Nano antibody for resisting different serotypes of adeno-associated virus and application thereof
By developing multiple nanoantibodies (Nb1 to Nb24) to bind different serotypes of AAV viruses, the problem of lack of broad-spectrum anti-AAV nanoantibodies in the prior art was solved, and efficient detection and purification of multiple AAV serotypes were achieved, reducing production costs.
Patent Information
- Application Number
- CN202510374912.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-27
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2045-03-27
AI Technical Summary
The lack of nano-antibody of broad-spectrum anti-aginal-associated virus (AAV) in the prior art leads to the need for the detection and purification of different AAV serotypes, which increases the cost and complexity.
A multi-strain nano-antibodies (Nb1 to Nb24) were developed that specifically and sensitively bind to different serotypes of AAV viruses, including AAV2, AAV5, AAV8 and AAV9.
Excellent broad-spectrum recognition and binding capabilities for a variety of AAV serotypes are achieved, and are used for the immunodetection and affinity chromatography purification of AAV, which improves the purification and recovery effect of viruses and reduces production costs.
Smart Images

Figure CN120137016A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of antibody preparation, and particularly to nanobodies against different serotypes of adeno-associated virus and their applications. Background Art
[0002] Adeno-associated virus (AAV) belongs to the family Parvoviridae, and is a non-enveloped single-stranded DNA virus that cannot replicate autonomously. It is infectious to both dividing and non-dividing cells. The AAV genomic DNA includes two open reading frames (ORFs), Rep and Cap, located between two inverted terminal repeats (ITRs). The ITRs serve as the viral replication origin and packaging signal. The Rep gene is involved in viral replication and integration, encoding viral replication proteins, and the Cap gene is responsible for encoding the three viral capsid proteins VP1, VP2, and VP3. Since AAV can infect a wide variety of tissue cells, has no or low pathogenicity and low immunogenicity during the host cell proliferation process, and can stably express the carried gene for a long time, it is very suitable as a vector for in vivo gene transfer. The AAV vector is obtained by artificial modification based on the wild adeno-associated virus, replacing the Rep and Cap genes between the two ITRs with the target gene, maximizing the capacity of carrying the target gene, and reducing its immunogenicity and cytotoxicity to obtain the recombinant adeno-associated virus (rAAV). The AAV vector has high transduction efficiency, high targeting, a wide host cell range (infecting both dividing and non-dividing cells), long-term expression, and good biosafety, and has been widely used in gene therapy and molecular biology research, and is considered the "most promising gene therapy vector".
[0003] With the steady increase in the number of trials using AAV vectors for in vivo gene transfer, the demand for the production, purification, identification, titer, and purity detection of AAV vectors has been steadily increasing. However, there are multiple serotypes of adeno-associated virus. Different AAV serotypes have different spatial structures, tissue specificities, and sequences of capsid proteins, so the cell surface receptors they recognize and bind to also vary greatly, which also leads to different tissue types, cell types, and infection efficiencies transfected by different serotypes. In the application of AAV virus, it is necessary to select the AAV virus of the corresponding serotype according to different tissues and organs. Traditionally, different antibodies are required for different serotypes of AAV to achieve immunodetection and affinity purification for specific serotype AAV, which will undoubtedly significantly increase the detection and purification costs.
[0004] Nanobodies, also known as single-domain antibodies, are antibodies that are naturally lacking a light chain and consist only of the variable region of the heavy chain, which are found in camelids such as alpacas and dromedaries, and cartilaginous fish such as sharks. They are the smallest known antibody molecules that can bind antigens, with a molecular weight only one-tenth of that of traditional monoclonal antibodies. They have the advantages of small molecular weight, high stability, low immunogenicity, and strong tissue penetration, and are widely used in the development of therapeutic antibody drugs, diagnostic reagents, affinity purification matrices, and scientific research. Therefore, developing broad-spectrum nanobodies against different serotypes of adeno-associated virus (AAV) has important application value. Summary of the Invention
[0005] Aiming at the problem that there is a lack of broad-spectrum anti-adeno-associated virus (AAV) nanobodies in the prior art, the present invention provides multiple strains of nanobodies that can specifically and sensitively bind to different serotypes of AAV virus, and have good application prospects in the fields of AAV immunoassay and affinity purification.
[0006] To achieve the above object, the present invention is specifically realized through the following technical solutions:
[0007] In the first aspect of the present invention, a nanobody against different serotypes of adeno-associated virus is provided, and the nanobody is selected from at least one of Nb1 to Nb24; wherein: the amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb1-Nb8 are shown in positions 26-33, 51-57, and 96-112 of SEQ ID NO.1-8 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb9-Nb14 are shown in positions 26-33, 51-57, and 96-113 of SEQ ID NO.9-14 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb15-Nb22 are shown in positions 26-33, 51-58, and 97-114 of SEQ ID NO.15-22 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 of nanobody Nb23 are shown in positions 25-32, 50-57, and 96-113 of SEQ ID NO.20 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 of nanobody Nb24 are shown in positions 26-32, 50-57, and 96-113 of SEQ ID NO.20 respectively.
[0008] Furthermore, the amino acid sequences of the variable regions of the heavy chains of nanobodies Nb1 to Nb24 are shown in SEQ ID NO.1-24 respectively.
[0009] Furthermore, the nanobody is selected from at least one of Nb1 to Nb14.
[0010] Furthermore, the nanobody is selected from at least one of Nb15 to Nb24.
[0011] Furthermore, the nanobody is selected from Nb10.
[0012] In a second aspect of the present invention, there is provided a nucleic acid molecule encoding the nanobody described above.
[0013] In a third aspect of the present invention, there is provided a recombinant vector comprising the nucleic acid molecule described above.
[0014] In a fourth aspect of the present invention, there is provided a host cell comprising the recombinant vector described above.
[0015] In a fifth aspect of the present invention, there is provided the use of the nanobody against different serotypes of adeno-associated virus described above in the preparation of an adeno-associated virus detection kit or a purification kit.
[0016] Furthermore, the adeno-associated virus is AAV2, AAV5, AVV8 and AAV9.
[0017] In a sixth aspect of the present invention, there is provided an adeno-associated virus detection kit comprising the nanobody against different serotypes of adeno-associated virus described above.
[0018] In a seventh aspect of the present invention, there is provided an adeno-associated virus purification kit comprising the nanobody against different serotypes of adeno-associated virus described above and a solid-phase carrier.
[0019] The advantages and positive effects of the present invention are as follows:
[0020] The nanobody provided by the present invention can sensitively and specifically bind to AAV, has excellent broad-spectrum recognition and binding ability for various serotypes such as AAV2, AAV5, AAV8 and AAV9, can be used in the field of immunoassay of AAV, and realizes sensitive and efficient detection of virus titer. Moreover, using the nanobody provided by the present invention conjugated with a solid-phase carrier as an affinity filler, it has good adsorption ability for AAV and desorption ability under the eluent, and is expected to be applied to the field of AAV affinity chromatography to improve the virus purification and recovery effect. The present invention provides a good antibody tool for separation, purification, identification and titer detection for the large-scale production and development and application of AAV viruses and vectors. When producing different AAV serotype products, it can reduce the replacement frequency of detection antibodies and / or purification antibodies, improve the versatility, flexibility and efficiency of the production process, greatly reduce the production cost, and has an important market prospect in the field of large-scale AAV vector production and gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the accompanying drawings required for description in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.
[0022] Figure 1 Chromatogram of the sample loading solution of AAV2 virus purified by the nanobody Nb10 conjugated affinity packing material in Example 3 of the present invention;
[0023] Figure 2 Chromatogram of the sample loading solution of AAV5 virus purified by the nanobody Nb10 conjugated affinity packing material in Example 3 of the present invention;
[0024] Figure 3 Chromatogram of the sample loading solution of AAV8 virus purified by the nanobody Nb10 conjugated affinity packing material in Example 3 of the present invention;
[0025] Figure 4 Chromatogram of the sample loading solution of AAV9 virus purified by the nanobody Nb10 conjugated affinity packing material in Example 3 of the present invention;
[0026] Figure 5 SDS-PAGE silver staining detection results of AAV2, AAV5, AAV8, and AAV9 viruses purified by the nanobody Nb10 conjugated affinity packing material in Example 3 of the present invention. Detailed implementation manners
[0027] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further details the present invention in combination with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention. According to the information included in the present invention, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims; it should be understood that all the various changes that those skilled in the relevant art can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.
[0028] To better understand the present invention rather than limit its scope, all the numbers representing amounts, percentages and other numerical values used in the present invention should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to different desired properties. Each numerical parameter should be regarded as obtained at least according to the reported significant figures and by the conventional rounding method.
[0029] In addition, unless otherwise defined, scientific and technical terms used in the present invention have the meanings commonly understood by those of ordinary skill in the art.
[0030] The meanings of the terms "comprising", "including", "containing", "having" and the like are non-restrictive, i.e., other steps and other components can be added without affecting the result. The term "and / or" shall be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is regarded as including the following cases: (i) A, (ii) B, and (iii) A and B. The terms "Nb1", "Nb2", "Nb3", etc. are used to distinguish similar objects and do not necessarily have to be used to describe a specific order or sequence, and it should be understood that such use can be interchanged under appropriate circumstances.
[0031] The terms "adeno-associated virus", "AAV", "AAV vector" and similar words have the same meaning in the present invention. Adeno-associated virus (AAV) exists widely in nature. Its genome is a single-stranded linear DNA with an inverted terminal repeat (ITR) at each end. There are two open reading frames (ORFs), upstream and downstream, in the genome coding region, which encode Rep protein and Cap protein respectively, and they play roles in genome replication, virus assembly and packaging. AAV virus has no envelope structure. Its virus surface is composed of capsid proteins VP1, VP2, and VP3 aggregated in an icosahedral configuration in a ratio of 1:1:10, forming spiky protrusions in structure. These protrusions mediate the recognition of glycosylated receptors on the surface of target cells. Therefore, the AAV capsid protein determines the tissue targeting specificity of different types of AAV and the ability to penetrate cell barriers. Different mutant forms of the capsid protein produce different AAV subtypes, which can be divided into different serotypes according to the results of serum tests. Currently, there are 13 AAV serotypes (AAV1-AAV13); AAV2, AAV5, AAV8, AAV9, etc. are serotypes that have been widely studied and used. The determination of serotypes is usually based on the reactivity of an antibody with one AAV and the lack of cross-reactivity with other or another AAV. This difference in cross-reactivity is usually due to the difference in the capsid protein sequence / epitope. Due to the advantages of wide host range, high safety, low immunogenicity, stable expression and high transduction efficiency of adeno-associated virus, it has been widely used in basic research and gene therapy and has become one of the most commonly used gene delivery vectors. AAV vector is artificially modified on the basis of wild adeno-associated virus. The coding region gene sequence is replaced with the target gene and related functional fragments, and only the ITR sequences at both ends are retained. Therefore, it is also called recombinant adeno-associated virus (rAAV). After the AAV vector infects cells, its capsid protein first binds to specific receptors on the cell surface and enters the cell through receptor-mediated endocytosis. Then the capsid protein will be degraded by the proteasome, the AAV virus uncoats and releases its single-stranded genome, and converts it into a double-stranded DNA template. Transcription and translation of the transgene are carried out on the double-stranded DNA template, thus realizing the expression of the target gene.
[0032] In recent years, significant progress has been made in gene delivery technology using AAV vectors, and the demand for AAV production has been continuously increasing. The detection and purification of AAV viruses are important processes in AAV production. In addition, in the field of gene therapy, accurate determination of AAV titer and improvement of AAV purity are important components of the quality control of gene therapy drugs. Currently, the above-mentioned processes are mostly achieved through antibody-based immunoassay techniques and affinity chromatography purification techniques. However, there is currently little research on anti-AAV antibodies, and most antibodies can only recognize a single serotype, resulting in the need to replace different antibodies for different serotypes of AAV, which greatly increases the production and application costs. Therefore, the development of new broad-spectrum antibodies that specifically target adeno-associated viruses and can bind to multiple serotypes of AAV, especially serotypes commonly used in clinics such as AAV2, AAV5, AAV8, and AAV9, especially nanobodies, is of great significance for large-scale AAV vector production and clinical applications.
[0033] An antibody is an immunoglobulin molecule that can specifically bind to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, unless otherwise specified, the term "antibody" should be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full-length antibodies, antigen-binding fragments of full-length antibodies, or nanobodies, as well as their genetic or chemical modifications, as long as they exhibit the desired antigen-binding activity.
[0034] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). The light chains can be divided into two types, namely κ chains and λ chains; the heavy chains can be classified into five types, namely μ, δ, γ, α, and ε chains, and the antibodies are defined as IgM, IgD, IgG, IgA, and IgE respectively. The amino acid sequences near the N-terminus of the heavy and light chains vary greatly, while the amino acid sequences of other parts are relatively constant. The regions with relatively large amino acid sequence variations near the N-terminus in the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and the variable regions of the light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable regions are also called complementarity-determining regions (CDR), which are loop structures. The CDRs of the heavy chain and the CDRs of the light chain are closely juxtaposed and cooperate with each other through the FR regions to jointly form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the specificity of the antibody and being the site where the antibody recognizes and binds to the antigen. The FR regions are the more conserved parts of VH and VL. They generally assume a β-sheet configuration and are connected by three CDRs forming linker loops. Each VH and VL usually consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
[0035] The CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, the cumulative of the Kabat definition and the Chothia definition, the AbM definition, the contact definition, the IMGT unique numbering definition, and / or the conformational definition or any CDR determination method well-known in the art. As used in the present invention, they are defined by the IMGT numbering system.
[0036] The constant regions of the light chain (CL) and the constant regions of the heavy chain (CH) do not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as participating in antibody-dependent cell cytotoxicity. The lengths of the CLs of different Ig types (κ or λ) are basically the same, but the lengths of the CHs of different Ig classes are different. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the constant regions of the heavy and light chains of the antibody are well-known in the art and can be obtained by querying the IMGT database.
[0037] The "antigen-binding fragment" of an antibody molecule is one or more parts or fragments of the full-length antibody, which substantially retains the same biological function or activity as the full-length form of the antibody. Specifically, the antibody fragment at least includes the same CDR regions as the full-length antibody, and more preferably has the same variable regions, thereby retaining the complete antigen recognition and binding sites and being able to bind to the same antigen as the full-length antibody, especially binding to the same epitope. In a typical example, antibody fragments include: Fab, F(ab) 2 ', Fab', F(ab') 2 2, Fv, (Fv) 2 2, scFv, sc(Fv) 2 2, and these antibody fragments can be obtained by conventional techniques in the art. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment and is a dimer (VH-VL dimer) formed by non-covalent binding of the variable regions of one light chain and one heavy chain, forming an antigen-binding site on the surface of the VH-VL dimer and having the ability to recognize and bind antigens. The single-chain antibody (Single-chain variable fragment, scFv) is composed of one VH and one VL connected by a flexible linker, which can better retain its affinity activity against antigens. Compared with the full-length antibody, scFv has the characteristics of a small molecular weight, so it has higher penetrability and lower immune side reactions.
[0038] The terms "single-domain antibody", "VHH", and "nanobody" have the same meaning in the present invention, and all refer to an antibody composed of only one heavy-chain variable region, which can specifically recognize and bind to AAV. During the long-term evolution process, in the immune systems of some camelid animals, there appeared heavy-chain antibodies (HCAb) that lacked the light chain and the CH1 structure of the heavy chain but completely retained the antigen-binding activity. The region of HCAb that specifically binds to the antigen is its heavy-chain variable region (variabledomain ofheavy chain ofheavy-chain antibody, VHH). The molecular weight of VHH is about 15 kDa, which is only 1 / 10 of the molecular weight of the full-length antibody molecule. Therefore, this antibody containing only one VHH is also called a nanobody (Nb), which is the smallest antigen-binding fragment with complete functions. Nb contains 4 FR regions and 3 CDR regions, and its interaction with the antigen is mediated by three CDR loops. Compared with traditional antibodies, Nb has the advantages of small molecular weight, simple structure, low immunogenicity, small size, strong tissue penetration, good hydrophilicity, and high stability. In addition, the production and purification process of Nb is relatively simple and can be produced through prokaryotic or eukaryotic expression systems, which makes them suitable for large-scale industrial production.
[0039] The antibodies of the present invention can be prepared by conventional methods in the art, such as the well-known hybridoma technology, phage display technology, yeast display technology, single-cell screening or single-cell sequencing technology in the art. Alternatively, based on recombinant expression technology, various antibody genes of the present invention are transformed into suitable host cells, and various antibodies of the present invention are obtained through heterologous expression.
[0040] The term "specific binding" is a well-known term in the art. If a molecule reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity with a specific target antigen or epitope than with other target antigens or epitopes, it exhibits "specific binding". "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.
[0041] The term "broad-spectrum" means that the antibody can recognize and bind to multiple AAV sera, especially the commonly used AAV2, AAV5, AAV8, and AAV9 serotypes in clinics.
[0042] To make the above objects, features, and advantages of the present invention obvious and easy to understand, the following specifically describes the specific embodiments of the present invention with reference to the accompanying drawings.
[0043] An embodiment of the present invention provides a nanobody against different serotypes of adeno-associated virus. The nanobody is selected from any one of Nb1 to Nb24. The nanobody includes 3 complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3 respectively. Among them:
[0044] The amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb1-Nb8 are shown in positions 26-33, 51-57, and 96-112 of SEQ ID NO.1-8 respectively;
[0045] The amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb9-Nb14 are shown in positions 26-33, 51-57, and 96-113 of SEQ ID NO.9-14 respectively;
[0046] The amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb15-Nb22 are shown in positions 26-33, 51-58, and 97-114 of SEQ ID NO.15-22 respectively;
[0047] The amino acid sequences of CDR1, CDR2, and CDR3 of nanobody Nb23 are shown in positions 25-32, 50-57, and 96-113 of SEQ ID NO.20;
[0048] The amino acid sequences of CDR1, CDR2, and CDR3 of nanobody Nb24 are shown in positions 26-32, 50-57, and 96-113 of SEQ ID NO.20.
[0049] The nanobody provided by the present invention can sensitively and specifically bind to AAV, has excellent broad-spectrum recognition and binding ability to multiple serotypes including AAV2, AAV5, AAV8, and AAV9, and can be used in the field of immunoassay of AAV to achieve sensitive and efficient detection of virus titer. Moreover, using the nanobody provided by the present invention conjugated to a solid-phase carrier as an affinity filler, it has good adsorption ability to AAV and desorption ability under the eluent, and is expected to be applied in the field of AAV affinity chromatography to improve the virus purification and recovery effect. The present invention provides a good antibody tool for separation, purification, identification, and titer detection of AAV virus and vectors. When producing different AAV serotype products, it can reduce the frequency of replacement of detection antibodies and / or purification antibodies, improve the versatility, flexibility, and efficiency of the production process, greatly reduce the production cost, and has important market prospects in the fields of large-scale AAV vector production and gene therapy.
[0050] Optionally, the nanobody further includes 4 framework regions (FR1, FR2, FR3, and FR4 in sequence), and the 4 FRs and 3 CDRs are arranged alternately in sequence to form the variable heavy chain region (VHH) of the nanobody. Among them: the amino acid sequences of the variable heavy chain regions of nanobodies Nb1 to Nb24 are shown in SEQ ID NO.1-24 respectively.
[0051] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the foregoing nucleic acid molecule, or a host cell containing the foregoing nucleic acid molecule, and the nucleic acid molecule encodes the nanobody as described above.
[0052] The nucleic acid molecule can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). The DNA can be single-stranded or double-stranded, and can also be a coding strand or a non-coding strand. The sequence of the nucleic acid molecule can be obtained by conventional means such as codon coding rules based on the amino acid sequence of the antibody.
[0053] The nucleic acid molecule can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). The DNA can be single-stranded or double-stranded, and can also be a coding strand or a non-coding strand. The sequence of the nucleic acid molecule can be obtained by conventional means such as codon coding rules based on the amino acid sequence of the antibody. The full-length sequence or a fragment of the nucleic acid molecule can usually be obtained by PCR amplification, recombination, or artificial synthesis methods.
[0054] The original vector for constructing the recombinant vector is various conventional vectors in the art, as long as it can accommodate the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, phages (such as λgt4λB, λCharon, λΔz1, and M13), cosmids, and minichromosomes. Plasmids are the most common form of vectors. Therefore, in the context of the present invention, vectors and plasmids can be used interchangeably. The vector can be a cloning vector (i.e., used to transfer the nucleic acid molecule into a host and multiply it in large quantities in the host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). Inserting the nucleic acid molecule into a suitable vector to form a cloning vector or an expression vector carrying the nucleic acid molecule is a well-known technique in the art.
[0055] The introduction of the recombinant vector into the host cell can be carried out by conventional techniques well-known to those skilled in the art. When the host is a prokaryote such as Escherichia coli, competent cells capable of absorbing DNA are harvested after the exponential growth phase, and are treated with CaCl 2 method or MgCl 2Treatment can also be achieved by microinjection, electroporation, liposome packaging, etc. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co - precipitation method, microinjection method, electroporation method, liposome packaging or gene gun bombardment, etc. to achieve gene introduction.
[0056] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include, but are not limited to, Escherichia coli (such as DH5α, JM109, BL21, W3110, SHuffle T7), Bacillus genus (such as Bacillus subtilis, Bacillus thuringiensis), Enterobacteriaceae strains (such as Salmonella typhimurium, Serratia marcescens) and Pseudomonas genus. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHODG44, CHO - S, COS - 7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK and HEK293 cell lines. After obtaining the host cells transfected or transformed with the recombinant vector as described above and culturing them under suitable conditions, the antibody can be expressed, and then isolated to obtain the purified antibody.
[0057] In a preferred embodiment, the above - mentioned recombinant vector is a prokaryotic expression vector PET25b, and the host cell is an Escherichia coli cell, such as Escherichia coli Rosetta(DE3). The method for preparing the antibody includes loading the gene encoding the heavy - chain variable region of the antibody between the NcoI and NheI restriction enzyme cleavage sites of the expression vector PET25b, transforming Escherichia coli Rosetta(DE3), then inducing the culture of the recombinant Escherichia coli cells, collecting the cell culture supernatant, and purifying to obtain the target antibody strain. The purification method adopts the conventional methods in the art, such as ion chromatography, affinity chromatography, etc.
[0058] Another embodiment of the present invention provides the use of the nanobodies against different serotypes of adeno - associated virus as described above in the preparation of an adeno - associated virus detection kit or purification kit.
[0059] The nanobodies of the present invention have specific and high - affinity binding ability to the AAV virus, can capture the AAV virus particles in the solution, and achieve efficient, accurate and sensitive detection of the virus. In addition, based on its ability to bind to the AAV virus, it can be used as an affinity filler to adsorb the AAV virus, and then the purified virus particles can be obtained by elution.
[0060] When used for detecting AAV, a nanobody can be conjugated with a detection label, and then the nanobody of the present invention is used to bind to the AAV antigen in the sample to be detected. Subsequently, qualitative or quantitative detection of AAV is achieved by analyzing the recognizable signal generated by the detection label. In some other embodiments, instead of labeling the anti-human AAV nanobody (as the primary antibody or capture antibody), the detection label is conjugated to a secondary antibody (detection antibody) or other molecules that can bind to the primary antibody. Thus, the secondary antibody conjugated with the detectable label specifically binds to the primary antibody to produce a change in the recognizable signal, such as the enzyme-linked immunosorbent assay system established in Example 2 of the present invention.
[0061] The above-mentioned detection labels for generating changes in recognizable signals include but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP, and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies, or combinations thereof. Detection methods include but are not limited to: enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), immunoblotting (WB), immunoprecipitation (IP), and flow cytometry (FC).
[0062] When used for purifying AAV, the nanobody of the present invention is conjugated with a solid-phase carrier to prepare an affinity packing material. Then, the affinity packing material is contacted with the sample solution to adsorb the AAV virus particles in the solution. Subsequently, the solid-phase carrier is separated from the sample and the adsorbed AAV is eluted.
[0063] The above-mentioned solid-phase carriers include but are not limited to: polymer microspheres, agarose gel microspheres, cellulose spheres, silica microspheres, magnetic microspheres, dextran, activated carbon, or resin microspheres.
[0064] Optionally, the adeno-associated virus is AAV2, AAV5, AVV8, and AAV9.
[0065] When detecting AAV5, AVV8, and AAV9, preferably, the nanobody is selected from at least one of Nb1 to Nb14.
[0066] When detecting AAV2, AAV5, AVV8, and AAV9, preferably, the nanobody is selected from at least one of Nb15 to Nb24.
[0067] When purifying AAV2, AAV5, AVV8, and AAV9, preferably, the nanobody is selected from Nb10.
[0068] Based on the same inventive concept described above, an embodiment of the present invention further provides an adeno-associated virus detection kit, which includes the nanobodies against different serotypes of adeno-associated virus as described above.
[0069] In addition, an embodiment of the present invention further provides an adeno-associated virus purification kit, which includes the nanobodies against different serotypes of adeno-associated virus and a solid-phase carrier as described above.
[0070] The present invention will be further described below in conjunction with specific embodiments. For the experimental methods without specific conditions indicated in the following embodiments, they are usually carried out under conventional conditions, such as those in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" published by Cold Spring Harbor Laboratory or the conditions recommended by the manufacturer.
[0071] Example 1 Preparation of Nanobodies Against Adeno-Associated Virus (AAV)
[0072] In this example, a mixture of equal titers of AAV2, AAV5, AAV8, and AAV9 viruses was used as an antigen to immunize alpacas. Then, specific B lymphocytes were isolated from the peripheral blood of the antigen-immunized alpacas, mRNA was extracted and reverse-transcribed into cDNA, PCR amplification was performed using VHH-specific primers to obtain the VHH gene, which was then cloned into a phage display expression vector to generate a library. Finally, the target antibody strains (Nb1 - Nb24) were obtained through antigen-binding experiments and other screening methods.
[0073] In the subsequent large-scale production of nanobodies, the VHH gene molecules obtained in the above process were constructed into an expression vector and transformed into host cells, and then the nanobodies of the present invention could be expressed in large quantities. The antibody sequencing work was completed by Suzhou Genewiz, Inc. The amino acid (AA) sequences of the antibodies are shown in Table 1, where CDR1 - 3 represent complementarity-determining regions CDR1 - 3 respectively, and the antibody amino acid sequences are divided based on the IMGT numbering rules.
[0074] Table 1 Summary of Nanobody Sequence Information in the Embodiment of the Present Invention
[0075]
[0076]
[0077]
[0078] 1.1 Alpaca Immunization and B Lymphocyte Isolation
[0079] A mixture of equal titers of AAV2, AAV5, AAV8, and AAV9 viruses was subcutaneously injected at multiple points in the neck to immunize an adult healthy alpaca. The immunization dose was 1×10 per alpaca injection 11A total of 3 immunizations were performed with virus particles (vp), and the immunization interval was 2 weeks. After the immunization, 50 mL of alpaca peripheral blood was collected, and B lymphocytes were isolated using lymphocyte separation medium (purchased from Solarbio, product number P8900).
[0080] 1.2 Construction of nanobody phage display library
[0081] TRIzol TM Reagent kit (purchased from Thermo Fisher, product number 15596018) was used to extract total RNA from B lymphocytes, and cDNA was reverse-transcribed. Using this as a template, the VHH gene was amplified by nested PCR. The DNA polymerase used in PCR was Taq enzyme (purchased from TAKARA, product number R001A), and the PCR program was set according to the Taq instruction manual. The amplified VHH gene fragment and the phagemid display vector pComb 3XSS were digested with Sfil restriction endonuclease respectively. Then, the VHH gene fragment and the linearized vector pComb 3XSS obtained by enzyme digestion were ligated using T4 DNA ligase, and the ligation product was recovered. The ligation product was electrotransformed into Escherichia coli (E. coli) TG1 competent cells to obtain a nanobody phage screening library. The library capacity was determined by the plate gradient dilution method to be 1.83×10 9 , and the cloning efficiency of the target gene inserted into the vector was 98%.
[0082] The first-round primers for nested PCR were F1: 5’-CTTGGTGGTCCTGGCTGC-3’ (see SEQ ID NO.25) and R1: 5’-GGTACGTGCTGTTGAACTGTTCC-3’ (see SEQ ID NO.26); the second round was F2: 5’-CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC-3’ (see SEQ ID NO.27), R2: 5’-CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG-3’ (see SEQ IDNO.28) and R3: 5’-CATGCCATGACTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG-3’ (see SEQ ID NO.29).
[0083] 1.3 Enrichment and screening of phage library
[0084] (1) First-round screening: The AAV5 virus was coated on a microplate at 100 μL / well, and the virus coating dose was 1×10 11Coat overnight at 4 °C with vp / mL. The next day, block with 1% bovine serum albumin (BSA), and wash the microplate with PBST. Add 100 μL of the above-mentioned constructed nanobody phage display library, incubate at 37 °C for 1 h to bind, then remove the unbound library, and wash the microplate with PBST and PBS respectively. Add 100 μL of Gly-HCl buffer (pH 2.2) to the microplate to dissociate specific phages, gently shake for 10 min, and collect the eluate. Infect E. coli TG1 in the logarithmic growth phase with the eluate, take a small amount of the infected E. coli TG1 and determine the titer of the eluate by the plate gradient dilution method, and amplify the remaining to obtain an anti-AAV5 specific phage enriched library.
[0085] (2) Second round of screening: Use the same operation as in "(1) First round of screening", the only difference is that the coated virus is AAV8, and bind 100 μL of the enriched library obtained from the first round of screening to the microplate coated with AAV8 virus. After elution and PCR library amplification operations, obtain an anti-AAV5 and AAV8 specific phage enriched library.
[0086] (3) Third round of screening: Use the same operation as in "(1) First round of screening", the only difference is that the coated virus is AAV2, and bind 100 μL of the enriched library obtained from the second round of screening to the microplate coated with AAV2 virus. After elution and PCR library amplification operations, obtain an anti-AAV2, AAV5 and AAV8 specific phage enriched library.
[0087] (4) Fourth round of screening: Use the same operation as in "(1) First round of screening", the only difference is that the coated virus is AAV9, and bind 100 μL of the enriched library obtained from the third round of screening to the microplate coated with AAV9 virus. After elution and PCR library amplification operations, obtain a broad-spectrum and specific phage enriched library against AAV2, AAV5, AAV8 and AAV9.
[0088] Infect the phage enriched library obtained from the fourth round of screening into E. coli TG1, randomly pick monoclonal colonies from the culture dish for measuring the titer, inoculate them into a 2 mL deep well plate, and culture at 30 °C until OD 600 is about 0.5, induce the expression of VHH with IPTG at a final concentration of 4 mM, and centrifuge to collect the bacterial culture supernatant containing nanobodies. Use the enzyme-linked immunosorbent assay (ELISA) method to identify the specific reaction of the antibody against antigens AAV2, AAV5, AAV8 and AAV9 viruses, including the following steps: coat 1×10 11AAV2 virus at vp / mL, then blocked with 5% skim milk, and then added with appropriately diluted supernatant of induced expression. After binding at 37°C for 1 h, the unbound antibody was washed, and then added with HRP-conjugated rabbit anti-goat secondary antibody diluted 1:5000 (Rabbit Anti-Camelid VHH Cocktail [HRP], purchased from GenScript Biotech Corporation, product number A02016). After binding at 37°C for 1 h, TMB substrate solution was added for color development after washing, and the absorbance was read at a wavelength of 450 nm. Negative control (no supernatant of nanobody induced expression) and blank well (buffer) were set. If the OD value of the well to be tested was more than 3 times that of the negative control, it was determined to be positive.
[0089] The clones corresponding to the positive wells were selected for bacterial preservation, and then the vectors were extracted for sequencing to obtain the VHH coding gene sequence. After translating the DNA sequence into amino acid sequence and comparing, the clones with the same CDR1, CDR2, and CDR3 sequences were regarded as the same antibody strain, and the clones with different CDR sequences were regarded as different antibody strains. The detection results of positive clones are shown in Table 2, and the corresponding antibody sequences are shown in Table 1.
[0090] Table 2 Reactivity of nanobody phage display library against AAVx virus (x = 2, 5, 8 or 9)
[0091]
[0092] 1.4, Large-scale production of nanobodies against AAVx (x = 2, 5, 8 or 9)
[0093] The VHH-encoding gene fusion sequence with a 6×His tag at the N-terminus was synthesized by whole gene synthesis. Subsequently, the fusion gene was inserted between the NcoI and NheI restriction sites of the PET25b vector. The obtained expression vector PET25b was transformed into Escherichia coli Rosetta(DE3) competent cells to obtain the VHH-expressing recombinant strain. The recombinant strain was inoculated into LB medium containing 50 μg / mL ampicillin (Amp) at an inoculum size of 1%, and cultured with shaking at 37 °C until OD600 = 0.8. Then, 0.5 mM IPTG was added, and induction was carried out at 22 °C and 200 rpm for 16 h. After centrifugation to discard the supernatant, the cells were resuspended in 20 mL of PBS (20 mM, pH = 7.4) buffer, and then centrifuged again to discard the supernatant. The washed cell pellet was resuspended in 20 mL of PBS, and the cell suspension was sonicated for 3 - 5 min until the solution became clear. Then, it was centrifuged at 10000 rpm for 20 min to separate the supernatant. The cell lysate supernatant was purified by a nickel column (SC-Ni NTA FF column packing, from Shangchun Biotech (Wuhan) Co., Ltd., product number SCB0E005B). The column was washed with 10 column volumes (CV) of washing buffer (PBS + 10 mM imidazole), and the target protein was eluted with 2 CV of elution buffer (PBS + 250 mM imidazole). The eluted sample was dialyzed in PBS buffer at 4 °C for 16 h, and then concentrated to 2 mL using a 3 kDa ultrafiltration tube to obtain the purified nanobody. The protein concentration was determined by the BCA method, and the purity was detected by SDS-PAGE. The antibody purity was >95%.
[0094] Example 2: Testing the binding ability of the nanobody to AAVx (x = 2, 5, 8, or 9)
[0095] The specific binding ability of the antibody to the antigens AAV2, AAV5, AAV8, and AAV9 viruses was identified by ELISA, including the following steps: Dilute the AAVx (x = 2, 5, 8, or 9) virus to 1×10 11 vp / mL, and coat a 96-well plate at 100 μL / well. Then, block it with 5% skim milk. Subsequently, add the gradient-diluted nanobody (primary antibody) solution and incubate at 37 °C for 1 h. After the incubation of the primary antibody is completed, wash the 96-well plate with PBST, and then add the HRP-conjugated rabbit anti-goat secondary antibody (Rabbit Anti-Camelid VHH Cocktail [HRP]) diluted 1:5000 and bind at 37 °C for 1 h. After washing with PBST, add the TMB substrate solution for color development for 15 min, and then add 2M H 2 SO 4 to terminate the color development, and read the absorbance value at a wavelength of 450 nm. Calculate the half-maximal effective concentration (EC 50 , unit: ng / mL), and the results are shown in Table 3.
[0096] Table 3 Binding ability test of nanobodies to AAVx viruses (x = 2, 5, 8, or 9)
[0097] Number Antibody Strain <![CDATA[AVV2EC 50 > <![CDATA[AVV5EC 50 > <![CDATA[AVV8EC 50 > <![CDATA[AVV9EC 50 > SC007 Nb1 >1000 33.3 17.4 18.9 SC080 Nb2 >1000 24.2 13.2 13.5 SC017 Nb3 >1000 43.0 20.7 22.4 SC043 Nb4 >1000 53.4 25.1 33.0 SC079 Nb5 >1000 66.9 78.2 46.3 SC013 Nb6 775.7 21.3 57.5 54.0 SC044 Nb7 >1000 103.1 62.4 78.8 SC081 Nb8 >1000 26.4 11.5 17.4 SC016 Nb9 >1000 58.2 103.1 102.4 SC015 Nb10 >1000 73.7 356.4 574.7 SC014 Nb11 >1000 189.4 243.7 369.1 SC025 Nb12 >1000 99.9 148.7 222.3 SC078 Nb13 >1000 198.2 84.4 136.7 SC012 Nb14 >1000 156.2 62.8 112.2 SC067 Nb15 399.4 701.7 214.3 267.8 SC068 Nb16 305.7 643.9 158.4 187.3 SC069 Nb17 224.7 611.7 105.9 112.7 SC070 Nb18 292.3 581.7 124.8 197.9 SC071 Nb19 304.1 596.3 247.5 310.0 SC076 Nb20 249.2 589.1 122.0 174.3 SC074 Nb21 261.2 705.1 128.3 156.7 SC073 Nb22 301.3 699.0 175.2 193.4 SC072 Nb23 265.1 609.4 132.8 139.2 SC075 Nb24 282.3 607.8 164.2 193.1
[0098] Note: >1000 indicates weak binding and the EC could not be accurately measured 50 。
[0099] As can be seen from Table 2, the nanobodies provided by the present invention have broad-spectrum binding ability to AAV2, AAV5, AVV8, and AAV9 viruses. Among them, nanobodies Nb1-Nb14, especially Nb1-Nb9, have stronger binding ability to AAV5, AVV8, and AAV9 serotypes, and their EC 50 is generally low, and the binding ability to AAV2 serotype is weak. Nanobodies Nb15-Nb24 have stronger binding ability to AAV2, AVV8, and AAV9 serotypes and medium binding ability to AAV5 serotype.
[0100] Example 3 Preparation of nanobody affinity packing material and purification performance test of AAVx (x = 2, 5, 8, or 9)
[0101] The nanobody of the present invention can specifically bind to AAV, conjugate it to a solid-phase carrier, and prepare an affinity filler for purifying AAV. Specifically, it includes: (1) Preparation of pre-activated affinity filler: Take 2 g of NHS 4FF pre-activated agarose (the filler is from Shangchun Biotechnology (Wuhan) Co., Ltd., product number SCB0E009), filter and wash it three times with pre-cooled 1 mM hydrochloric acid (0 - 4 °C), and wash for at least 10 min each time; (2) Preparation of nanobody solution: Exchange the purified nanobody solution into the conjugation buffer with a 3KDa ultrafiltration membrane (from Hangzhou KeBaiTe Filter Equipment Co., Ltd., model UFELA0003001P), and determine the protein concentration by the BCA protein quantification method. The conjugation buffer is selected according to the activated filler. In this example, sodium bicarbonate buffer (pH 8.5) is used; (3) Conjugation of nanobody to affinity filler: Add 2 g of NHS 4FF affinity filler to 6 mL of nanobody solution, with a mass ratio of filler to nanobody of 1 g:10 mg, react at 28 °C and 250 rpm for 3.5 h, and after the reaction, seal it overnight with 1 M ethanolamine (pH 8.0) to obtain the AAV affinity filler conjugated with nanobody; (4) Preparation of AAV virus loading solution: Lyse the harvested AAV virus solution obtained after fermentation with Tween-20, add nuclease and incubate. The incubated fermentation broth is filtered through a 0.22 μm filter membrane to obtain the AAV supernatant. The supernatant is concentrated and exchanged with an ultrafiltration membrane to make the AAV sample after exchange consistent with the affinity filler equilibration solution. The sample after exchange is passed through a 0.22 μm filter membrane, and the filtered solution is collected as the loading solution for the affinity filler; (5) Purification of AAV virus affinity filler: Load 1 mL of AAV affinity filler into a chromatography column, and load the AAV2, AAV5, AAV8, and AAV9 virus loading solutions respectively to detect the purification effect; Before purification, equilibrate the chromatography column with PBS equilibration solution. After loading, elute the chromatography column with citric acid (pH 2.5), phosphoric acid (pH 1.9), and 4 M guanidine hydrochloride respectively, and then use qPCR method to detect the virus genome titer in the eluted sample. Calculate the AAV purification recovery rate according to the virus genome titer before and after sample purification. The recovery rate calculation method is the percentage of the virus genome titer in the purified sample to the virus genome titer in the loading solution. At the same time, use SDS-PAGE silver staining to detect the purity of the eluted sample.
[0102] The qPCR method is operated as follows: After diluting the sample 10 - 100 times with purified water, take 200 μL of the diluted sample for double - enzyme treatment with nuclease and proteinase K. After the treatment, the sample is further diluted by an appropriate multiple, and then the qPCR system is configured and qPCR detection is carried out. The qPCR system includes: 0.3 μL of forward primer (10 μM), 0.3 μL of reverse primer (10 μM), 5 μL of iTaq Universal SYBR Green Supermix (Bio - Rad, catalog number 1725125), and make up to 8 μL with pure water. The qPCR reaction program is: 95°C for 3 min; 95°C for 10 s; 60°C for 30 s, for a total of 40 cycles. The primers are as follows:
[0103] Q - F: CCGTTGTCAGGCAACGTG (see SEQ ID NO.30);
[0104] Q - R: AGCTGACAGGTGGTGGCAAT (see SEQ ID NO.31).
[0105] The nanobodies of the present invention have similar properties. Taking SC015 (antibody strain Nb10) as an example, it was prepared into an AAV affinity packing material and a series of tests were carried out. Figures 1 - 4 The chromatograms of the affinity packing material conjugated with the nanobody Nb10 of the present invention for purifying the AAV2, AAV5, AAV8, and AAV9 virus loading solutions are respectively shown. Among them, the red line is the absorbance curve at a wavelength of 260 nm, and the blue line is the absorbance curve at a wavelength of 280 nm. Tables 4 - 7 respectively show the qPCR detection results of the affinity packing material conjugated with the nanobody Nb10 of the present invention for purifying AAV2, AAV5, AAV8, and AAV9 viruses. Among them, AC - Load is the sample before purification of the adeno - associated virus. This sample has been clarified and filtered and has been exchanged into the PBS equilibration solution in the purification step. AC - FT represents the flow - through in the purification step, AC - E represents the virus eluate in the purification step, and most of the purified virus will be eluted in the citric acid (PH2.5) eluate. AC - CIP represents the eluate after the chromatographic column is washed and regenerated with guanidine hydrochloride in the purification step. Figure 5 The SDS - PAGE silver staining detection results of the affinity packing material conjugated with the nanobody Nb10 of the present invention for purifying AAV2, AAV5, AAV8, and AAV9 viruses are shown. Among them, the lane Marker represents the molecular marker, the lane loading solution is the sample before purification of the adeno - associated virus, the lane flow - through is the flow - through in the purification step, and the lane collected solution is the virus eluate in the purification step.
[0106] Table 4 qPCR detection results of the purification of AAV2 virus by the affinity packing material conjugated with nanobody Nb10
[0107] Sample Name Virus Titer Volume Total Virus Recovery Rate AAV2AC-Load 7.54E+12 18 1.36E+14 N / A AAV2AC-FT 5.25E+11 32.16 1.69E+13 12.44% AAV2AC-E 7.72E+12 6.95 5.36E+13 39.49% AAV2AC-CIP 3.98E+12 4.12 1.64E+13 12.07%
[0108] Table 5 qPCR detection results of AAV5 virus purified by nanobody Nb10 conjugated affinity packing
[0109] Sample Name Virus Titer Volume Total Virus Recovery Rate AAV5AC-Load 8.08E+12 19.50 1.57E+14 N / A AAV5AC-FT 5.37E+11 33.61 1.80E+13 11.45% AAV5AC-E 6.69E+12 13.38 8.95E+13 56.84% AAV5AC-CIP 3.46E+12 7.67 2.65E+13 16.85%
[0110] Table 6 qPCR detection results of AAV8 virus purified by nanobody Nb10 conjugated affinity packing
[0111] Sample Name Virus Titer Volume Total Virus Recovery Rate AAV8AC-Load 9.75E+12 19.5 1.90E+14 N / A AAV8AC-FT 6.85E+11 33 2.26E+13 11.89% AAV8AC-E 1.01E+13 10.9 1.10E+14 57.86% AAV8AC-CIP 4.26E+12 2.49 1.06E+13 5.58%
[0112] Table 7 qPCR detection results of AAV9 virus purified by nanobody Nb10 conjugated affinity packing
[0113] Sample Name Virus Titer Volume Total Virus Recovery Rate AAV9AC-Load 7.38E+12 15 1.11E+14 N / A AAV9AC-FT 4.62E+10 39.751 1.84E+12 1.66% AAV9AC-E 2.47E+13 4.112 1.02E+14 91.80% AAV9AC-CIP 4.08E+12 1.878 7.66E+12 6.92%
[0114] Note: E represents the exponent with base 10. For example, 7.54E+12 means 7.54×10 12 。
[0115] From Figures 1 - 5 Tables 4 - 7, it can be seen that Nb10 conjugated affinity packing can be used to purify AAV2, 5, 8, and 9 viruses. During the purification process, the viruses can be captured and eluted very gently; the purified viruses have high purity and high recovery rate, which proves that nanobody Nb10 can be used for the affinity purification of viruses.
[0116] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A nanobody against different serotypes of adeno-associated viruses, characterized in that: The Nanobody is selected from one of Nb1 to Nb24; wherein: The amino acid sequences of CDR1, CDR2 and CDR3 of Nanobodies Nb1-Nb8 are shown at positions 26-33, 51-57 and 96-112 of SEQ ID NOs. 1-8, respectively; The amino acid sequences of CDR1, CDR2 and CDR3 of Nanobodies Nb9-Nb14 are shown in SEQ ID NOs. 9-14 at positions 26-33, 51-57 and 96-113, respectively; The amino acid sequences of CDR1, CDR2 and CDR3 of Nanobodies Nb15-Nb22 are shown in SEQ ID NOs. 15-22 at positions 26-33, 51-58 and 97-114, respectively; The amino acid sequences of CDR1, CDR2 and CDR3 of Nanobody Nb23 are shown in SEQ ID NO. 20 at positions 25-32, 50-57 and 96-113; The amino acid sequences of CDR1, CDR2 and CDR3 of Nanobody Nb24 are shown in SEQ ID NO.20 at positions 26-32, 50-57 and 96-113.
2. The nanoantibody against different serotypes of adeno-associated viruses according to claim 1, characterized in that: The amino acid sequences of the heavy chain variable regions of Nanobodies Nb1 to Nb24 are shown in SEQ ID NO.1-24, respectively.
3. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the nanobody against different serotypes of adeno-associated virus as described in any one of claims 1-2.
4. A recombinant vector, characterized in that: Comprising the nucleic acid molecule as claimed in claim 3.
5. A host cell, characterized in that Comprising the recombinant vector as described in claim 4.
6. Use of the nanoantibodies against different serotypes of adeno-associated viruses as described in any one of claims 1-2 in the preparation of an adeno-associated virus detection kit or purification kit.
7. Use of the nanoantibodies against different serotypes of adeno-associated viruses according to claim 6 in the preparation of an adeno-associated virus detection kit or purification kit, characterized in that: The adeno-associated viruses are AAV2, AAV5, AVV8 and AAV9.
8. Use of the nanoantibodies against different serotypes of adeno-associated viruses according to claim 7 in the preparation of an adeno-associated virus detection kit or purification kit, characterized in that: When preparing an adeno-associated virus detection kit for detecting AAV5, AVV8 and AAV9, the nanoantibody is selected from at least one of Nb1 to Nb14; when preparing an adeno-associated virus detection kit for detecting AAV2, AAV5, AVV8 and AAV9, the nanoantibody is selected from at least one of Nb15 to Nb24; when preparing an adeno-associated virus purification kit for purifying AAV2, AAV5, AVV8 and AAV9, the nanoantibody is selected from Nb10.
9. An adeno-associated virus detection kit, characterized in that: It comprises nanobodies against different serotypes of adeno-associated viruses as described in any one of claims 1-2.
10. An adeno-associated virus purification kit, characterized in that: It comprises a nanobody against different serotypes of adeno-associated virus as described in any one of claims 1-2 and a solid phase carrier.
Citation Information
Patent Citations
Nanometer antibody capable of being combined with multiple AAV serotypes and application thereof
CN116199773A
Nanometer antibody specifically combined with AAV2 and application thereof
CN120399044A
Nanometer antibody specifically binding to AAV9 and application thereof
CN120399045A
Low molecular weight antibody
WO2023282161A1
Cited By
Nanometer antibody specifically combined with AAV2 and application thereof
CN120399044A
A nanobody that specifically binds to AAV2 and its application
CN120399044B