Application of rice OsKLP protein and coding gene thereof in regulation and control of plant growth and development

By studying the rice OsKLP protein and its coding genes, it regulates the plant's fertility, plant height and tiller count, and solves the problem of unexplained molecular mechanism of rice tillering, and improves rice yield and quality.

CN120136987AActive Publication Date: 2025-06-13PEKING UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510348263.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-06-13
Estimated Expiration
2045-03-24

AI Technical Summary

Technical Problem

The prior art has not yet fully understood the molecular mechanism of rice tillering, which has affected the improvement of rice plant type and yield.

Method used

Through the study and application of rice OsKLP protein and its encoding genes, the plant fertility, plant height and tiller number are regulated. Increases or decreases in OsKLP protein content or gene abundance may positively regulate these properties.

Benefits of technology

Effective regulation of rice breeding, plant height and tiller quantity has been achieved, and the yield and quality of rice has been improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005325319890000051
    Figure BDA0005325319890000051
  • Figure BDA0005325319890000061
    Figure BDA0005325319890000061
  • Figure BDA0005325319890000091
    Figure BDA0005325319890000091
Patent Text Reader

Abstract

The invention discloses an application of a rice OsKLP protein and a coding gene thereof in regulation and control of plant growth and development. The invention provides an application of an OsKLP protein or an OsKLP gene in regulating and controlling the fertility and / or the plant height and / or the tillering number of a plant. The invention also provides an application of the OsKLP protein or the OsKLP gene as an inhibition target in plant breeding. The target of plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced tillering number. The OsKLP protein is as shown in SEQ ID NO: 1. The invention provides a new thought and a potential target for rice molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to the application of rice OsKLP protein and its encoding gene in regulating plant growth and development. Background Art

[0002] Rice (Oryza sativa L.) is the main food source for more than half of the world's population, and the improvement of its yield is crucial for global food security. The yield of rice is affected by various factors, among which plant architecture and the development of floral organs are key factors.

[0003] Plant architecture is an important agronomic trait of rice, which is closely related to yield, quality and stress resistance. Tillering is an important index in the study of plant architecture. It forms at the unelongated basal internodes and grows independently of the mother stem (culm) through its adventitious roots. Tillering increases the number of leaves of the rice plant, thus expanding the photosynthetic area. More leaves mean more photosynthetic products, which helps to increase biomass and ultimately yield. Although the morphology and histology of rice tillering and some rice tillering mutants have been well described, the molecular mechanism of rice tillering remains to be elucidated. Tillering is the ability of a rice plant to produce new branches from the base of the main stem, and these branches can form additional panicles, thus increasing yield.

[0004] Plant height is one of the important agronomic traits affecting rice plant architecture. Since the "Green Revolution", through the research on the plant hormone gibberellin, scientists have successfully cultivated high-yield rice with semi-dwarf traits, greatly improving food production. Dwarf and semi-dwarf are key indicators for lodging resistance and high-yield breeding of rice. Therefore, exploring genes related to internode elongation in rice, analyzing the molecular mechanism affecting internode elongation, and exploring its relationship with the gibberellin regulatory pathway are of great significance for increasing rice yield. Summary of the Invention

[0005] The object of the present invention is to provide the application of rice OsKLP protein and its encoding gene in regulating plant growth and development.

[0006] The present invention provides the application of OsKLP protein or OsKLP gene in regulating plant fertility and / or plant height and / or tiller number.

[0007] For fertility, the regulation is positive regulation.

[0008] An increase in the content of OsKLP protein increases plant fertility.

[0009] A decrease in the content of OsKLP protein reduces plant fertility.

[0010] An increase in the abundance of OsKLP gene increases plant fertility.

[0011] Reduction in the abundance of the OsKLP gene results in reduced fertility of plants.

[0012] For the number of tillers, the regulation is positive regulation.

[0013] An increase in the content of the OsKLP protein results in an increase in the number of tillers of plants.

[0014] A decrease in the content of the OsKLP protein results in a decrease in the number of tillers of plants.

[0015] An increase in the abundance of the OsKLP gene results in an increase in the number of tillers of plants.

[0016] A decrease in the abundance of the OsKLP gene results in a decrease in the number of tillers of plants.

[0017] For plant height, the regulation is positive regulation.

[0018] An increase in the content of the OsKLP protein results in an increase in the plant height.

[0019] A decrease in the content of the OsKLP protein results in a decrease in the plant height.

[0020] An increase in the abundance of the OsKLP gene results in an increase in the plant height.

[0021] A decrease in the abundance of the OsKLP gene results in a decrease in the plant height.

[0022] The present invention also provides the use of the OsKLP protein or the OsKLP gene as a target for inhibition in plant breeding; the objective of the plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced number of tillers. The plant is a plant having the OsKLP gene.

[0023] The present invention also provides the use of a substance that inhibits the OsKLP protein or a substance that inhibits the OsKLP gene in plant breeding; the objective of the plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced number of tillers. The plant is a plant having the OsKLP gene. Inhibiting the OsKLP gene may specifically be inhibiting the expression of the OsKLP gene. The substance that inhibits the expression of the OsKLP gene may specifically be: a gene editing vector targeting the OsKLP gene. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsKLP gene. Specifically, the targets of the sgRNA are: "TCACGGGCCGCCTCATGCCG" and "TATGCTGTCCCCGGATCGGG".

[0024] The present invention also provides a method for cultivating a plant with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: deleting the following two segments in the OsKLP gene in the genomic DNA of the plant in a homozygous mutation manner: "CTCATGCCGC", "CCTCCCGATCCGGGGACA". The plant is a plant having the OsKLP gene. Homozygous mutation means that the same mutation occurs on a pair of homologous chromosomes.

[0025] The present invention also provides a method for cultivating a plant with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: performing gene editing on the OsKLP gene in a recipient plant to obtain a gene-edited plant, and screening a plant with reduced fertility and / or reduced plant height and / or reduced tiller number from the gene-edited plant relative to the recipient plant. The recipient plant is a plant having the OsKLP gene. The gene editing is achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsKLP gene. Specifically, the targets of the sgRNA are: "TCACGGGCCGCCTCATGCCG" and "TATGCTGTCCCCGGATCGGG".

[0026] The present invention also provides a method for cultivating a plant with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: inhibiting the expression of the OsKLP gene in a recipient plant to obtain a plant with reduced fertility and / or reduced plant height and / or reduced tiller number relative to the recipient plant. The plant is a plant having the OsKLP gene. Inhibiting the expression of the OsKLP gene in the recipient plant can be specifically achieved by introducing a substance that inhibits the expression of the OsKLP gene into the recipient plant. The substance that inhibits the expression of the OsKLP gene can be specifically a gene editing vector targeting the OsKLP gene. Inhibiting the expression of the OsKLP gene in the recipient plant is specifically achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsKLP gene. Specifically, the targets of the sgRNA are: "TCACGGGCCGCCTCATGCCG" and "TATGCTGTCCCCGGATCGGG".

[0027] The present invention also provides a method for cultivating a plant with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: reducing the content of OsKLP protein in the plant to reduce the fertility and / or reduce the plant height and / or reduce the tiller number of the plant. The plant is a plant having the OsKLP gene.

[0028] Reducing rice fertility has important practical value in specific scenarios, especially in the fields of weed control, gene drift prevention, hybrid seed production optimization, and basic scientific research.

[0029] The present invention also provides the use of OsKLP protein-related biomaterials in cultivating transgenic plants with increased fertility and / or increased plant height and / or increased tiller number. The plant is a plant without the OsKLP gene.

[0030] The present invention also provides a method for cultivating a plant with increased fertility and / or increased plant height and / or increased tiller number, comprising the following steps: introducing the OsKLP gene into a recipient plant to obtain a plant with increased fertility and / or increased plant height and / or increased tiller number relative to the recipient plant. The plant is a plant without the OsKLP gene.

[0031] Any of the above-mentioned OsKLP proteins is as follows (a1) or (a2) or (a3) or (a4):

[0032] (a1) The protein shown in SEQ ID NO: 1;

[0033] (a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0034] (a3) A protein obtained by substituting and / or deleting and / or adding one or several amino acid residues to (a1) and related to the fertility and / or plant height and / or tiller number of the plant;

[0035] (a4) A protein derived from rice, having more than 98% identity with (a1), and related to the fertility and / or plant height and / or tiller number of the plant;

[0036] The specific tags can be as shown in Table 1.

[0037] Table 1 Sequences of tags

[0038] Label Residue Sequence Poly-Arg 5 - 6 (usually 5) RRRRR Poly-His 2 - 10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0039] Any of the above-mentioned OsKLP genes is a gene encoding the OsKLP protein.

[0040] The OsKLP gene is as follows (b1) or (b2) or (b3) or (b4) or (b5):

[0041] (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2;

[0042] (b2) The DNA molecule shown in positions 180-10851 of SEQ ID NO: 3;

[0043] (b3) The DNA molecule shown in SEQ ID NO: 3;

[0044] (b4) A DNA molecule derived from rice and having more than 95% identity with (b1) or (b2) or (b3) and encoding the said protein;

[0045] (b5) A DNA molecule that hybridizes with the nucleotide sequence defined by (b1) or (b2) or (b3) under stringent conditions and encodes the said protein.

[0046] The above-mentioned stringent conditions may be a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65°C and washing the membrane in a DNA or RNA hybridization experiment.

[0047] The biological material related to the OsKLP protein is any one of the following (c1) to (c4):

[0048] (c1) A nucleic acid molecule encoding the OsKLP protein;

[0049] (c2) An expression cassette containing the nucleic acid molecule described in (c1);

[0050] (c3) A recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2);

[0051] (c4) A recombinant microorganism containing the nucleic acid molecule described in (c1) or a recombinant microorganism containing the expression cassette described in (c2) or a recombinant microorganism containing the recombinant vector described in (c3).

[0052] The nucleic acid molecule encoding the OsKLP protein may specifically be the said OsKLP gene.

[0053] The said recombinant vector may specifically be a recombinant expression vector.

[0054] Any of the above-mentioned recombinant expression vectors may specifically be a recombinant plasmid obtained by inserting the double-stranded DNA shown in SEQ ID NO: 4 into the multiple cloning site (such as the KpnI and XbaI restriction enzyme sites) of the pCAMBIA2300 vector.

[0055] Fertility as described above is manifested as the seed setting rate. A decrease in fertility as described above is manifested as a decrease in the seed setting rate. An increase in fertility as described above is manifested as an increase in the seed setting rate.

[0056] Any of the above-mentioned plants may be a monocotyledonous plant or a dicotyledonous plant. Any of the above-mentioned plants may be a gramineous plant. Any of the above-mentioned plants may be a plant of the genus Oryza. Specifically, any of the above-mentioned plants may be rice. Specifically, any of the above-mentioned plants may be rice Dongjin.

[0057] The present invention provides new ideas and potential targets for rice molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 It is a schematic diagram of the components of the pCBSG032 vector.

[0059] Figure 2 It is a sequencing result diagram of the osklp mutant strain.

[0060] Figure 3 They are photos of the plant phenotypes and stem node phenotypes in Example 2.

[0061] Figure 4 It is a photo of the pollen after staining in Example 2.

[0062] Figure 5 They are the results of plant height, seed setting rate and tiller number in Example 2.

[0063] Figure 6 It is a schematic diagram of the components of the pCAMBIA2300 vector.

[0064] Figure 7 They are photos of the plant phenotypes in Example 4. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0065] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0066] The experimental methods in the following embodiments, unless otherwise specified, are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels. Unless otherwise specified, the quantitative tests in the following embodiments are all set with three repeated experiments, and the results are averaged. Seed setting rate = number of filled seeds ÷ (number of filled seeds + number of empty seeds) × 100%.

[0067] The pCBSG032 vector (for the schematic diagram of the components, see Figure 1):Future Biotechnology Co., Ltd. The pCBSG032 vector is described in the following literature: Tian Y, Zhong D, Li X, Shen R, Han H, Dai Y, Yao Q, Zhang X, Deng Q, Cao X, Zhu JK, Lu Y. High-throughput genome editing in rice with a virus-based surrogate system. J Integr Plant Biol. 2022 Oct 11. doi: 10.1111 / jipb.13381. Epub ahead of print. PMID: 36218268.

[0068] The vector pYLsgRNA-OsU3 is described in the following literature: Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015 Aug; 8(8): 1274-84. doi: 10.1016 / j.molp.2015.04.007. Epub 2015 Apr 24. PMID: 25917172.

[0069] Rice Dongjin, belonging to japonica rice (Oryza sativa L. subsp. japonica), also known as japonica rice Dongjin, is an existing rice germplasm resource. In the examples, the rice Dongjin plant is also called the wild-type plant, denoted as WT. After sequencing verification, the genomic DNA of rice Dongjin has the DNA segment shown in SEQ ID NO: 3, and the cDNA of rice Dongjin has the DNA segment shown in SEQ ID NO: 2, encoding the OsKLP protein shown in SEQ ID NO: 1.

[0070] The formula of N6 basal medium is shown in Table 2.

[0071] Table 2

[0072]

[0073] Callus induction medium (pH 5.8): Based on the N6 basal medium, add inositol (to a concentration of 100 mg / L in the medium), 2,4-D (to a concentration of 2 mg / L in the medium), proline (to a concentration of 2.878 g / L in the medium), enzymatically hydrolyzed casein (to a concentration of 300 mg / L in the medium), sucrose (to a concentration of 30 g / L in the medium), and phytagel (to a concentration of 2.6 g / L in the medium).

[0074] Co-culture medium (pH 5.2): Based on the N6 basal medium, add acetosyringone (to a concentration of 100 μM in the medium), glucose (to a concentration of 10 g / L in the medium), and phytagel (to a concentration of 2.6 g / L in the medium).

[0075] Screening medium (pH 5.8): Based on the N6 basal medium, add casein hydrolysate (to a concentration of 500 mg / L in the medium), 2,4-D (to a concentration of 2 mg / L in the medium), proline (to a concentration of 2.8 g / L in the medium), sucrose (to a concentration of 30 g / L in the medium), G418 (to a concentration of 150 mg / L in the medium), cephalosporin (to a concentration of 500 mg / L in the medium), and phytagel (to a concentration of 2.6 g / L in the medium).

[0076] Differentiation medium (pH 5.8): Based on the N6 basal medium, add kinetin (to a concentration of 2 mg / L in the medium), NAA (to a concentration of 0.02 mg / L in the medium), sucrose (to a concentration of 30 g / L in the medium), sorbitol (to a concentration of 30 g / L in the medium), acid hydrolysate casein (to a concentration of 2 g / L in the medium), and phytagel (to a concentration of 2.6 g / L in the medium).

[0077] Rooting medium (pH 5.8): Contains 1 / 4 concentration of MS inorganic salts, 1× concentration of MS vitamins, 0.5 mg / L NAA, 1 mg / L paclobutrazol, 2.6 g / L phytagel, with the balance being water.

[0078] The formulation of the AAM infection solution (pH 5.2) is shown in Table 3.

[0079] Table 3

[0080]

[0081] Example 1. Preparation of mutant plants

[0082] I. Preparation of recombinant plasmid

[0083] 1. Using vector pYLsgRNA-OsU3 as a template, perform PCR amplification with the primer pair consisting of 10g36880-032double-F and 10g36880-032double-R, and recover the PCR amplification product (about 583 bp).

[0084] 10g36880-032double-F (forward primer):

[0085] 5’-gatgGGTCTCATGTG TCACGGGCCGCCTCATGCCG GTTTTAGAGCTAGAAA-3’;

[0086] 10g36880-032double-R (reverse primer): 5’-CGCAAGCACCGAATTG TATGCTGTCCCCGGATCG GG GTTTAGAGACCCCAA-3’.

[0087] 2. Take the pCBSG032 vector, perform digestion with the restriction enzyme BsaⅠ, and recover the digestion product (linearized vector backbone).

[0088] 3. Take the PCR amplification product obtained in step 1, perform digestion with the restriction enzyme BsaⅠ, and recover the digestion product.

[0089] 4. Ligate the digestion product obtained in step 2 and the digestion product obtained in step 3 to obtain a recombinant plasmid, which is the gene editing vector. The recombinant plasmid has been verified by sequencing. The recombinant plasmid has two sgRNA expression cassettes, expressing two sgRNAs. The target site of one sgRNA is “TCACGGGCCGCCTCATGCCG”, and the target site of the other sgRNA is “TATGCTGTCCCCGGATCGGG”.

[0090] II. Preparation of mutant plants using CRSPR / Cas9 technology

[0091] 1. Callus induction and subculture

[0092] Take the mature seeds of rice Dongjin, remove the glumes, disinfect with 75% ethanol solution for 1 min, then rinse with sterile water, then disinfect with 30% sodium hypochlorite solution for 20 min, then wash thoroughly with sterile water, dry the surface moisture of the seeds with sterile filter paper, and then transfer the seeds to the callus induction medium for culture to obtain callus for Agrobacterium infection.

[0093] 2. Preparation of Agrobacterium suspension

[0094] Introduce the gene editing vector prepared in Step 1 into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium. Cultivate the recombinant Agrobacterium and collect the cells, and suspend them with AAM infection solution to obtain an Agrobacterium suspension with an OD 600nm value of 0.3 - 0.5.

[0095] 3. Agrobacterium infection

[0096] Take the callus obtained in Step 1, immerse it in the Agrobacterium suspension prepared in Step 2, infect it at room temperature for 20 minutes (shake it from time to time during this period), then take out the callus, suck off the excess bacterial liquid with sterile filter paper, and then transfer it to a co-culture medium covered with a layer of sterile filter paper, and culture it in the dark at 26°C for 3 days.

[0097] 4. Screening and cultivation

[0098] After completing Step 3, take the callus, first rinse it twice with sterile water, then rinse it once with carbenicillin solution, suck off the excess moisture with a pipette and transfer it to sterile filter paper to air-dry the surface moisture on the super clean bench, and then transfer it to a screening medium containing hygromycin, and culture it in the dark at 28 - 30°C for 3 - 4 weeks. At this time, positive calli with bright yellow color and a diameter of 1 - 2 mm can be observed to grow.

[0099] 5. Differentiation and regeneration

[0100] Take the positive callus obtained in Step 4 and transfer it to a differentiation medium, and culture it under alternating light and dark conditions (16 h light / 8 h dark) at 28 - 30°C. Green dots can be observed to emerge from the callus after about 10 days of culture, and seedlings will differentiate after about another 10 days of culture, and the height of the differentiated seedlings is 2 - 3 cm.

[0101] 6. Rooting

[0102] Take the seedlings obtained in Step 5 and transfer them to a rooting medium, and culture them under alternating light and dark conditions (16 h light / 8 h dark) at 28 - 30°C. The rooted seedlings are T0 generation plants.

[0103] III. Identification of mutation forms

[0104] The T0 generation plants obtained in Step 2 are self-crossed and the seeds are harvested. The seeds are cultivated into plants, which are T1 generation plants.

[0105] Take the leaves of the T1 generation plants, extract genomic DNA, perform PCR amplification using the primer pair composed of GP36880F and GP36880R, then recover the amplification product and sequence it. Screen the mutant strains according to the sequencing results.

[0106] GP36880F: TTCGGTTTCCGTGCGGGAT;

[0107] GP36880R: CGCACAAGCAACTGAAGCATA.

[0108] One homozygous mutant plant was screened from the T1 generation plants, and this mutant plant was named the osklp mutant.

[0109] Compared with the genomic DNA of wild-type plants, the coding region of the OsKLP gene in the genomic DNA of the osklp mutant was deleted in homozygous form (the same changes occurred in both homologous chromosomes) of the following two segments "CTCATGCCG C " and "CCTCCCGATCCG GGG ACA", and there were no changes in other sequences. The sequencing results are shown in Figure 2 .

[0110] Example 2. Phenotypic comparison

[0111] Test seeds: Seeds of wild-type plants and seeds obtained by self-crossing the osklp mutant obtained in Example 1.

[0112] The test seeds were sown and cultivated until emergence, and then transferred to the fields in the suburbs of Beijing for normal cultivation and management.

[0113] Phenotypic photos of plants at the jointing stage are shown in the left figure of Figure 3 Photos of the stem nodes are shown in the right figure of Figure 3 .

[0114] At the flowering stage, small flowers at the pollen stage were taken, anthers were dissected under a stereomicroscope, and I 2 -KI solution (I 2 -KI solution: Dissolve 0.5 g of KI in 1.25 mL of deionized water, add 0.25 g of iodine tablets, and then dilute to 75 mL, store in the dark) was added, the anthers were quickly mashed to release pollen, and the pollen was observed under a microscope. The photo is shown in Figure 4 .

[0115] At the maturity stage, the plant height was measured, and the seed setting rate and tiller number were counted. The results of plant height, seed setting rate and tiller number are shown in Figure 5 (The sample size of each test plant was 10 plants).

[0116] In the seedling stage, there were no obvious differences in the morphology of each plant. At the jointing stage, the growth rate of the offspring plants of the mutant plants was significantly lower than that of the wild-type plants. At the maturity stage, the plant height of the offspring plants of the mutant plants was significantly lower than that of the wild-type plants. The wild-type plants were about 115.7 cm tall, while the mutant plants were only 85 cm. Compared with the wild-type plants, the seed setting rate of the offspring plants of the mutant plants was significantly reduced. The seed setting rate of the wild-type plants was 93.86%, while the seed setting rate of the offspring plants of the mutant plants was 33.27%. Compared with the wild-type plants, the tiller number of the offspring plants of the mutant plants was significantly reduced. The wild-type plants had an average of 19.1 effective tillers, while the offspring plants of the mutant plants had an average of 12.1 effective tillers. By observing the stem nodes, it was found that about half of the offspring plants of the mutant plants had one less visible elongated stem node than the wild-type plants, and the internodes of the panicle of the offspring plants of the mutant plants were significantly shorter than those of the wild-type plants.

[0117] Example 3: Preparation of Complemented Plants

[0118] I. Preparation of Recombinant Plasmid

[0119] Insert the double-stranded DNA shown in SEQ ID NO: 4 into the KpnI and XbaI restriction sites of the pCAMBIA2300 vector (for the schematic diagram of the elements of the pCAMBIA2300 vector, see Figure 6 ), to obtain a recombinant plasmid. The recombinant plasmid has been verified by sequencing.

[0120] II. Preparation of Complemented Plants

[0121] Use the mature seeds obtained by self-crossing the osklp mutant strain obtained in Example 1 to replace the mature seeds of rice Dongjin, use the recombinant plasmid prepared in step I to replace the gene editing vector, use the screening medium containing kanamycin to replace the screening medium containing hygromycin, and the other steps are the same as step II of Example 1.

[0122] III. Screening of Homozygous Transgenic Plants

[0123] The T0 generation plants obtained in step II are self-crossed and the seeds are harvested. The seeds are cultivated into plants, which are the T1 generation plants.

[0124] Screen the transgenic plants from the T1 generation plants, which are the T1 generation transgenic plants.

[0125] The T1 generation transgenic plants are self-crossed and the seeds are harvested. The seeds are cultivated into plants, which are the T2 generation plants.

[0126] For a certain T1 generation transgenic plant, if all the T2 generation plants obtained by its self-crossing are transgenic plants, this T1 generation transgenic plant is a homozygous transgenic plant, and the self-crossed offspring of this plant are all homozygous transgenic plants.

[0127] Method for screening or identifying transgenic plants: Take the leaves of the plants, extract genomic DNA, and perform PCR amplification using the primer pair consisting of GP2300KanF and GP2300KanR (the primers target the kanamycin resistance gene on the vector, and the target fragment is 328 bp). If an amplification product of the expected size is obtained, the plant is a transgenic plant.

[0128] GP2300KanF: TGTCATACCACTTGTCCGCC;

[0129] GP2300KanR: ATCGAGCTGTATGCGGAGTG.

[0130] Example 4. Phenotypic comparison

[0131] Test seeds: Seeds of wild-type plants, seeds obtained by self-crossing the osklp mutant plants obtained in Example 1, and seeds obtained by self-crossing the T1 generation homozygous transgenic plants obtained in Example 3.

[0132] Sow the test seeds and cultivate them until emergence, then transfer them to the fields in the suburbs of Beijing for normal cultivation and management.

[0133] Phenotypic photos of the plants at the jointing stage are shown in Figure 7 . Figure 7 Among them, WT represents wild-type plants, osklp represents the self-progeny plants of the osklp mutant, and OsKLP OE / osklp represents the self-progeny plants of the T1 generation homozygous transgenic plants obtained in Example 3.

[0134] At the mature stage, measure the plant height, and count the seed setting rate and tiller number. The results of the plant height are shown in Table 4 (the sample size of each test plant is 10 plants, that is, 10 biological replicates). The results of the tiller number are shown in Table 5 (the sample size of each test plant is 10 plants, that is, 10 biological replicates).

[0135] Compared with the wild-type plants, the plant height of the progeny plants of the osklp mutant was significantly reduced, the tiller number was significantly decreased, and the seed setting rate was significantly reduced. Compared with the wild-type plants, there were no significant differences in the plant height, tiller number, and seed setting rate of the transgenic plants. The results indicate that the phenotype of the mutant is due to the inactivation of the OsKLP gene function.

[0136] Table 4

[0137]

[0138]

[0139] Table 5

[0140] Repeat WT osklp <![CDATA[OsKLP OE / osklp]]> 1 18 13 22 2 25 13 18 3 16 8 17 4 22 14 14 5 17 12 20 6 20 17 18 7 15 10 17 8 17 12 19 9 21 13 18 10 20 9 17

[0141] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application is intended to cover any variations, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made with conventional techniques known in the art. Some basic features can be applied according to the scope of the appended claims below.

Claims

1. Application of OsKLP protein or OsKLP gene in regulating plant fertility and / or plant height and / or tillering number; The OsKLP protein is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to plant fertility and / or plant height and / or tillering number obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) a protein derived from rice that has 98% or more identity with (a1) and is associated with plant fertility and / or plant height and / or tillering number; The OsKLP gene is a gene encoding the OsKLP protein.

2. The use according to claim 1, characterized in that: The OsKLP gene is as follows (b1) or (b2) or (b3) or (b4) or (b5): (b1) a DNA molecule whose coding region is shown in SEQ ID NO: 2; (b2) the DNA molecule shown at positions 180-10851 in SEQ ID NO: 3; (b3) the DNA molecule shown in SEQ ID NO: 3; (b4) a DNA molecule derived from rice and having 95% or more identity with (b1) or (b2) or (b3) and encoding the protein; (b5) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) or (b3) under stringent conditions and encodes the protein.

3. Use of OsKLP protein or OsKLP gene as an inhibition target in plant breeding; the goal of plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced tillering number; the OsKLP protein is the OsKLP protein described in claim 1; the OsKLP gene is the OsKLP gene described in claim 1 or 2.

4. Use of a substance that inhibits OsKLP protein or a substance that inhibits OsKLP gene in plant breeding; the goal of the plant breeding is to cultivate plants with reduced fertility and / or reduced plant height and / or reduced tillering number; the OsKLP protein is the OsKLP protein described in claim 1; the OsKLP gene is the OsKLP gene described in claim 1 or 2.

5. A method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tillering number, comprising the following steps: deleting the following two segments of the OsKLP gene in the plant genomic DNA in a homozygous mutation manner: "CTCATGCCGC" and "CCTCCCGATCCGGGGACA"; the OsKLP gene is the OsKLP gene described in claim 1 or 2.

6. A method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: gene editing the OsKLP gene in a recipient plant to obtain a gene-edited plant, and screening from the gene-edited plants plants with reduced fertility and / or reduced plant height and / or reduced tiller number relative to the recipient plant; the OsKLP gene is the OsKLP gene described in claim 1 or 2.

7. A method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tiller number, comprising the following steps: inhibiting the expression of the OsKLP gene in a recipient plant to obtain a plant with reduced fertility and / or reduced plant height and / or reduced tiller number relative to the recipient plant; the OsKLP gene is the OsKLP gene described in claim 1 or 2.

8. A method for cultivating plants with reduced fertility and / or reduced plant height and / or reduced tillering number, comprising the following steps: reducing the fertility and / or reducing the plant height and / or reducing the tillering number of the plant by reducing the content of OsKLP protein in the plant; the OsKLP protein is the OsKLP protein described in claim 1.

9. Application of OsKLP protein-related biological materials in cultivating transgenic plants with increased fertility and / or increased plant height and / or increased tillering number; The OsKLP protein-related biological material is any one of the following (c1) to (c4): (c1) a nucleic acid molecule encoding an OsKLP protein; (c2) an expression cassette containing the nucleic acid molecule described in (c1); (c3) a recombinant vector containing the nucleic acid molecule described in (c1) or a recombinant vector containing the expression cassette described in (c2); (c4) a recombinant microorganism containing the nucleic acid molecule described in (c1), a recombinant microorganism containing the expression cassette described in (c2), or a recombinant microorganism containing the recombinant vector described in (c3); The OsKLP protein is the OsKLP protein described in claim 1.

10. A method for cultivating plants with increased fertility and / or increased plant height and / or increased tiller number, comprising the following steps: introducing an OsKLP gene into a recipient plant to obtain a plant with increased fertility and / or increased plant height and / or increased tiller number relative to the recipient plant; the OsKLP gene is the OsKLP gene described in claim 1 or 2.

Citation Information

Patent Citations

  • Cell proliferation-related polypeptides and uses therefor

    CN101018864A

  • Application of OsGRP1 protein and coding gene thereof in regulation and control of plant growth and development

    CN116769822A

  • Application of rice OsGH3.4 protein and coding gene thereof in regulation and control of plant growth and development

    CN119930774A

  • Sequence-determined DNA fragments and corresponding polypeptides encoded therapy

    US20090265815A1