Antibacterial peptide with antibacterial and antiviral effects, and application and product thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to an antibacterial peptide with antibacterial and antiviral effects, application and product thereof. The amino acid sequence of the antibacterial peptide has the following general formula: X1GX2FX3FX4KKFX5LFX6X7SKVLK; X1 is M or no amino acid; X2 is one of R, G and H; X3 is one of KS, KR, HR and HH; X4 is R or L; X5 is one of KK, HH and HK; X6 is RR or KK; and X7 is I or L. The antibacterial peptide has good antibacterial effect, and shows antiviral activity to HPV16 and HPV18. The antibacterial peptide shows good application prospect in preparation of antibacterial or antiviral products.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to an antibacterial peptide with antibacterial and antiviral effects, and application and products thereof. BACKGROUND

[0002] Antibacterial peptides are important components of the immune system produced by organisms in the long-term evolution process to adapt to the environment for survival. They are a class of polypeptide small molecules with antibacterial activity, composed of 20-60 amino acids, and have the characteristics of fast bactericidal, broad antibacterial spectrum, and difficult to develop drug resistance, etc. Therefore, the development of antibacterial polypeptide drugs has become a trend to replace antibiotic drugs, and the research and development of bioengineering antibacterial polypeptide drugs based on genetic engineering technology has become the mainstream and direction for a long time. There are many kinds of antibacterial peptides in the biological world, but the number is very limited, it is difficult to extract in batches, and most of the polypeptides in the natural biological world are toxic to the human body. Therefore, how to mass-produce antibacterial peptides with broad-spectrum bactericidal effect and safety to the human body through advanced bioengineering technology has become a difficult problem for many biomedicine researchers.

[0003] However, this problem can be solved by genetic engineering technology. Mainly, the antibacterial peptide gene is cloned or appropriately modified by molecular cloning technology, and then the excellent gene is introduced into a suitable host bacteria, and a high-yield strain is further screened to improve the yield of antibacterial peptides. There are a large number of researches at home and abroad, such as patent CN113336836A for expressing in Escherichia coli; there are also antibacterial peptide genes expressed in insect cell lines (Andersons D, et al. Biologically active and amidated cecropin produced in a baculovirus expression system from a fusion construct containing the antibody-binding part of protein A. Biochem J. 1991 Nov 15; 280 (Pt 1) (Pt

[0004] 1):219-24.).

[0005] The polypeptides with antibacterial effect in the prior art often have a single function, and there is room for further optimization. Moreover, the problems of genetic engineering expression of antibacterial peptides mainly include that the antibacterial peptide molecules are small and easy to be degraded by proteases, and there is a lack of detection method for antibacterial peptides; the expression product of the gene may be harmful to the host, and often needs to be expressed in fusion with other proteins, thereby causing low yield of genetic engineering technology.

[0006] Therefore, it is a hotspot to design a peptide antibiotic with higher activity, more targeting and no toxicity to host cells. SUMMARY

[0007] In view of the above problems, the present application provides an antibacterial peptide with antibacterial and antiviral effects, and application and products thereof. Due to the above-mentioned effects and characteristics, it becomes a raw material for many products, and can develop products in the fields of biological medicine products, health disinfection products, medical equipment products, maintenance and beauty products, daily use cosmetic products and food preservation products.

[0008] The amino acid sequence of the antibacterial peptide provided by the present application has the following general formula:

[0009] X1GX2FX3FX4KKFX5LFX6X7SKVLK;

[0010] X1 is M or no amino acid; X2 is one of R, G and H; X3 is one of KS, KR, HR and HH; X4 is R or L; X5 is one of KK, HH and HK; X6 is RR or KK; and X7 is I or L. The antibacterial peptide has good antibacterial effect and shows antiviral activity against HPV16 and HPV18. It has good application prospect in the preparation of antibacterial or antiviral products.

[0011] In the present application, the amino acid letters have the following meanings:

[0012] A represents alanine; C represents cysteine; D represents aspartic acid; E represents glutamic acid; F represents phenylalanine; G represents glycine; H represents histidine; I represents isoleucine; K represents lysine; L represents leucine; M represents methionine; N represents asparagine; P represents proline; Q represents glutamine; R represents arginine; S represents serine; T represents threonine; V represents valine; W represents tryptophan; and Y represents tyrosine.

[0013] The technical scheme of the present application comprises:

[0014] In a first aspect, the present application provides an antibacterial peptide with antibacterial and antiviral effects, and the amino acid sequence of the antibacterial peptide has the following general formula:

[0015] X1GX2FX3FX4KKFX5LFX6X7SKVLK;

[0016] X1 is M or no amino acid;

[0017] X2 is one of R, G and H;

[0018] X3 is one of KS, KR, HR and HH;

[0019] X4 is R or L;

[0020] X5 is one of KK, HH, HK;

[0021] X6 is RR or KK;

[0022] X7 is I or L.

[0023] Preferably, X1 is M; X2 is R; X3 is KS; X4 is L; X5 is KK; X6 is RR; and X7 is I.

[0024] Preferably, the antibacterial peptide comprises any one or more of the following amino acid sequences, or a partial segment of any one or more of the following sequences:

[0025] SEQ ID NO. 1: MGRFKRFRKKFKKLFRRISKVLK.

[0026] SEQ ID NO. 2: MGRFKSFLKKFKKLFKKLSKVLK.

[0027] SEQ ID NO. 3: MGRFKSFLKKFKKLFRRISKVLK.

[0028] SEQ ID NO. 4: GGFHRFRKKFHKLFKKLSKVLK.

[0029] SEQ ID NO. 5: GHFHHFRKKFHHLFKKLSKVLK.

[0030] Preferably, the antibacterial peptide comprises a sequence having more than 80% homology with any one of the amino acid sequences of SEQ ID NO. 1-5.

[0031] In a second aspect, the present application provides a gene encoding the antibacterial peptide.

[0032] Preferably, the gene comprises any one or more of the following nucleotide sequences, or a partial segment of any one or more of the following sequences:

[0033] SEQ ID NO. 6:

[0034] TGGGCCGCTTTAAACGCTTTCGCAAAAAATTTAAAAAACTGTTTCGCCGCATTAGCAAAGTGCTGAAA.

[0035] SEQ ID NO. 7:

[0036] ATGGGCCGCTTTAAAAGCTTTCTGAAAAAATTTAAAAAACTGTTTAAAAAACTGAGCAAAGTGCTGAAA.

[0037] SEQ ID NO. 8:

[0038] ATGGGAAGGTTCAAATCATTTCTAAAGAAATTCAAAAAGTTGTTTCGCCGTATCAGCAAGGTGCTGAAATAA.

[0039] SEQ ID NO. 9:

[0040] GGCGGCTTTCATCGCTTTCGCAAAAAATTTCATAAACTGTTTAAAAAA CTGAGCAAAGTGCTGAAA.

[0041] SEQ ID NO. 10:

[0042] GGCCATTTTCATCATTTTCGCAAAAAATTTCATCATCTGTTTAAAAAAC TGAGCAAAGTGCTGAAA.

[0043] Preferably, the gene comprises a sequence having more than 80% homology with any one of the nucleotide sequences of SEQ ID NO. 6-10.

[0044] In a third aspect, the present application provides a genetic engineering vector, wherein the genetic engineering vector comprises the gene described above.

[0045] In a fourth aspect, the present application provides a genetic engineering cell, wherein the genetic engineering cell comprises the genetic engineering vector described above.

[0046] In a fifth aspect, the present application provides a method for improving the purity of an antibacterial peptide, wherein the method comprises expressing the antibacterial peptide described above by means of genetic engineering.

[0047] Specifically, the genetic engineering means is to transduce an expression cell by a genetic engineering vector and express the polypeptide.

[0048] Preferably, the genetic engineering vector skeleton comprises a pET-28a vector, a pRSFDuet-1 vector, a pETDuet-1 vector, a pACYCDuet-1 vector or a pTrc99a vector.

[0049] Further preferably, the genetic engineering vector skeleton is a pET-28a vector.

[0050] Preferably, the expression cell is E. coli.

[0051] In a sixth aspect, the present application provides use of the above-mentioned antibacterial peptide, gene, genetically engineered vector, genetically engineered cell and / or the antibacterial peptide prepared by the above-mentioned method in the preparation of an antibacterial and / or antiviral product.

[0052] Specifically, the antibacterial product is directed against one or more of gram-negative bacteria and gram-positive bacteria.

[0053] Preferably, the gram-negative bacteria include one or more of Acinetobacter baumannii, Enterobacter aerogenes, Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia.

[0054] Preferably, the gram-positive bacteria include one or more of Enterococcus faecium, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Listeria monocytogenes, and Staphylococcus aureus.

[0055] Specifically, the antiviral product is directed against HPV virus.

[0056] Preferably, the antiviral product is directed against HPV16 virus and / or HPV18 virus.

[0057] In a seventh aspect, the present application provides an antibacterial or antiviral drug, which comprises the above-mentioned antibacterial peptide, gene, genetically engineered vector, genetically engineered cell and / or the antibacterial peptide prepared by the above-mentioned method.

[0058] Specifically, the dosage form of the drug includes a parenteral dosage form or a gastrointestinal dosage form.

[0059] Preferably, the gastrointestinal dosage form includes, but is not limited to, tablets, powders, granules, solutions, capsules, emulsions, suspensions, and oils.

[0060] Preferably, the parenteral dosage form includes, but is not limited to, injection dosage forms, respiratory dosage forms, skin dosage forms, mucosal dosage forms, and cavity dosage forms.

[0061] Specifically, the drug further comprises one or more pharmaceutically acceptable excipients.

[0062] Preferably, the pharmaceutically acceptable excipient includes, but is not limited to, a solvent, a diluent, a disintegrant, a precipitation inhibitor, a surfactant, a glidant, a binder, a lubricant, a dispersant, a suspending agent, an isotonic agent, a thickening agent, an emulsifying agent, a preservative, a stabilizer, a hydrating agent, an emulsification accelerator, a buffer, an absorbent, a coloring agent, a flavoring agent, a sweetening agent, an ion exchanger, a release agent, a coating agent, a flavoring agent, or an antioxidant.

[0063] In an eighth aspect, the present application provides an antibacterial food additive, which comprises the antibacterial peptide, the gene, the genetic engineering vector, the genetically engineered cell, and / or the antibacterial peptide prepared by the above method.

[0064] Specifically, the food includes human food or animal food.

[0065] Specifically, the food includes, but is not limited to, a candy, a soy milk, a yogurt, a can, a biscuit, a chocolate, a pastry, a butter, a cheese, a cream, a milk powder, an ice cream, a popsicle, a jam, a puree, a preserved fruit, a preserved fruit, a bread, an egg roll, a protein beverage, a solid beverage, a lactic acid bacteria beverage, a plant protein beverage, a carbonated beverage, a coffee, an expanded food, or a health food.

[0066] Preferably, the health food includes a tea product, a granule, a medicinal liquor, a capsule, a fruit juice, a fruit vinegar, a granule, a fermented milk product, a fermented cereal product, a fermented soy product, a powder, a honey paste, or a meal replacement powder.

[0067] Further preferably, the health food further comprises a conventional health food excipient, which includes, but is not limited to, a filler, a flavoring agent, a binder, a disintegrant, a lubricant, an antacid, or a nutritional fortifier.

[0068] In a ninth aspect, the present application provides an antibacterial daily necessity, which comprises the antibacterial peptide, the gene, the genetic engineering vector, the genetically engineered cell, and / or the antibacterial peptide prepared by the above method.

[0069] Preferably, the daily necessity includes a toiletry, a household product, a sanitary product, a kitchen product, or a baby product.

[0070] The present application has the following beneficial effects:

[0071] The antibacterial peptide provided by the present application has good inhibitory effect on gram-negative bacteria, gram-positive bacteria, and human papillomavirus (HPV). It has good application prospect in the preparation of antibacterial or antiviral products. The genetically engineered cell line provided by the present application is biologically recombinant expressed, and has the ability of rapid, large-scale, low-cost, and environment-friendly production and preparation. BRIEF DESCRIPTION OF DRAWINGS

[0072] Figure 1 The diagrams show the structures of DP01-DP05; A is the structure diagram of DP01; B is the structure diagram of DP02; C is the result diagram of DP03; D is the structure diagram of DP04; and E is the structure diagram of DP05.

[0073] Figure 2 The half-effective dose EC 50 Schematic diagram of sample loading.

[0074] Figure 3 The half-maximal cytotoxic concentration (CC) 50 Schematic diagram of sample loading.

[0075] Figure 4 These are the experimental results of the antimicrobial peptide's anti-HPV16 activity.

[0076] Figure 5 These are the experimental results of the antimicrobial peptide's anti-HPV18 activity.

[0077] Figure 6 These are the results of an antimicrobial peptide cytotoxicity experiment. Detailed Implementation

[0078] To make the technical means, creative features, and achieved objectives and effects of this invention easier to understand, the invention is further illustrated below with specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the protection scope of this invention. Unless otherwise specified, the operating methods and equipment used in the following embodiments are conventional operating methods, and the materials and equipment used in each embodiment are the same.

[0079] Example 1: Preparation of antimicrobial peptides

[0080] 1. Preparation of antimicrobial peptides by chemical synthesis

[0081] Polypeptides with the amino acid sequences shown in SEQ ID NO. 1-5 were synthesized by chemical synthesis (Shanghai Ketai Synthesis, purity ≥95%). Detailed polypeptide information is shown in Table 1. The polypeptide structures are as follows: Figure 1 As shown.

[0082] Table 1

[0083] Polypeptide name Sequence number Sequence (5'→3') Isoelectric point DP01 SEQ ID NO. 1 MGRFKRFRKKFKKLFRRISKVLK 12.61 DP02 SEQ ID NO. 2 MGRFKSFLKKFKKLFKKLSKVLK 11.53 DP03 SEQ ID NO. 3 MGRFKSFLKKFKKLFRRISKVLK 12.32 DP04 SEQ ID NO. 4 GGFHRFRKKFHKLFKKLSKVLK 12.05 DP05 SEQ ID NO. 5 GHFHHFRKKFHHLFKKLSKVLK 11.43

[0084] 2. Preparation of antimicrobial peptides by biosynthesis

[0085] 2.1 Codon Optimization for the Encoding Gene of DP03

[0086] The coding gene for DP03 was codon-optimized to obtain the nucleotide sequence shown in SEQ ID NO.8. A gene fragment was synthesized using whole-genome synthesis technology to express the coding gene for DP03 (SEQ ID NO.8), and the synthesized gene fragment has the nucleotide sequence shown in SEQ ID NO.11.

[0087] SEQ ID NO.11:

[0088] CCATGGGAAGGTTCAAATCATTTCTAAAGAAATTCAAAAAGTTGTTTC GCCGTATCAGCAAGGTGCTGAAATGATAACTCGAG.

[0089] 2.2 Preparation of genetically engineered strains

[0090] The synthesized gene fragment SEQ ID NO.11 was ligated to the pET-28a vector by double digestion with NcoI and XhoI enzymes, respectively, so that SEQ ID NO.11 was inserted between the NcoI and XhoI restriction sites of the pET-28a vector, thus obtaining the expression vector pET-28a-DP03 for the expressed peptide.

[0091] The expression vector pET-28a-DP03 was transformed into BL21(DE3)Plys Escherichia coli using the heat shock method. The heat shock method consisted of heat shock at 42℃ for 1.5 min, followed by standing on ice for 5 min. Then, LB broth without antibiotics was added and cultured at 37℃ and 120 rpm for 1 h. Finally, it was evenly spread on LB resistant plates containing kanamycin sulfate (100 μg / mL) and incubated upside down at 37℃ overnight. Positive clones were screened, and the resulting recombinant Escherichia coli was named BL21(DE3)Plys-DP03.

[0092] Recombinant Escherichia coli BL21(DE3)Plys-DP03 was cultured in LB basal medium at 37℃ and 220 rpm. When the bacterial density OD600 reached 0.5-1.5, the temperature was lowered to 30℃, and 1 mM IPTG was added for induction for 10-15 hours. 0.1 mL of bacterial culture was collected by centrifugation, and 20 μL of 4× loading buffer and 60 μL of purified water were added. The mixture was boiled at 100℃ for 10 min, centrifuged at 12000 rpm, and the supernatant was used for whole-cell electrophoresis to detect the induced expression. The results showed that BL21(DE3)Plys-DP03 could highly express the DP03 antimicrobial peptide.

[0093] 2.3 Fermentation and purification of BL21(DE3)Plys-DP03

[0094] Recombinant Escherichia coli BL21(DE3)Plys-DP03 was seed cultured and then inoculated into LB medium. The culture temperature was 37℃, the rotation speed was 170 r / min, and the fermentation time was 10 h. IPTG was added for induction, and the induction culture temperature was 28-32℃ for 10-15 h.

[0095] The culture medium was centrifuged using a low-temperature high-speed centrifuge, and the precipitated bacterial cells were collected. Purified water was added at a volume ratio of precipitated bacterial cells to purified water of 1:10, and the mixture was resuspended and stirred. The resuspended solution was ultrasonically disrupted, and after complete disruption, concentrated HCl was added to adjust the pH to 0.1. The mixture was then incubated in a water bath at 60-65°C for 30 minutes. The mixture was centrifuged at 9000 rpm at 4°C for 20 minutes, and the supernatant was collected. The pH of the supernatant was adjusted to 6.5-7.4 with Tris dry powder, and the mixture was centrifuged at 9000 rpm at 4°C for 20 minutes. The supernatant was then collected.

[0096] The supernatant was passed through a cation exchange resin (CM-Sepharose Fast Flow medium). Impurity proteins were first washed with Tris-HCl solution containing 1.2 M sodium chloride, followed by washing with Tris-HCl solution containing 2.0 M sodium chloride. The elution peaks were collected. The eluent was then subjected to hydrophobic column chromatography (Octylsepharose 4F medium), eluting the target protein with Tris-HCl solution containing 0.5 M NaCl. The elution peaks were collected to obtain the final eluent. The final eluent was analyzed using Tricine-SDS-PAGE, and the results showed that the molecular weight was consistent with the theoretical molecular weight of DPO3-1. Peptide purity was determined by HPLC, showing a purity greater than 98%. The final eluent was concentrated and replaced with a dialysis membrane with a molecular cutoff of 1 KD, and then lyophilized to obtain high-purity DPO3 peptide.

[0097] DP01, DP02, DP04, and DP05 were all prepared using a similar method as described in this embodiment.

[0098] Experiment Example 1: Antibacterial Performance Verification Test

[0099] 1. Initial screening of antimicrobial peptides

[0100] 1.1 Test strains

[0101] The strains used in this experiment were a Gram-positive bacterium Staphylococcus aureus (Hangzhou Microsphere, number HGP-D1-C2) and a Gram-negative bacterium Escherichia coli (Hangzhou Microsphere, number HGP-D1-C7) as indicator bacteria to evaluate their antibacterial activity.

[0102] 1.2 Sample to be tested

[0103] In this experiment, DP01-DP05 prepared by the chemical synthesis method in Example 1 were used as the test samples for subsequent experiments. Stock solution preparation: On the day of the experiment, the test samples were serially diluted with LB medium to different concentrations of 640, 320, 160, 80, 40, 20, 10, 5, 2.5, 1.25, and 0.625 μg / mL.

[0104] 1.3 Preparation of bacterial culture

[0105] Staphylococcus aureus and Escherichia coli were prepared by diluting LB medium to prepare 2×10⁻⁶ saturates. 6 A suspension of CFU / mL was prepared for subsequent experiments.

[0106] 1.4MIC Measurement

[0107] (1) Add 100 μL of Staphylococcus aureus suspension or Escherichia coli suspension to each well of a 96-well plate; (2) Add 100 μL of DP01-DP05 at concentrations of 640, 320, 160, 80, 40, 20, 10, 5, 2.5, 1.25 or 0.625 μg / mL to each well of a 96-well plate, and use 100 μL of LB medium as a growth control; (3) Incubate at 37℃ for 20 hours, and measure the absorbance at OD600nm to determine the MIC.

[0108] 1.5 Experimental Results

[0109] The experimental results are shown in Table 2 below:

[0110] Table 2

[0111] Polypeptide number Staphylococcus aureus MIC (pg / mL) Escherichia coli MIC (pg / mL) DP01 2.5 5.0 DP02 2.5 2.5 DP03 2.5 1.25 DP04 5.0 2.5 DP05 5.0 5.0

[0112] The results showed that peptides DP01-DP05 all exhibited good antibacterial activity. Among them, peptide DP03, which has the amino acid sequence shown in SEQ ID NO.3, showed the best antibacterial activity, and therefore this sequence was used for further development.

[0113] 2. Antibacterial spectrum determination experiment

[0114] 2.1 Test strains

[0115] The bacterial strains used in this experiment are shown in Table 3:

[0116] Table 3

[0117]

[0118]

[0119] Note: In the table, "a" represents MHIIB; "b" represents MHIIB + 5% lysed horse blood.

[0120] 2.2 Main Reagents The main reagents used in this experiment are shown in Table 4:

[0121] Table 4

[0122] Reagent name Brand Catalogue number Batch number Alamar blue Invitrogen DAL1100 2486611 Levofloxacin Abcam ab141245 APN12602-1-1 Vancomycin Abcam ab141224 APN12578-1-1 Meropenem TCI-M2279 M2279 YCY8L-ML Ciprofloxacin Amplyco E080630 GB260026 Amikacin Sigma A3650 BCBP7942V Azithromycin TCI A2076 3ABMK-AE Voriconazle Adamas 22105A P1196112 Itraconazole Adamas-beta 85974A P1034592 Rifampicin Sigma R3501 WXBD0542V Clarithromycin Abcam ab141202 APN12556-1-1

[0123] 2.3 Preparation of Stock Solution for Test Samples and Positive Control Drug. On the day of the experiment, the test sample (DP03 prepared by biosynthesis in Example 1) and the positive control drug were dissolved to prepare stock solution, as detailed in Table 5.

[0124] Table 5

[0125]

[0126] 2.4 MIC test for aerobic bacteria

[0127] Aerobic bacteria: Inoculate the bacterial strain on agar plates in advance and incubate overnight at 35°C. On the day of the experiment, adjust the bacterial concentration to a turbidity of 0.2.

[0128] The bacterial suspension was diluted with the corresponding liquid culture medium (Table 3), and then 50 μl was transferred to a 96-well round-bottom plate containing 50 μl of working solution to obtain the detection plate. The bacterial concentration was 5 × 10⁻⁶. 5 CFU / mL. The obtained 96-well circular bottom plate was placed in an incubator at 35°C and incubated for 20 h.

[0129] 2.5 MIC test for anaerobic and microaerophilic bacteria

[0130] Dispense 30 μL of the prepared 100× test sample and positive control drug working solution into a 6-well plate, then add 3 mL of the prepared test agar medium, mix thoroughly, and cool to solidify.

[0131] For anaerobic bacteria, the desired strains are inoculated onto blood agar plates beforehand and cultured in an anaerobic environment. On the day of the experiment, some colonies are picked from the agar plates, the turbidity is adjusted to 0.2, and then 2 μl is inoculated onto the drug-containing blood agar plates using a workstation. 5 / spot. After the inoculum is absorbed by the plate, invert the blood plate obtained above and incubate it in an anaerobic environment at 35°C for 2 days.

[0132] 2.6MIC reading

[0133] The lowest concentration of the test sample / positive control drug at which bacterial growth is visually completely or significantly inhibited will be defined as the MIC of the compound.

[0134] 2.7 Experimental Results

[0135] The minimum inhibitory concentrations (MICs) of polypeptide DP03 against the strains (in μg / mL) are shown in Tables 6-28 (NA in the tables represents no inhibitory effect). The MICs of the positive control drugs against the quality control strains were all within the CLSI reference range. Therefore, the test data are reliable.

[0136] Table 6

[0137]

[0138] Table 7

[0139]

[0140] Table 8

[0141]

[0142]

[0143] Table 9

[0144]

[0145] Table 10

[0146]

[0147] Table 11

[0148]

[0149]

[0150] Table 12

[0151]

[0152] Table 13

[0153]

[0154] Table 14

[0155]

[0156] Table 15

[0157]

[0158]

[0159] Table 16

[0160]

[0161] Table 17

[0162]

[0163] Table 18

[0164]

[0165] Table 19

[0166]

[0167] Table 20

[0168]

[0169]

[0170] Table 21

[0171]

[0172] Table 22

[0173]

[0174] Table 23

[0175]

[0176]

[0177] Table 24

[0178]

[0179] Table 25

[0180]

[0181] Table 26

[0182]

[0183]

[0184] Table 27

[0185]

[0186] Table 28

[0187]

[0188]

[0189] Based on the requirements of CLSIM7 (for aerobic bacteria) and CLSIM11 (for anaerobic bacteria), the minimum inhibitory concentration of DP03 against multiple bacterial strains was determined.

[0190] For Gram-negative bacteria (G-), DP03 exhibits relatively strong antibacterial activity against Acinetobacter baumannii, Enterobacter aerogenes, Escherichia coli, Enterobacter hominis, and Moraxella catarrhalis (8-16 μg / mL), and some antibacterial activity against Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia (16-128 μg / mL). Furthermore, its antibacterial activity against drug-resistant bacteria is comparable to that against sensitive bacteria.

[0191] For Gram-positive bacteria (G+), DP03 exhibits relatively strong activity against Enterococcus faecalis, Staphylococcus epidermidis, Staphylococcus hemolyticus, Streptococcus mutans, and Listeria monocytogenes (most with MICs between 1-8 μg / mL). It shows strong antibacterial activity against Staphylococcus aureus (16 μg / mL) and some antibacterial activity against Candida albicans (64 μg / mL). It also shows relatively strong antibacterial activity against drug-resistant bacteria such as MSSA, MRSA, and VRSA.

[0192] Test results showed that DP03 had a stronger antibacterial effect than the control antibiotic for all tested strains.

[0193] Experiment Example 2: Verification of Antiviral Performance

[0194] 1. Experimental Materials

[0195] 1.1 Test Sample

[0196] The test sample in this experiment was DP03 prepared by the biosynthesis method in Example 1. The control compound (DAPT, also known as GSI-IX) was provided by WuXi AppTec.

[0197] 1.2 Virus-like particles (VLPs)

[0198] HPV16 VLP and HPV18 VLP were provided by WuXi AppTec.

[0199] 1.3 Cells and Culture Medium

[0200] 293FT (ATCC-CRL-3216) cells were provided by WuXi AppTec. DMEM cell culture medium was provided by CORNING.

[0201] 2. Experimental Methods

[0202] 2.1 Experimental Procedure for Screening DP03 Anti-HPV16 and HPV18 Activity

[0203] On day 1, 293FT cells were loaded at 4 × 10⁻⁶ cells per well. 4Cells were seeded at a density of 1,000 cells per well in 96-well plates and cultured overnight in a 5% CO2, 37°C cell culture incubator.

[0204] On day 2, the virus, test sample, and control compound were diluted separately using serum-free culture medium. 50 μL of diluted DP03 and 50 μL of 100% TCID50 HPV16 VLP or HPV18 were added to cell wells, respectively. Similarly, 50 μL of the control compound and 50 μL of 100% TCID50 HPV16 VLP or HPV18 were added to cell wells. Cell controls (cells, without test sample, control compound treatment, or virus infection) and virus controls (cells infected with virus, without test sample or control compound treatment) were set up for antiviral experiments (see details). Figure 2 ).

[0205] The highest detection point concentration of DP03 in the test sample was 100 μg / mL. It was serially diluted and detected at 8 concentration points (100 μg / mL, 40 μg / mL, 16 μg / mL, 8 μg / mL, 4 μg / mL, 2 μg / mL, 1 μg / mL, 0.5 μg / mL) with double duplicate wells.

[0206] Control compound: GSI-IX was serially diluted 5-fold, with 8 concentration points detected using double-duplicate wells, and the starting point and final concentration were 10000 nM.

[0207] Cells containing the above-mentioned virus, test sample, and control compound were incubated in a 5% CO2, 37°C incubator for 3 days.

[0208] The antiviral activity of the test samples is expressed as the inhibition rate (%) of the virus-induced cytopathic effect of the samples at different concentrations.

[0209] 2.2 DP03 Cytotoxicity Assay Procedure

[0210] On day 1, 293FT cells were loaded at 4 × 10⁻⁶ cells per well. 4 Cells were seeded at a density of 1,000 cells per well in 96-well plates and cultured overnight in a 5% CO2, 37°C cell culture incubator.

[0211] On day 2, the test sample and control compound were diluted separately using serum-free medium. 50 μL of the diluted test sample and control compound, along with 50 μL of medium, were added to virus-free cell wells (see details). Figure 3 Simultaneously, cell controls (cells, no test sample, control compound treatment, and virus infection) and culture medium controls (no cells, no test sample, control compound treatment, and virus infection) were set up for cytotoxicity experiments.

[0212] The highest detection point concentration of DP03 in the test sample was 100 μg / mL. It was serially diluted and detected at 8 concentration points (100 μg / mL, 40 μg / mL, 16 μg / mL, 8 μg / mL, 4 μg / mL, 2 μg / mL, 1 μg / mL, 0.5 μg / mL) with double duplicate wells.

[0213] Control compound: GSI-IX was serially diluted 5-fold, with 8 concentration points detected using double-duplicate wells, and the starting point and final concentration were 10000 nM.

[0214] Cells containing the test sample and control compound were cultured in a 5% CO2, 37°C incubator for 3 days.

[0215] The cytotoxicity of the test samples was expressed as the inhibition rate (%) of 293FT cell activity at different concentrations of the sample.

[0216] 2.3 Experimental Results

[0217] The EC50 values ​​of DP03 against HPV16 and HPV18 were 19.03 μg / mL and 27.23 μg / mL, respectively, indicating that DP03 exhibited antiviral activity against HPV16 and HPV18 under in vitro experimental conditions. Detailed data are shown in Table 29 and... Figure 4-5 .

[0218] Table 29

[0219]

[0220] The antimicrobial peptides did not produce cytotoxicity at any of the tested concentrations. 50 >100 μg / mL. See Table 30 for detailed data. Figure 6 .

[0221] Table 30

[0222]

[0223] In summary, the DP03 provided by this invention exhibits strong antiviral activity against both HPV16 and HPV18, with superior antiviral efficacy compared to the control compound GSI-IX. Furthermore, DP03 demonstrates good safety, showing no cytotoxicity at any of the tested concentrations.

[0224] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.

Claims

1. An antimicrobial peptide with antibacterial activity, characterized in that, The amino acid sequence of the antimicrobial peptide is shown in SEQ ID NO.

3.

2. A gene characterized in that, The gene encodes the antimicrobial peptide of claim 1.

3. The gene according to claim 2, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

8.

4. A gene engineering vector, characterized in that, The genetic engineering vector comprises the gene as described in any one of claims 2-3.

5. A genetically engineered cell, characterized in that, The genetically engineered cells include the genetically engineered vector as described in claim 4.

6. A method for preparing antimicrobial peptides, characterized in that, The method includes: expressing the antimicrobial peptide of claim 1 by genetic engineering means.

7. The method according to claim 6, characterized in that, The aforementioned genetic engineering method involves transducing cells using genetic engineering vectors to express antimicrobial peptides.

8. The method according to claim 7, characterized in that, The genetic engineering vector backbone includes pET 28a vector, pRSFDuet 1. Carrier, pETDuet 1. Carrier, pACYCDuet 1. Vector or pTrc99a vector.

9. The use of the antimicrobial peptide of claim 1, the gene of any one of claims 2-3, the gene engineering vector of claim 4, the gene engineering cell of claim 5, and / or the antimicrobial peptide prepared by the method of any one of claims 6-8 in the preparation of antibacterial and antiviral drugs; The bacteria mentioned in the antibacterial agents are one or more of the following: Acinetobacter baumannii, Enterobacter aerogenes, Escherichia coli, Enterobacter hominis, Moraxella catarrhalis, Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Enterococcus faecalis, Staphylococcus epidermidis, Staphylococcus hemolyticus, Streptococcus mutans, Listeria monocytogenes, and Staphylococcus aureus. The virus in the antiviral agent is HPV16 and / or HPV18.

10. An antibacterial or antiviral drug, characterized in that, The drug comprises the antimicrobial peptide of claim 1, the gene of any one of claims 2-3, the gene engineering vector of claim 4, the gene engineering cell of claim 5, and / or the antimicrobial peptide prepared by the method of any one of claims 6-8.

11. The medicament according to claim 10, characterized in that, The dosage forms of the drug include those administered via the gastrointestinal tract.

12. The medicament according to claim 11, characterized in that, The drug also includes one or more pharmaceutically acceptable excipients.

13. An antibacterial daily necessities product, characterized in that, The aforementioned daily necessities include the antimicrobial peptide of claim 1, the gene of any one of claims 2-3, the gene engineering vector of claim 4, the gene engineering cell of claim 5, and / or the antimicrobial peptide prepared by the method of any one of claims 6-8.

Images