ ID NO: 4) IL-6 F: AGGAGACTTGCCTGGTGAAAAT (SEQ ID NO: 5) R: GCTCTGGCTTGTTCCTCACTAC (SEQ ID NO: 6) IL-8 F: CACTGTGTGTAAACATGACTTCCAA (SEQ ID NO: 7) R: TGTGGTCCACTCTCAATCACTCTC (SEQ ID NO: 8) IL-13 F: GTATGGAGCATCAACCTGACAGC (SEQ ID NO: 9) R: TCAGCATCCTCTGGGTCTTCTC (SEQ ID NO: 10) IL-33 F: CCTACCAGAGCCTAGATGAGACACC (SEQ ID NO: 11) R: AACTTTGCCCAATGTGACAGTGA (SEQ ID NO: 12) IL-1β F: TCCACCTCCAGGGACAGGATA (SEQ ID NO: 13) R: TTCAACACGCAGGACAGGTACA (SEQ ID NO: 14) IFN-γ F: CTTTAAAGATGACCAGAGCATCCAA (SEQ ID NO: 15) R: GGCGACAGTTCAGCCATCAC (SEQ ID NO: 16) TGF-β F: TTCAACACATCAGAGCTCCGAGA (SEQ ID NO: 17) R: GTATCGCCAGGAATTGTTGCTGTA (SEQ ID NO: 18)

[0061] 2. Experimental Results

[0062] The results are as Figure 2 、 3 shown.

[0063] For the innate immune pathway, after treating cells with the supernatant of Paracoccus yeei cultures, the decreased levels of the innate immune pathway inflammatory factors IL-6, IL-8, IL-1β, and IFN-γ showed a significant dose-response relationship. After treating cells with L-tryptophan, the innate immune pathway inflammatory factors decreased significantly at high concentrations, showing a certain dose-response relationship.

[0064] For asthma-related inflammatory factors, after treating cells with the supernatant of Paracoccus yeei cultures, TGF-β, IL-4, IL-13, and IL-33 all decreased to varying degrees. After treating cells with L-tryptophan, TGF-β, IL-4, and IL-13 did not show obvious decreases, and IL-33 even increased significantly.

[0065] The above experiments showed that in bronchial epithelial cells treated with tryptophan, some inflammatory factors decreased significantly, but the dose-response relationship was unstable. In contrast, under the treatment of the supernatant of Paracoccus yeei extracts, the decreased levels of inflammatory factors in bronchial epithelial cells had a significant dose-response relationship with the treatment concentration, and asthma-related inflammatory factors decreased significantly.

[0066] Therefore, at the cellular level, the inhibitory effect of the supernatant of Paracoccus yeei cultures on asthma-related inflammatory factors was better than that of L-tryptophan, and the supernatant of Paracoccus yeei cultures was further selected for animal experiments.

[0067] Example 4 Improvement of Asthma-Related Phenotypes by Paracoccus yeei at the Animal Level

[0068] 1. Experimental Method

[0069] Forty healthy adult female Kunming mice were selected and randomly divided into 4 groups according to the random number method, namely the control group, the asthma model group, product intervention group I, and product intervention group II. Among them, product intervention group I and product intervention group II were parallel control groups (i.e., replicate groups) with the same treatment measures. Ovalbumin (OVA) was used as the allergen in the asthma model group and each product intervention group to establish the asthma state. The control group was replaced with normal saline. The product intervention groups were treated with Paracoccus yeei supernatant by atomization at a ratio of 1:10 (volume ratio, supernatant of bacterial culture medium: normal saline) for one month, and the control group and the asthma model group were replaced with normal saline. Dissection was performed within 24 hours after the last atomization exposure, and serum and lung tissues were taken to detect the indexes related to airway inflammation in the lungs and observe the pathological changes of the lung tissues.

[0070] 2. Experimental results

[0071] Figure 4 It shows the apparent fur changes of mice in each group. After the induction of asthma in the mice in the non-intervention group, symptoms such as dyspnea, scratching, and hair loss appeared, and the symptoms in the product spray intervention group were significantly alleviated.

[0072] Figure 5 It shows the pathological structure of the lung tissues of mice in each group (HE staining). Compared with the control group, the number of inflammatory cells around the bronchi and blood vessels in the mice in the asthma model group increased, and the tracheal basement membrane thickened to 20.3 μm. After atomization intervention with Paracoccus yeei supernatant, the aggregation of inflammatory cells around the bronchi and blood vessels decreased, and the thickening of the airway basement membrane was significantly alleviated, reaching 9.2 μm and 8.6 μm.

[0073] Figure 6 It shows the mucus secretion of the lung tissues of mice in each group (PAS staining). Compared with the control group, the mucus secretion around the bronchi in the mice in the asthma model group increased, and after atomization intervention with Paracoccus yeei supernatant, the mucus secretion decreased.

[0074] In summary, Paracoccus yeei can improve the expression of asthma-related inflammatory factors at the cellular level, reduce the levels of inflammatory factors in the lung tissues, alleviate the aggregation of inflammatory cells around the bronchi and blood vessels, and reduce the thickness of the airway basement membrane at the animal level, and the asthma-related symptoms are significantly improved.

Claims

1. Application of Paracoccus iberimangioides in the preparation of products for preventing and treating chronic respiratory diseases.

2. The use according to claim 1, characterized in that: The chronic respiratory diseases include asthma.

3. The use according to claim 1, characterized in that: The Paracoccus ivanovii includes an extract and a culture of Paracoccus ivanovii.

4. The use according to claim 1, characterized in that: The products include pharmaceutical products.

5. The use according to claim 4, characterized in that: The product also includes acceptable excipients.

6. The use according to claim 5, characterized in that: The acceptable excipients include at least one of solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, adhesives, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesives, integrators, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants and deflocculating agents, filter aids, release retardants, and carriers.

7. A product, characterized in that: The product comprises a culture and / or an extract of Paracoccus ivanovii.

8. The method for preparing the product according to claim 7, comprising the following steps: Paracoccus iberovar Ivanhoe was inoculated into the culture medium and cultured to obtain.

9. The preparation method according to claim 8, characterized in that: The culture medium includes TSA culture medium, NA culture medium and R2A culture medium.

10. The preparation method according to claim 8, characterized in that: The culture temperature is 25-32°C; The culture time is 12 to 96 hours.

Images